Background
Ovarian cancer (OC) is regarded as the 7th leading cancer diagnosis and the 8th major reason for cancer mortality among global females [
1], which is featured by extensive peritoneal dissemination with ascites [
2]. OC could be divided into four major histological subtypes, serous, endometrioid, mucinous and clear cell [
3]. The risk factors for OC include rare use of oral contraceptive, menstrual and hormonal factors, smoking, dietary factors, the lack of physical activity, and a family history [
4]. The recommended treatments for OC include the use of cisplatin as an anti-tumor drug against OC; however, the recurrent tumors post cisplatin therapy become chemoresistant [
5]. Moreover, cancer-associated fibroblasts (CAFs), an abundant stromal cell type in various cancers [
6], have been reported to cause unsatisfactory prognosis of OC [
7]. Notably, CAFs are able to secrete exosomes under the tumor microenvironment, and it has been reviewed that exosomes are implicated in both cancer progression and drug resistance [
8].
Exosomes are identified as membrane vesicles of 40–100 nm, which are of endocytic origin secreted by the majority of cell types in vitro [
9]. Exosomal microRNAs (miRs) have attracted increasing attention and have been recognized as biomarkers for cancers [
10]. As previously reported, miR-98-5p participated in the control of cisplatin resistance in epithelial OC, the expression of which was correlated with unfavorable outcome of epithelial OC patients [
11]. Moreover, hsa-miR-98-5p was indicated as a promising target in clinical cisplatin treatment for non-small cell lung cancer [
12].
Cyclin-dependent kinase inhibitor 1A (CDKN1A, p21), belonging to the Cip/Kip family, has been identified as a target of anti-cancer drugs [
13]. As reported previously, CDKN1A could reverse the promoting function of miR-33b-3p on cisplatin resistance in lung cancer cells [
14]. Moreover, another study also documented that increased expression of CDKN1A could promote the sensitivity of OC cells to cisplatin [
15]. In our study, the binding site between miR-98-5p and CDKN1A was identified based on the prediction through TargetScan online website. On the basis of the aforementioned results and reports, we proposed the hypothesis that CAF-derived exosomes overexpressing miR-98-5p influenced the cisplatin resistance in OC through targeting CDKN1A. Therefore, CAFs were co-cultured with OC cells to test this hypothesis.
Materials and methods
Ethics approval and consent to participate
The present study protocols had been approved by General Hospital of Ningxia Medical University. All participating patients signed informed consents prior to the study. All protocols were conducted based on the ethics statement of the Declaration of Helsinki. The animal experiments were carried out strictly following the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health.
Study subjects
In total, 42 patients with OC (aged 45–72 years; an average age of 53.52 ± 8.08 years old) who underwent surgical resection at the General Hospital of Ningxia Medical University from August 2017 to October 2018 were enrolled in this study. Based on the FIGO 2008 staging criteria, among the 42 patients, 26 patients were in stage I-II and 16 patients in stage III. Thirty normal ovarian tissues were collected as controls from healthy individuals (aged 42–71 years, with an average age of 54.33 ± 6.94 years old) who underwent ovariectomy during the same period. The OC tissues and normal ovarian tissues were fresh and intact and histopathologically confirmed. These tissue were rinsed with phosphate-buffer saline (PBS) containing 20% antibiotics, and then detached with collagenase I (Sigma-Aldrich Chemical Company, St Louis, MO, USA) and hyaluronidase (Sigma-Aldrich Chemical Company, St Louis, MO, USA) to isolate major normal fibroblasts (NFs) and CAFs [
16].
In vitro culture of cells
Human normal ovarian epithelial cell line HOSEpiC and human OC cell lines SKOV3, SKOV3/cisplatin (cisplatin-resistant SKOV3 cells) were purchased from Cell Bank Type Culture Collection of Chinese Academy of Sciences (Shanghai, China), and A2780 and A2780/cisplatin (cisplatin-resistant A2780 cells) were provided by Shanghai Biological Technology Co., Ltd. enzyme research (Shanghai, China). Cells were cultured in Roswell Park Memorial Institute-1640 medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS; Life Technologies, Carlsbad, CA, USA) and 1% penicillin/streptomycin (Beyotime Biotechnology Co., Shanghai, China). CAFs and NFs were co-cultured with Dulbecco’s modified Eagle’s medium (DMEM)/F12 containing 10% FBS at 37 °C in a 5% CO
2 incubator (thromo3111, Beisheng Medical Devices Co., Ltd., Jinan, China). The cells were passaged every 3 days [
17].
Immunofluorescence
CAFs and NFs were collected and seeded into 6-well plates coated with polylysine. Following three rinses with preheated 0.01 mol/L PBS, the cells were fixed with 4% paraformaldehyde under room temperature conditions for a 30-min period. After three PBS rinses, the cells were sealed with blocking solution (Beyotime Biotechnology Co., Shanghai, China) at 37 °C for 60 min. Afterwards, the cells were probed with rabbit antibodies against α-smooth muscle actin (α-SMA; ab32575, 1: 200), fibroblast activation protein (FAP; ab53066, 1: 50), and fibroblast-specific protein 1 (FSP1; ab124805, 1: 500) overnight at 4 °C. The antibodies were obtained from Abcam Inc., Cambridge, UK. The following day, further incubation of the cells was conducted with the following secondary antibodies: Alexa Fluor 594 conjugated donkey anti-rabbit (1: 400, A21202) and Alexa Fluor 488 conjugated donkey anti-mouse (1: 400, A21207), for 1 h in dark, which were both purchased from Life Technologies (Carlsbad, CA, USA). Subsequently, the cells were stained with 4′,6-diamidino-2-phenylindole (DAPI; Beyotime Biotechnology Co., Shanghai, China) at room temperature for 5 min, and sealed with anti-fade mounting medium (Beyotime Biotechnology Co., Shanghai, China). Finally, a high-content screening imaging system (Image Xpress Micro 4, Molecular Devices, Sunnyvale, CA, USA) was employed for photography.
Isolation and characterization of exosomes
CAFs or NFs were cultured on 6-well plates. When the cell confluence reached 80–90%, the culture medium was removed. The cells were rinsed two times with sterile PBS, followed by a 2-h period of culture in 2 mL serum-free DMEM/F12 medium. Afterwards, the culture medium (CM) was collected. CAFs-CM or NFs-CM were subjected to a 30-mie centrifugation at 2000×
g at 4 °C. A 0.22 μm membrane was applied to filter the supernatant, followed by ultracentrifugation at 100,000×
g for 90 min. Subsequently, the precipitations were exosomes to be collected, which were then resuspended in sterilized PBS buffer and centrifuged again for 60 min at 100,000×
g at 4 °C. Following the removal of the supernatant, another rinse, re-suspension and further precipitation, the precipitations were re-suspended with PBS, filtered using a 0.22 μm membrane, and frozen at -20 °C for subsequent use [
18,
19].
The isolated exosomes were fixed first with 2% paraformaldehyde, 2.5% glutaraldehyde, 1% osmic acid for 1.5 h, dehydrated using gradient alcohol, embedded, immersed in epoxy resin overnight, and polymerized sequentially at 35 °C, 45 °C and 60 °C for 24 h. Finally, the exosomes were sliced into ultrathin sections and stained with lead with the morphology observed and photographed under transmission electron microscopy (H-600, Hitachi, Tokyo, Japan).
The exosome suspension was diluted by means of gradual dilution, an appropriate amount of which was then added to a nanoparticle tracer (Malvern Instruments, Malvern, Worcestershire, UK) for detection purpose. The diluted samples whose concentration was detected to fluctuate from (1 − 9) × 108/mL were selected for further use. The appropriate background gray level was selected using the operation software, and the motion track of the particles was recorded. The concentration and particle size distribution of the diluted samples were output. The concentration of exosomes from the original suspension was calculated based on the dilution ratio.
Western blot assay
Cells were lysed for 30 min using radio immunoprecipitation assay lysis buffer containing phenylmethanesulfonyl fluoride (R0010, Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) on ice, and subjected to a 10-min centrifugation at 12,000 r/min at 4 °C. The total protein concentration was determined using a bicinchoninic acid kit (Pierce, Rockford, IL, USA). Next, 50 μg protein was dissolved in 2× sodium dodecyl sulfate (SDS) buffer and boiled for 5 min. Subsequently, the protein samples underwent 10% SDS–polyacrylamide gel electrophoresis and a transfer onto polyvinylidene fluoride membranes (Merck Millipore, Billerica, MA, USA) by the wet transfer method. The membrane was blocked with 5% skim milk under room temperature conditions for 1 h. An overnight incubation of the membrane was then performed at 4 °C with diluted rabbit antibodies against CD63 (ab118307, 1: 50), CD81 (ab109201, 1: 1000), tumor susceptibility gene 101 (TSG101; ab125011, 1: 1000), CDKN1A (p21) (ab109520, 1: 1000) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; ab8245, 1: 10,000). Afterwards, the membrane was probed with the horseradish peroxidase-labeled secondary antibody, goat anti-rabbit antibody to immunoglobulin G (IgG; ab205719, 1: 2000) for 1 h. After a TBST rinse, the membrane was developed using enhanced chemiluminescence (BB-3501, (Amersham, Buckinghamshire, UK). Gel imaging system was used for photography, followed by analysis using the Image J software. All the antibodies mentioned were from Abcam Inc. (Cambridge, UK).
Cell counting kit-8 (CCK-8) assay
OC cells were collected upon reaching logarithmic growth state, and resuspended in order to reach a concentration of 1 × 105 cells/mL. Next, 100 μL cell suspension was subjected to a 24-h incubation at 37 °C with 5% CO2 in a 96-well plate. After 24, 48 and 72 h, 10 μL CCK-8 reagent was applied to stain the cells. The optical density (OD) was measured at 450 nm with an enzyme-linked immunometric meter after 24 h.
Determination of half maximal inhibitory concentration (IC50) of cisplatin
A total of 100 μL cell suspension (1 × 105 cells/mL) was seeded to 96-well plates, followed by treatment with cisplatin at variant concentrations (0, 1, 2, 4, 8 μg/mL; Selleck Chemicals, Houston, TX, USA) for 72 h. The sensitivity of OC cells to cisplatin was then evaluated via the CCK-8 assay, and IC50 was obtained.
Co-culture of exosomes and OC cells
Exosomes were labeled with PKH67 fluorescent staining solution (Sigma-Aldrich Chemical Company, St Louis, MO, USA). Briefly, 200 μg exosomes and 4 μg PKH67 staining solution were dissolved with 1 mL Dilument C solution (Beyotime, Shanghai, China), respectively, followed by slight mixing for 5 min. After the exosomes underwent a 2-h centrifugation at 100,000 g at 4 °C, the labeled exosomes were collected after another centrifugation at 100,000g at 4 °C for 2 h. After A2780 cells were plated to a 24-well plate at a density of 5 × 104 cells each well, they were cultured overnight. The next day, the cells were respectively treated with PBS, CAF-derived exosomes (CAF-exo) or NF-derived exosomes (NF-exo) for 24 h. A Nikon Eclipse Ti confocal laser scanning microscope was used to observe the uptake of exosomes by A2780 cells. Next, the cells subjected to different co-culture were treated with cisplatin for 48 h.
Cell transfection
A2780 cells were plated into 6-well plates. Upon reaching cell confluency of about 70%, the cells were treated with overexpression-negative control (oe-NC) and oe-CDKN1A plasmids with the use of Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). All the plasmids were from Ribobio (Guangzhou, Guangdong, China).
Mimic-NC and miR-98-5p mimic plasmids were transfected into CAFs using the same method described above. After 24 h of transfection, exosomes were isolated from CAFs. Next, the exosomes, including exosomes from CAFs transfected with miR-98-5p or mimic-NC (miR-98-5p-exo or NC-exo) were added into A2780 cells without transfection or A2780 cells after transfection. All the exosomes were preserved for subsequent experimentation.
Reverse transcription quantitative polymerase chain reaction (RT-qPCR)
Total RNA was collected using a RNeasy MiniKit (Qiagen company, Hilden, Germany). For mRNA and lncRNA, RNA was reversely-transcribed by a reverse transcription kit (RR047A, Takara Bio Inc., Otsu, Shiga, Japan). For miRNA, the obtained RNA was then reversely-transcribed into complementary DNA (cDNA) according to the protocols of the microRNA FirstStrand cDNA Synthesis (Tailing Reaction) kit (B532451-0020, Shanghai Sangon Biotechnology Co. Ltd., Shanghai, China). qPCR was then performed on a real-time fluorescence qPCR detection device (ABI7500, ABI, Foster City, CA, USA) with reference to the SYBR PremixExTaqTMII (Perfect Real Time) kit (DRR081, Takara Bio Inc., Otsu, Shiga, Japan); three duplicated wells were set for each sample. The general negative primers of miRs and the upstream primers of U6 internal reference were extracted from the microRNA FirstStrand DNA synthesis kit. The other primers synthesized by Shanghai Sangon Biotechnology Co., Ltd. (Shanghai, China) are listed in Table
1. Target gene expression was normalized to that of GAPDH, and miR-98-5p expression was normalized to that of U6. Relative expression was calculated using the 2-ΔΔCt method.
Table 1Primer sequences for RT-qPCR
miR-98-5p | F: GGAAAATCGCCATAGCCAGG |
R: AGATCAGGGTGGCCCCATTT |
CDKN1A | F: GGAAGGGACACACAAGAAGAAG |
R: AGCCTCTACTGCCACCATCTTA |
GAPDH | F: CCAGGAAATGAGCTTGACAAAGTG |
R: AAGGTCATCCCTGAGCTGAGCTG |
In total, 2 mL 0.6% bottom agarose (Gibco Company, Grand Island, NY, USA) was supplemented to each well of a 6-well plate. After the agarose at the bottom was coagulated, the cells were evenly suspended in 0.3% agarose at 37 °C. Next, 2 mL cell suspension was immediately added to the 6-well plate (2000 cells/well) and allowed to stand for 10 min at 4 °C. The cells were maintained in an incubator for 14 days at 37 °C. The number of formed clones (≥ 50 cells was regarded as one clone) was counted under a microscope. Three parallel wells were set up to obtain the average value.
Flow cytometry
Extracted cells were resuspended to adjust the density into 1 × 106 cells/mL. Subsequently, 1 mL cells were fixed overnight at 4 °C using precooled 70% ethanol solution. Following re-suspension, 100 μL cell suspension (no less than 1 × 106 cells/mL) was treated with 1 mL 50 mg/L propidium iodide (PI) staining solution contained RNAase (Sigma-Aldrich Chemical Company, St Louis, MO, USA) for 30 min in darkness. Afterwards, a 300-mesh nylon mesh was used to filter the cell suspension. Finally, cell cycle distribution was detected using a Gallios flow cytometer (Beckman Coulter, Inc., Chaska, MN, USA) at the excitation wavelength of 488 nm.
Annexin V-fluorescein isothiocyanate (FITC)/PI staining was conducted to detect cell apoptosis. The procedures used in cell apoptosis detection were the same with those used in cell cycle detection. The cells were dyed using 10 μL Annexin V-FITC as well as 5 μL PI under room temperature conditions for 15 min in darkness. Finally, cell apoptosis was tested with the use of a flow cytometer.
Dual luciferase reporter assay
CDKN1A 3′ untranslated region (UTR) gene fragments were artificially synthesized, and then introduced into pMIR-reporter (Beijing Huayueyang Biotechnology, Beijing, China). The mutant form in the potential miR-98-5p binding sites was also constructed. The wild type (WT) and mutant (MUT) luciferase reporter plasmids were co-transfected into HEK293T cells along with miR-98-5p, respectively. The activities of both firefly luciferase (M1) and Ranilla luciferase (M2) were determined using a dual luciferase reporter assay kit (Promega, Madison, WI, USA). The target gene as well as the luciferase activity of gene promoter was expressed by M2/M1, and the average of three wells served as the final result.
Xenograft tumor in nude mice
Thirty specific-pathogen-free female BALB/c nude mice (aged 4–6 weeks) were from Shanghai SLAC Laboratory Animal Co., Ltd. (Shanghai, China) and reared in a routine manner. A2780 cells were subjected to different culture patterns as follows: (1) 1.5 × 106 A2780 cells were exposed to serum-free medium; (2) 1.5 × 106 A2780 cells were cultured in serum-free medium containing 20 μg agomir-NC-exo; (3) 1.5 × 106 A2780 cells were cultured in serum-free medium containing 20 μg agomir-miR-98-5p-exo. After 12 h, A2780 cells were thoroughly rinsed to remove the remaining exosomes.
The A2780 cells (2 × 10
6 cells in 25 mL PBS) cultured in different ways were delivered into the groin of the nude mice in a separate manner, in order to develop a subcutaneous transplantation nude mouse model of OC. Subsequently, cisplatin, at a dose of 2.5 mg/kg/2 days, was administrated into the abdominal cavity of the nude mice [
20] for a total of 21 times. The length as well as the width of the transplanted tumors in the nude mice was measured every 7 days utilizing a digital caliper. The volume of tumors was calculated by this formula: volume = length × width
2 × 0.5 [
21] to plot the growth curve. After 42 days, the mice were euthanized by excessive anesthesia, and the tumors were removed, and weighed.
Statistical analysis
Data analysis was conducted utilizing the SPSS 21.0 software (IBM Corp., Armonk, NY, USA). All quantitative data were shown as mean ± standard deviation. Unpaired t test was applied to compare the unpaired data between two groups that conformed to normal distribution and homogeneity of variance. One-way analysis of variance (ANOVA) was used to compare data among multiple groups, followed by a Tukey multiple comparisons posttest. Comparisons among multiple groups at various time points were analyzed using repeated measures ANOVA, and Bonferroni post hoc test was further employed. The correlation between two indices was analyzed by means of Pearson’s correlation analysis. p < 0.05 was indicative of a statistically significant difference.
Discussion
OC is a gynecological tumor with a high mortality rate, whose first-line therapy is combination of radiation treatment and chemotherapy [
22]. However, drug resistance is one of the reasons that can lead to therapy failure. The crucial role of exosomes and “exosomal shuttle miR” in both tumorigenesis and drug resistance has been highlighted previously [
23]. In this study, the main aim was to examine the functions of CAF-derived exosomes overexpressing miR-98-5p on cisplatin resistance in OC. The findings demonstrated that CAF-derived exosomes could deliver miR-98-5p to facilitate cisplatin resistance in OC, which was achieved by regulating CDKN1A.
Initially, the present study provided evidence to demonstrate that the expression of CDKN1A was higher in cisplatin-sensitive OC cell lines than that in cisplatin-resistant OC cell lines. CDKN1A is defined as a vital regulator for cell cycle arrest and apoptosis [
24]. It was found that CDKN1A aided in proliferation restriction of OC cells [
25]. Moreover, downregulation of CDKN1A was also found to be accountable for OC cell growth [
26]. It has been documented that CDKN1A is a biomarker for response to systemic adjuvant therapies and is associated with drug resistance in human tumors [
27]. In line with our study, the sensitization of cisplatin in OC cells by kaempferol was found to be in part due to the upregulation of CDKN1A [
28]. Furthermore, in the current study, miR-98-5p was predicted based on the TargetScan website to be the upstream regulatory miRNA of CDKN1A, which was verified by dual luciferase reporter assay. In fact, miR-98-5p has been discovered to participate in cisplatin resistance. For instance, miR-98-5p, by targeting Dicer1, is able to cause cisplatin resistance in epithelial OC cells through the suppression of miR-152 biogenesis [
11]. Moreover, in a previous study, downregulated hsa-miR-98-5p was found to potentiate the efficacy of cisplatin in non-small cell lung cancer A549 cells [
12].
Another important finding uncovered in this study was that the expression of miR-98-5p in A2780 cells treated with CAF-exo was notably higher than in A2780 cells treated with NF-exo. It was further demonstrated that CAF-derived exosomes could lead to a significant promotion in cisplatin resistance in OC cells. Exosomes can be taken up by other cells, thereby being able to transfer biological messages to nearby cells, and this cell-to-cell communication can affect pathogenesis of some diseases, such as human cancers [
29]. It is worthy to note that CAFs can secrete paracrine factors including exosomes and thus regulate proliferation, invasion and cell signaling of cancer cells [
30]. It has been discovered that tumor cells can communicate with CAFs via exosomes, thereby constructing a bidirectional cross talk to facilitate both tumor growth, and drug resistance [
31]. A previous study on OC cell also showed that fibroblasts-derived exosomes carrying TGFβ1 were capable of promoting epithelial-mesenchymal transition of OC cells [
32]. Similar with our results, CAF-derived exosomes were also reported to result in elevation of chemoresistance-inducing factor, Snail, in recipient pancreatic cancer epithelial cells and promote proliferation as well as drug resistance in pancreatic cancer [
33].
Furthermore, we demonstrated the promoting role of CAF-derived exosomes in cisplatin resistance in OC, as reflected by enhanced OC cell proliferation and colony formation, and inhibited cell apoptosis, which was mediated by overexpression of miR-98-5p. miRs have been found in exosomes, which are capable of transferring miRs and serving as delivery vehicles for therapeutic molecules [
34,
35]. Similarly, highly expressed miR-98-5p was found in Parp1-deficient embryonic stem cell-derived exosomes [
36]. Supportably, multiple exosomal miRs have been reported to be implicated in cancer progression or drug resistance. For instance, transfer of stroma-derived miR-21 via exosomes could induce paclitaxel resistance in OC cells by targeting APAF1 [
37]. Similar with the finding obtained in this study, exosomal miRs released by CAFs could accelerate the progression of an aggressive breast cancer cell phenotype [
38]. Thus, it was concluded that CAF-derived exosomes delivered miR-98-5p to downregulate CDKN1A, thereby promoting OC cells resistance to cisplatin.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.