Background
Hypopharyngeal squamous cell carcinoma (HSCC), which originates from a subsite of the upper aerodigestive tract, accounts for 2-6% of head and neck cancers, the 6th most common cancer in the world [
1,
2]. As this type of cancer is initially diagnosed at an advanced stage, thus, therapy for this tumor is one of the most formidable challenges in human malignancies. As such, studies of the molecular biology of this disorder are key issues to get insight into the mechanistic underpinnings of how incipient cells become tumorigenic and malignant ultimately, which may, in turn, lead to offer novel therapeutics to patients with advanced hypopharyngeal cancer, with more expectation of both survival improvement and maximum preservation of hypopharyngeal function. While numerous genetic and epigenetic factors have been found to be involved in the pathogenesis of HSCC, the molecules that participate in tumorigenesis of this kind of carcinoma are still known little. More recently, compelling evidence has indicated the involvement of serine/threonine kinase 33 (STK33) gene in tumorigenesis [
3,
4].
STK33 gene encodes a serine/threonine kinase [
5], which is subsequently identified as a member of the calcium⁄ calmodulin dependent kinase (CAMK) family [
6]. Of note, STK33 involves in the “synthetic lethal” process of a variety of tumor cells, which depends on the Ras oncogene [
4]. This finding implies that STK33 might possess an important value in molecular target therapy for KRAS-dependent tumors. However, a new study demonstrates that STK33 activity is nonessential in KRAS-dependent cancer cells [
7,
8]. The pro and con evidence indicates that the role of STK33 in tumor cells remains controversial and, from another angle, reflects that the mechanism underlying the action of STK33 to alter the nature of tumor may be much more complex [
7-
9].
In comparison to the other members of CAMK family, which are well known to phosphorylate a wide range of substrates and regulate numerous cellular functions [
10], the precise mechanism underlying the actions of STK33, especially, on survival or signaling pathways on tumor cells, however, has been studied sparingly as yet. It has been confirmed that mitogen-activated protein kinase (MAPK) system, which comprises a cluster of a serine/threonine protein kinases, represents one of the most classical signal transduction pathways [
11]. Almost all eukaryotic cells possess multiple MAPK pathways, which generally regulate a variety of cell activities in response to different stimuli. Particularly, extracellular signal-regulated protein kinases 1 and 2 (ERK1/2), the members of the MAPK family, is able to mediate cell proliferation, survival, differentiation and motility etc. [
12], and thus, is widely used throughout evolution in many physiological and pathological processes.
To date, no study has been conducted to investigate STK33 expression in human HSCC as well as the relationship between the STK33 gene and ERK1/2 pathway in carcinogenesis of HSCC. With these points in mind, we firstly examined the expression of STK33 in human HSCC specimen and its association with clinicopathological characteristics and, then, explored whether STK33 gene could affect the biological traits, such as apoptosis, proliferation, metastasis and invasion, as well as epithelial mesenchymal transition (EMT) in Fadu cells, a cell line of human HSCC, and its relationship with ERK1/2 signaling pathway.
Methods
Carcinoma specimens
HSCC specimens and corresponding adjacent normal tissues were obtained from 30 patients who underwent operations at General Hospital of Ningxia Medical University (Yinchuan, P.R. China) from 2010 to 2013. Patients had received neither adjuvant chemotherapy nor radiotherapy prior to surgery. The pathological analysis was conducted according to criteria issued by World Health Organization (WHO) [
13]. Tumor clinical stage was defined according to criteria by American Joint Committee on Cancer (AJCC) [
14]. All the detailed information and clinicopathological parameters of patients in this series were provided in Table
1. This study was reviewed and approved by the Institute Research Ethics Committee of General Hospital of Ningxia Medical University, Yinchuan, P. R. China. All patients provided written informed consent for this research.
Table 1
HSCC patients’ clinicopathological characteristics and IHC staining for STK33
Age
|
<60 years | 13 | 13.69 ± 4.23 | 0.8988 |
≥60 years | 17 | 14.12 ± 2.98 | |
Sex
|
Male | 28 | 13.96 ± 3.65 | 0.8255 |
Female | 2 | 13.50 ± 2.12 | |
Differentiation
c
|
Keratinizing | 888 | 12.95 ± 3.36 | 0.0044* |
Non-keratinzing | 552 | 15.61 ± 3.04 | |
Tumor size
|
≤2 cm | 23 | 12.83 ± 3.27 | 0.0011* |
>2 cm | 7 | 17.57 ± 1.13 | |
Clinical stage
|
I | 9 | 9.78 ± 2.11 | <0.0001* |
II | 4 | 14.25 ± 2.87 | |
III | 5 | 15.60 ± 2.51 | |
IV | 12 | 16.25 ± 2.01 | |
Lymph node metastasis
|
Negative | 24 | 13.29 ± 3.62 | 0.048* |
Positive | 6 | 16.50 ± 1.64 | |
Immunohistochemistry (IHC) and haematoxylin and eosin (HE) staining
Tumor tissues and patient-matched normal hypopharyngeal tissues were fixed in 10% neutral-buffered formalin and embedded in paraffin blocks. 4-μm serial sections were cut, then, IHC and HE staining were carried out. Briefly, tissue sections were performed with citrate buffer (PH = 6.0) and 1.5% hydrogen peroxide in methanol. Slides were incubated with anti-STK33 (1:100, Santa Cruz, CA, USA) at 4°C overnight, then, with second antibody (ZSGB, Beijing, China) at room temperature for 1 h. 3,3’-diaminobenzidine (DAB) was used for visualization of the immunoreaction. As for the HE staining, the sections were stained with hematoxylin and eosin respectively. The process of dehydration, transparence and mounting was similar to that of IHC.
A semiquantitative scoring system named “H-score approach” was used to evaluate the expression level of STK33 [
15]. The proportion of epithelial cells staining positively was termed category A and was assigned scores from 1 to 6 (A = 1 (0-4%); 2 (5-19%); 3 (20-39%); 4 (40-59%); 5 (60-79%); 6 (80-100%). Intensity of staining was termed category B and was scored as 0 (negative); 1 (weak); 2 (moderate); 3 (strong). For the H-score assessment, all fields were observed at × 400 magnification [
16]. A final score was calculated by multiplying A by B (minimum 0, maximum 18). Meanwhile, the average score of each case was obtained.
Cell culture
The human HSCC cell line, Fadu cells, was purchased from Biosis (Shanghai, China). Fadu cells were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum at 37°C in a humid atmosphere containing 5% CO2. Cells were treated with 1 to 10 μM PD98059 (an inhibitor of ERK1/2, Sigma, MO, USA).
Construction of STK33-RNAi lentiviral vector and transfection into Fadu cells
A STK33-RNA interference (STK33-RNAi) lentiviral vector (GV115-GFP-STK33 shRNA) was constructed by GeneChem Co, Ltd (Shanghai, China) and a GFP-lentiviral vector (GV115-GFP) was used as a negative control (Mock RNAi). In brief, after identification of the target sequence of STK33-RNAi (NM_030906, CTCAAGAACCTCAAATGTA), double-stranded oligonucleotides encoding human STK33-vshRNA were annealed and inserted into the small hairpin RNA (shRNA) expression vector GV115-GFP. Next, the lentiviral titers of STK33-RNAi and control mock RNAi were identified. In order to detect the efficiency of transfection in Fadu cells, 2 × 104 Fadu cells were seeded into 15 mm plate specially used for laser scanning confocal microscope and incubated for 24 h. GV115-GFP-STK33-shRNA and GV115-GFP, which were diluted with 270 μl 10% FBS and 30 μl polybrene (50 μg/ml, Sigma, MO, USA), pretreated Fadu cells for 12 h. Subsequently, the solution was replaced with 10% FBS-DMEM. Transfected Fadu cells were observed with laser scanning confocal microscopy everyday.
Assessment for cell viability
The 3-(4, 5-Dimethylthiazol-2-yl)-2, 5-Diphenyltetrazolium Bromide (MTT) assay was used to evaluate the cell viability. In brief, 3 × 10
4/ml (100 μl per well) Fadu cells were seeded in 96-well culture plate and incubated for 24 h, then, replaced with fresh medium containing different concentrations of PD98059 (0, 1, 5, and 10 μM) for another 24, 48 and 72 h incubation, respectively. With respect to the effect of STK33-RNAi related groups, after Fadu cells were transfected with mock RNAi and 1 × 10
7 TU/ml STK33-RNAi for 48 h, cells were subjected to 0 and 5 μM PD98059 for another 48 h. Then, 20 μl MTT (5 mg/ml) was added into each well and incubated at 37°C for additional 4 h. Subsequently, the supernatant was removed, 100 μl DMSO was added into each well and shaken for another 20 min until the crystals were dissolved. The optical density (OD) values were measured at 570 nm using an ELISA reader (Multiskan MK3, Finland). Cell viability was calculated according to the following formula:
$$ Cell\ relative\kern0.3em viability\ \left(\%\right) = O{D}_{experiment}/O{D}_{control}\times 100\%\left(O{D}_{\mathrm{blank}}\mathrm{is}\ \mathrm{adjusted}\ \mathrm{t}\mathrm{o}\ \mathrm{zero}\right) $$
Morphological examination by Ho.33342 (HO) and Propidium Iodide (PI) double fluorescent staining
2 × 10
4 Fadu cells/ml were seeded in dishes (20 mm) for 24 h. Cells were transfected with mock RNAi and 1 × 10
7 TU/ml STK33-RNAi for 48 h followed by the administration of 0 and 5 μM PD98059 for another 48 h. Then, cells were washed twice by PBS, fixed with 95% alcohol for 10 min, and stained by Ho (10 μg/ml) and PI (50 μg/ml) at 37°C for 30 min. Laser scanning confocal microscopy was used to observe the morphological changes of Fadu cells with green light (488 nm) for blue nucleus and red light (532 nm) for red cells respectively, later, the two pictures were integrated together as one. The number of dead cells within every 200 cells were counted [
17].
500 cells/per pore were seeded into 6-well plate and cultured for 24 h. Next, cells were transfected with mock RNAi and 1 × 10
7 TU/ml STK33-RNAi for 48 h and cells were treated with 0 and 5 μM PD98059 every 3 d till 10 d. Then, cells were washed twice with PBS, fixed with 95% alcohol for 10 min and stained with crystal violet for 10 min, subsequently, washed with water till the plates were clear. Finally, the number of colonies where the number of cells exceeded 50 was counted [
18].
Assessment of cell migration and invasion
A Costar Transwell chamber (Corning, NY, USA) was employed to assess cell migration. As for cell invasion assay, the membrane was covered with matrigel (BD, MA, USA). Firstly, Fadu cells were transfected with mock RNAi and 1 × 107 TU/ml STK33-RNAi for 48 h. Then, 100 μl (1 × 104/ml) cell suspension with serum-free DMEM, which simultaneously contained PD98059 at final concentrations of 0 and 5 μM, was individually added into the upper chamber and 500 μl complete medium was consistently placed into the lower chamber. These cells were incubated at 37°C for 48 h, washed with PBS and fixed by methanol. Then, cells remaining on the upper surface of the filter membrane were completely removed, while, the cells still on the opposite surface of the filter membrane were stained with crystal violet for 10 min. The migratory cells were then observed and counted in six random fields (Magnification 100×).
mRNA extraction and real-time PCR analysis
Fadu cells (1.5 × 10
5 cells/ml, 1 ml) were cultured in 6-well culture plates for 24 h. Then, cells were transfected with mock RNAi and 1 × 10
7 TU/ml STK33-RNAi lentiviral vector for 48 h and cells were treated with 0 and 5 μM PD98059 for another 48 h. These cells were collected for extracting the total RNA with Trizol (Invitrogen, USA). Then, mRNA was reverse transcribed into cDNA (Fermentas, Ontario, Canada) and SYBR Green real-time PCR (Takara, Dalian, China) assay was employed. PCR primers (Sangon Biotech, Shanghai, China) for the genes were listed in Table
2. The conditions were as follows: pre-degeneration at 95°C for 2 min, degeneration at 95°C for 15 sec, renaturation at different temperatures (Table
2), elongation at 72°C for 40 sec, total 40 cycles. The data were analyzed using the Realplex2 Real-Time PCR System (Eppendorf, Hamburg, Germany). The real-time PCR experiments with every gene were carried out in triplicate, and Mean ± SEM was used for the determination of mRNA levels. By use of the comparative Ct method with GAPDH as the reference gene, relative quantification of the mRNA levels was performed with the formula 2
-△△Ct.
Table 2
Primer, amplicon size and annealing temperature of each gene for qRT-PCR
STK33 | CCCCGACTGTTCATCTGCTTCT | TGCCCACTTCGTTTCTGTTTCC | 391 | 54 | Nm_030906.2 |
ERK1/2 | TCCAAGGGCTACACCAAGTC | CTCGTCACTCGGGTCGTAAT | 363 | 60 | Nm_002745.4 |
Caspase-3 | CAGAACTGGACTGTGGCATTG | GCTTGTCGGCATACTGTTTCA | 192 | 54 | Nm_004346.3 |
Bcl-2 | GTGGCCTTCTTTGAGTTCGG | TCCACAGGGCGATGTTGTC | 88 | 55 | Nm_000633.2 |
Ki-67 | TGTCACATCGCTATTTCAAATTCAG | GGAGGGCTTGCAGAGCATTTATC | 170 | 54 | Nm_001145966.1 |
E-Cadherin | GGGGTCTGTCATGGAAGGTGCT | GTAAGCGATGGCGGCATTGTAG | 103 | 57 | Nm_004360.3 |
Vimentin | AGGCAGAAGAATGGTACAAATCC | TTTAAGGGCATCCACTTCACAG | 146 | 55 | Nm_003380.3 |
Nm-23-H1 | CTGGGACCATCCGTGGAGACT | TCCTCAGGGTGAAACCACAAGC | 112 | 55 | Nm_000269.2 |
GAPDH | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA | 130 | 55 | Nm_001289746.1 |
Protein extraction and western blot analysis
Fadu cells (1.5 × 105 cells/ml, 1 ml) were cultured in 6-well culture plates for 24 h. Subsequently, cells were transfected with mock RNAi and 1× 107 TU/ml STK33-RNAi lentiviral vector for 48 h and cells were treated with 0 and 5 μM PD98059 for another 48 h. These cells were used to extract the total protein with lysis buffer (PMSF: RIPA = 1:100) and the concentration of protein was measured with the BCA protein assay kit (Beyotime, Shanghai, China). 35 μg protein was separated by 6% (Ki-67), 10% (E-Cadherin), 12.5% (Vimentin, STK33, β-Actin, ERK1/2) and 15% (Caspase-3, Bcl-2, Nm-23-H1) SDS-PAGE gels. After electrophoresis, transmenbrane and blockage, the PVDF membranes (Millipore, USA) were incubated with primary antibodies overnight at 4°C (anti-STK33: 1:400, anti-Caspase-3: 1:400, anti-Bcl-2: 1:400 (Santa Cruz, CA, USA), anti-ERK1/2: 1:400, (Abcam, Cambridge, USA), anti-E-Cadherin: 1:300, anti-Vimentin: 1:10000, anti-Nm-23-H1: 1:2000, (Epitomics, Calfornia, USA), anti-Ki-67: 1:500, and anti-β-Actin: 1:2000 (Biosynthesis, Beijing, China). Then, the membranes were incubated with the secondary antibody (1:2000) at room temperature for 1 h. Finally, the immunoblots were developed using ECL reagents (Santa Cruz, CA, USA) and detected after exposure to X-ray film. Densitometer readings were carried out to quantitate the immunoreactive bands. The ratios of related-genes to β-actin were then determined.
Statistical analysis
The STK33 IHC scores of each subgroup of clinicopathological parameters in Table
1 were shown as mean ± standard deviation (SD). The Man-Whitney
U test was applied for comparisons between two groups, while, one-way analysis of variance (ANOVA) was used to compare more than two groups. The other data were presented as mean ± standard error of mean (SEM) of separate experiments (n ≥ 3) and statistically analyzed by one-way ANOVA. Statistical calculations were performed using SPSS software package for Windows (version 13.0; SPSS, Chicago, IL).
P value of less than 0.05 was considered significant.
Discussion
Previous studies on human somatic tumors have shown that STK33 acts as a novel tumor gene [
4,
7,
8]. However, these few data published relevant to STK33 expression in different types of tumor are conflicting and the possible role of STK33 on human HSCC has not been investigated to date. In the present study, strong STK33 immunostaining was noted in human HSCC, but, weak staining was presented in corresponding normal tissues. This indicates that STK33 over-expression may play a crucial role in the pathogenesis of HSCC, which is consistent with the findings in other types of tumor [
4,
7,
19]. Meanwhile, we found that STK33 was abundantly expressed at both mRNA and protein levels, confirming the activation of STK33 in Fadu cells. Keratinizing HSCC is well differentiated and associated with a better prognosis, whereas, non-keratinizing HSCC is poorly differentiated and associated with a more aggressive course [
13]. In the present work, the expression of STK33 was markedly elevated in non-keratinizing type than that in keratinizing type. Therefore, the significance of the greater expression of STK33 in non-keratinizing HSCC than in keratinizing type is that STK33 might be related to the dedifferentiation in HSCC. Moreover, statistical analyses showed that there existed significant associations between STK33 expression in HSCC with tumor size, clinical stage, and lymph node metastasis. These results indicate that aberrant expression of STK33 may promote the initiation and progression of HSCC. Our findings highly support an oncogenic role of STK33 in human HSCC, which sheds a new light on the mechanisms underlying the occurrence of HSCC.
To examine the effect of STK33 per se, the STK33 RNAi was generated and introduced into Fadu cell. We found that the cells transfected with STK33 RNAi not only exhibited a marked reduction in STK33 protein expression, but also appeared the morphological change compared with those in the mock RNAi-transfected cells, indicating that the generated STK33 RNAi was effective. Next, we concentrated on exploring whether STK33 knockdown alone or together with PD98059, had the potential to alter the properties of Fadu cells and, if so, the possible mechanism underlying such an action.
In this work, we demonstrated that either STK33-RNAi or PD98059 remarkably reduced cell viability of Fadu cells, implying that STK33-RNAi was able to inhibit the growth of Fadu cells
in vitro. Meanwhile, the exposure of Fadu cells to STK33-RNAi led to cell destruction with specific morphologic features, which were in accordance with typical morphological characteristics of cells undergone apoptosis. This indicates that STK33-RNAi exerts its cytotoxity on Fadu cells is mainly attributable to the induction of apoptosis. Not only that, this cytotoxic effect was potentiated by the administration of PD98059 at the minimum dose, exhibiting a synergistic effect of the two insults. Moreover, the ability of colony formation is necessary for a tumor cell growing to a micro- lesion and furthermore developing into macro-lesion [
20]. We found STK33-RNAi caused a marked reduction in colony number of Fadu cells, which means STK33-RNAi may suppress the coloning proliferation of Fadu cells, while, PD98059 may potentiate the effect. These data reveal that STK33 is an important factor and that a cross-talk network exists between STK33 and ERK1/2 in the regulation of survival and proliferation in Fadu cells.
It has been well known that cytochrome c is released from mitochondria to cytoplasm, which in turn activates a series of other apoptosomes and, particularly, the activation of Caspase-3 responsible for the execution of the apoptotic program in response to apoptotic signals [
21]. In the present study, the activities of Caspase-3 were remarkably up-regulated by STK33-RNAi, suggesting that STK33 knockdown -induced apoptosis in Fadu cells is depend on mitochondrial pathway. It is well known that proteins of the Bcl-2 family, which generally either repress apoptosis or promote apoptosis, play a key role in controlling the activation of caspases [
22]. In this work, a decrease in expression of Bcl-2 were observed after exposure to STK33-RNAi, indicating that STK33 knockdown triggers apoptosis by down-regulating the activities of anti-apoptotic Bcl-2, thereby revealing another mechanism underlying the action of STK33 knockdown on Fadu cells. As Ki67 universally expresses among proliferating cells and is absent in quiescent cells, it is commonly used as a marker for the evaluation of cell proliferation [
23]. We found that STK33-RNAi significantly suppressed Ki-67 expressions at mRNA and protein levels, further revealing the inhibitory trait of STK33 knockdown on Fadu cells. In addition, PD98059 acts cooperatively with STK33-RNAi to affect the expressions of these genes, providing additional proof for a cross-talk interaction between STK33 and ERK1/2 in Fadu cells.
Tumor cell invasion and metastasis are complex processes that involve multiple steps [
19]. In the present investigation, STK33 knockdown altered the migratory and invasive phenotype of the cells. Similarly, such effects by STK33-RNAi were enhanced with PD98059. Epithelial-mesenchymal transition (EMT) is a process by which epithelial cells lose their polarity and are converted to a mesenchymal phenotype, which represents an important pathway to mediate invasion and metastasis of tumors [
24]. A defining feature of EMT is a reduction in E-Cadherin level and a concomitant induction of higher expression of Vimentin [
25]. It has been documented that ERK1/2 pathway is involved in EGF-induced EMT and PD98059 diminished the EGF-induced EMT in SBOT cells [
26,
27]. As for the relationship between STK33 and EMT, it was reported that STK33 exhibited autophosphorylation and phosphorylated the intermediate filament protein Vimentin directly [
28]. Our data revealed STK33-RNAi not only blocked Vimentin expression but also simultaneously elevated E-Cadherin expression, implying STK33-RNAi suppresses EMT through both of the two aspects. Furthermore, the synergistic effects of STK33-RNAi and PD98059 on the expressions of Vimentin and E-Cadherin exist, suggesting STK33 may trigger EMT involved in EKR1/2 pathway. Lastly, we demonstrated STK33-RNAi significantly increased the Nm-23-H1 expression and the effect was enhanced by PD98059. This suggests that STK33-knockdown inhibits the invasion and metastasis of Fadu cells via triggering the activity of Nm-23-H1 gene, which is well known to possess anti-metastasis trait in tumors [
29]. These data indicate that STK33 may promote metastasis in HSCC and increase migration and invasion in Fadu cells via inducing EMT by activating Vimentin and suppressing E-Cadherin, and reducing Nm-23-H1 genes, while, EKR1/2 pathway is involved in the process.
In view of the aforementioned findings that STK33-RNAi and PD98059 act in close collaboration each other on Fadu cells, we tried to seek out the direct evidence in relation to STK33 and ERK1/2 pathway by the examination of STK33 and ERK1/2 expressions. In the present study, we found that STK33-RNAi only markedly suppressed STK33 expression but failed to impact ERK1/2 expression; however, PD98059 significantly reduced both ERK1/2 and STK33 expressions at mRNA and protein levels in Fadu cells. These findings suggest that ERK1/2 might directly mediate STK33 activity, implying that STK33 is possibly a downstream of ERK1/2, which is consistent with the previous findings [
4]. However, it has been reported that reduction of STK33 has no effect on the expression of ERK1/2 [
9], indicating that the exact relationship between STK33 activity and ERK1/2 pathway needs to be deciphered further.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
Conception and design of the study: JL, HW, LH. Experiments carrying out: LH, CC, GZ, JZ. Statistical analysis: LH, YJ. Manuscript writing: LH, JL. All authors read and approved the final manuscript.