T cell infiltration and upregulation of MHCII in microglia leads to accelerated neuronal loss in an α-synuclein rat model of Parkinson’s disease

All animal experiments were conducted in accordance with the National Institute of Health Guide and Use of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee of the University of South Florida. Three-month-old male nude rats (NIH-Foxn1^rnu, Charles River), male heterozygous nude rats (Foxn1^rnu/Foxn1⁺, Charles River), and male Fisher 344 rats were pair-housed in environmentally controlled conditions (12:12 h day: night cycle at 21 ± 1 °C) and they were provided with food and water ad libitum. Ten animals per group were used (nude rats—GFP, α-synuclein; heterozygous nude rats—GFP, α-synuclein). Human wild-type α-synuclein or green fluorescent protein (GFP) expressing recombinant adeno-associated virus serotype 9 was produced with CBA promoter according to the protocol described in Nash et al. [26]. Animals were injected unilaterally in the right substantia nigra (ipsilateral) with 2 μl of the rAAV serotype 9 expressing either human wild-type α-synuclein (~ 1 × 10¹³ vg/ml) or GFP (~ 0.6 × 10¹³ vg/ml) at a flow rate of 2.5 μl/min. Convection enhanced delivery (CED) method of delivery was followed for the viral injection [27]. Stereotactic surgery was performed with the following injection coordinates for the delivery of rAAV; lateral: −2.00 mm, anteroposterior: −5.2 mm, and dorsoventral: −8.2 mm from bregma.

The forelimb activity of the rats was tested using a cylinder behavioral test. Animals were placed in a cylinder of 24 cm height and 16 cm in diameter. The first twenty-forelimb contacts to the wall of the cylinder were recorded for each animal while rearing. The test was carried out before surgery, 1-month, and 2-month post-surgery by blinded observers. The percentage of left versus right or both paw touches was calculated.

After day 15 (2 weeks), 30 (4 weeks), 45 (6 weeks), and 60 (8 weeks), the rats were anesthetized and transcardially perfused with 0.1 M phosphate-buffered saline at pH 7.2 (PBS) followed by 4% paraformaldehyde (PFA) in PBS. Brain and spleen were removed and fixed in 4% PFA/PBS overnight. They were then transferred to 30% sucrose in PBS for at least 16 h until the brains equilibrated, at which point they were sectioned coronally at 40 μm using cryostat and the sections were stored at −20 °C in a cryoprotectant liquid for further processing. Immunostaining was performed on every sixth free-floating section spanning the substantia nigra of the brain or spleen for each animal. In order to block the endogenous peroxidase activity, the sections were either treated with tris buffered saline with sodium periodate (NaIO₄) for tyrosine hydroxylase (TH) staining or 40% methanol/2% H₂O₂ (hydrogen peroxide) in 0.1 M PBS buffer for NeuN, Iba1, and OX-6 staining for 20 min at room temperature (RT, 60 rpm). For CD4, CD8 T cell, α-syn211, and syn33 staining, the free-floating sections were treated with 1X SSC buffer (Sigma; S6639-1 L) for 40 min at 80 °C followed by incubation with 5% H₂O₂ for 20 min at RT (60 rpm). The tissue sections were washed with 0.1 M PBS. Followed by washing, the tissues were blocked with a blocking buffer (PBS/0.3% Triton X-100/10% horse serum or goat serum) for 60 min at RT (60 rpm). Tissues were then incubated with primary antibody (mouse anti-TH (1:10000), Immunostar (Cat no: 22941); mouse anti-NeuN (1:1000), Millipore (Cat no: MAB 377B); rabbit anti-rat Iba1 (1:2000), Wako (Cat no: 019-19741); mouse anti-RT1B (OX-6) (1:750), BD Biosciences (Cat no: 554926); mouse anti-CD4 (1:150), BioRad (Cat no: MCA55G); mouse anti-CD8 (1:200), Abcam (Cat no: ab33786 ); mouse anti-α-syn211 (1:10000), Abcam (Cat no: ab80627); rabbit anti human-α-syn33 (1:500), Dr. Rakez Kayed [28]) made in PBS containing 3% horse serum or 3% goat serum (for Iba1, syn33), 0.1% Triton X-100 overnight at 4 °C (60 rpm). The following day, sections were washed of in PBS containing 3% horse serum or 3% goat serum (for Iba1, syn33) and incubated with horse anti-mouse or goat anti-rabbit (for Iba1, syn33) secondary antibody at a concentration of 1:1000 in PBS/Triton X-100/serum solution for 60 min at RT (60 rpm). The secondary antibody was amplified by incubating the tissues with avidin-biotin substrate (ABC kit, Vector Labs (Cat# PK-6100)) for 60 min at RT (60 rpm). As final step, the tissues were developed using 3, 3′—Diaminobenzidine tetra-hydrochloride (DAB (Sigma, Cat no: D4418)) for TH, NeuN, CD4, and CD8 staining and with metal enhancer (nickel, Ni (Sigma, Cat no: D0426)) for OX-6 (MHCII), α-syn211, Iba1, and syn33 staining. Free-floating tissues were then mounted onto a glass slide and dried overnight. The following day, the slides were dehydrated and cover-slipped using DPX mounting medium. For immunofluorescence staining, the tissues were incubated with secondary antibodies, goat-anti-mouse Alexa Fluor 488 (for MHCII; 1:500), and goat anti-rabbit Alexa Fluor 594 (for Iba1; 1:500) for 60 min at RT (60 rpm) and mounted onto slides cover-slipped with hard-set DAPI (Vector Labs). The spleen tissues were stained as a positive control for CD4 and CD8 T cell staining (Supplemental Figure 1).

Primary microglia were obtained from young (3 months) nude and heterozygous nude rats. Rats were euthanized with CO₂ according to the approved IACUC protocol. The rats were perfused with PBS and the brains were dropped in ice-cold 1XHBSS (GIBO, Cat no: 14185-052) w/o Ca++ and Mg++. The brain was dissociated to small pieces using a scalpel or razor blade in a petri dish and then transferred to a 15-ml tube and centrifuged at 200 g for 2 min. The tissue was enzymatically digested using the Miltenyi Biotec’s neural dissociation kit (Cat no: 130-093-231) to obtain a single-cell suspension according to manufacture protocol. Primary microglia were isolated using Miltenyi Biotec’s LS magnetic columns and CD11b (Miltenyi Biotec, Cat no: 130-090-320) magnetic beads. The procedure yielded around 1.9-2.3 × 10⁶ cells with > 95% purity for both nude and heterozygous nude rats [29].

For LPS and TNF-α treatment, a 6-well plate was seeded with 300,000 microglial cells/well. The cells were treated with LPS (1 ng/ml and 10 ng/ml; Thermo Fisher, Cat no: O55:B5) and TNF-α (50 ng/ml and 100 ng/ml; Sigma, Cat no: T5944) in triplicate for each biological replicate at the given concentration 72 h after the cells were isolated and plated. The cells for RNA isolation were collected 3 h post-TNF-α treatment and 6 h post LPS treatment. The media isolated from the LPS-treated cells were used for ELISA testing (TNF-α Duo Set, R&D systems, Cat no: DY510-05) for TNF-α secretion as described by the manufacturer.

RNA from LPS and TNF-α treated primary microglial cultures were isolated using the Qiagen isolation kit (Cat no: 80004) and performed according to the manufacture’s protocol. The RNA concentrations were measured using Nanodrop. The isolated RNA was converted to cDNA using high capacity RNA to cDNA kit (Applied Biosystems, Cat no: 4387406) and manufacturer protocol was followed. The primers used were TNF-α, IL1β, IL-6 (IDT Primers, ref sequence # NM_012675, NM_031512, and NM_012589) and MHCII (RT1u.D). The MHCII primer was designed for RT1u.D alpha chain mRNA 3′ end (PubMed ID: M15562) with forward and reverse primers as follows: 5′ AGACAGTGTTTCTCCCAAGG 3′; 5′GTGATCCACCTCACAGTCATAG 3′. For the RT-PCR, 1 μl of primer yielding final concentration to 500 nM (TNF-α, IL-6, IL1β, MHCII), 5 μl of SYBR Green master mix (Applied Biosystems, Cat no: A25742), and 10 ng of cDNA were mixed together in a sterile PCR tube. The RT-PCR procedure has four stages: two holding stages for 2 min each at 50 °C followed by 95 °C, cycling stage repeating for 40 cycles at 95 °C for 3 s and 60 °C for 30 s, and the last melting curve stage at 95 °C for 15 s followed by 60 °C for 1 min and again at 95 °C for 15 s (StepOnePlus Real-Time PCR system, ThermoFisher Scientific). The amplification curve and the ΔC_T were calculated using the Step One software. Each experimental condition was run in triplicate for each donor rat, and the RNA from each well assayed in duplicate.

The tissues stained with TH, NeuN, OX-6, Iba1, α-syn33, and α-syn211 were scanned using Zeiss Mirax image scanner. The scanned images were analyzed using NearCYTE image analysis software (nearcyte.​org). Using the NearCYTE image analysis software, region of interest (ROI) were imposed onto the images and was selected for the substantia nigra pars compacta (SNpc). The ROI was compared to the threshold intensity setup by an experimenter blind to the treatment groups. The comparison creates a ratio of the population of the staining in each ROI [26]. The neurodegeneration is estimated by comparing the area ratio generated for contralateral and ipsilateral side of each brain slice per animal. Our lab has previously demonstrated that data collected with the NearCYTE software accurately reflects the cell counts using the Stereo investigator software (MBF Bioscience) [26]. The TH + ve cells, α-syn oligomers stained with syn33 antibody, CD4 and CD8 T cells in the SN and spleen were also counted in every 6th section using the optical fractionator method of unbiased stereology utilizing the Stereo Investigator software (MicroBrightField) on a Nikon Eclipse 600 microscope. A grid size of 150 × 150 (for CD4 and CD8)/300 × 300 (for syn33)/140 × 140 (TH) and counting frame of 100 × 100 (syn33, CD4 & CD8)/70 × 70 (TH) [30] was employed for each animal. The ROI was outlined using a 10 × 0.45 objective and the positive cells were counted using a 40 × 0.95 objective. For immunofluorescence staining, the images were taken using the Keyence microscope and the representative images are from a single Z stack plane.

In order to understand the functional impact of the synucleinopathy in SNpc, we behaviorally assessed forelimb akinesia by performing the cylinder test on T cell deficient (nude) and T cell competent (heterozygous) rats injected unilaterally with rAAV9 expressing either human wild-type α-syn or GFP at three different time points: before surgery, 30 days (1 month) post-surgery, and 60 days (2 month) post-surgery. The nude and heterozygous nude rats used in this study were from same littermates. The nude rats injected with either AAV9-α-syn or -GFP did not show any paw preference bias at any of these time points. However, the heterozygous nude rats injected with human α-syn showed a preference for ipsilateral paw touches (Two-way ANOVA: F (1.96, 79.15) = 13.31, p < 0.05; Tukey’s multiple comparison, p = 0.0003) at the 60 days (2 month) post-surgery time point as expected in this model (Fig. 1). These results show that absence of T cells protects the rats from the functional impact of synucleinopathy in SNpc at 60 days (2 month) post-injection.

In our previous studies, we have shown that overexpression of human α-syn using AAV9 results in dopaminergic neuronal loss in SNpc of the F344 rats [26, 30, 31]. The nude and heterozygous nude rat brains were immuno-stained for tyrosine hydroxylase (TH) 2 months after injection of AAV9-α-syn (Fig. 2a-d). TH is the rate limiting enzyme that converts tyrosine to L-DOPA (L-3, 4-dihydroxyphenylalanine), a precursor to dopamine and thus a marker of DA neurons. In GFP treated rats there was no difference in TH+ staining between the ipsilateral and contralateral substantia nigra pars compacta (SNpc). In heterozygous nude rats injected with AAV9-α-syn the percent positive area of staining for TH ratioed to the contralateral side showed significant reductions (Two-way ANOVA F (1, 32) = 23.12, p < 0.05; Tukey’s multiple comparison, p = 0.044) (Fig. 2e) when compared to the GFP injected controls [26]. In contrast, nude rats injected with AAV9-α-syn did not show a significant reduction in TH immunostaining. The unbiased stereological cell counts for TH for each treatment group showed the same effect as the NearCYTE area sampling method (Supplemental Figure 2). Additionally, Fischer 344 rats that have a full complement of T cells showed an even larger reduction in TH staining (Two-way ANOVA F (2, 24) = 10.02, p < 0.05; Tukey’ multiple comparison, p = 0.0005) (Fig. 2g) when compared to the nude rats that are deficient in T cells, possibly indicating that there may be a correlative relationship between the number of T cells and dopamine neuron loss in SNpc. Further, we stained for NeuN to determine if loss of TH was accompanied by neuronal loss in the SNpc. Like TH staining, heterozygous nude rats injected with AAV9-α-syn showed significant reduction (unpaired t test, p = 0.0026) in neurons in SNpc when compared to the nude rats injected with AAV9-α-syn (Fig. 2f). These results indicate that T cell competent rats show significant dopamine neuronal loss in SNpc with α-syn expression when compared to the T cell deficient rats, demonstrating that T cells may play a major role in dopamine neuronal loss in SNpc.

To further understand the role of microglia in dopaminergic neuron loss, we stained the SNpc for MHCII (OX6 antibody) (Fig. 3a-d, k) and Iba1 (Fig. 3e-f, k). A similar number of Iba-1 microglia are observed in the control GFP-treated nude and heterozygous nude rats (Fig. 3e, g, j). In response to AAV9-α-syn, both nude and heterozygous nude rats show morphological changes where the cell body becomes swollen (Fig. 3f, h) that when quantified shows an increased area of staining compared the GFP-treated rats of the same genotype (Two-way ANNOVA F (1, 34) = 257.8, p < 0.05; Tukey’s multiple comparison test, p < 0.0001) (Fig. 3j). Moreover, when comparing the microglial Iba-1 response to α-syn in the nude versus heterozygous nude rats there was a significantly higher increase in the heterozygous nude rats that may also reflect microgliosis or recruitment of additional microglia (monocytes) to SNpc (Fig. 3f, h, j) (Two-way ANNOVA; Tukey’s multiple comparison, p < 0.0001). Further, we measured upregulation of MHCII by immunostaining (OX-6 antibody). The number of MHCII positive microglia was only increased in heterozygous nude rats injected with AAV9-α-syn when compared to all other groups tested (Two-way ANNOVA F (1, 33) = 13.68, p < 0.05; Tukey’s multiple comparison, p = 0.0001) (Fig. 3a-d, i). Immunofluorescence co-staining with Iba1 and MHCII showed that the cells expressing MHCII in heterozygous nude rats injected with AAV9-αsyn are microglia or monocytes co-expressing Iba1 (Fig. 3k). Although we observed a few cells staining MHCII alone, more than 95% of the cells expressing MHCII co-stained with Iba1. These results indicate that that although microglia in both genotypes respond to the presence of α-synuclein, infiltration of T cells is necessary for microglia to upregulate MHCII leading to dopamine neuron loss in the SNpc.

To ensure that there were no differences in the amount of α-syn expression between groups we stained with anti-α-syn211 (Fig. 4a-d) and syn33 antibody (Fig. 4e-h), both are markers for oligomeric synuclein in the brain. The α-syn211 antibody binds to phosphorylated S129 on human α-syn, an important post translational modification required for the oligomer formation [32]. Our results indicate that both nude and heterozygous nude rats show the same level of α-syn211 staining at 60 days when normalized to TH expression (Fig. 4i). We additionally stained for oligomeric α-syn expression using an antibody (syn33-(29)) that stains for dimers and higher molecular weight aggregates. Our results show equal expression of α-syn oligomers when normalized to the number of DA neurons using both stereology counting and the ROI area of staining methods in both the groups (Fig. 4 j-k). These results further support that dopamine neuronal loss in the SNpc of the heterozygous nude rats is due to the interaction between T cells and microglia to upregulate MHCII and not due to differences in transgene expression.

Since microglia upregulate MHCII in heterozygous nude rats injected with AAV9-α-syn, we stained for specific subtypes of T cells in SNpc (Fig. 5a-d). The heterozygous nude rats showed presence of both CD4 and CD8 T cells while the nude rats did not have any T cells present in SNpc with oligomeric α-syn expression (One-way ANNOVA F (3, 14) = 426.6, p < 0.05; Tukey’s multiple comparison, p < 0.0001) (Fig. 5e, f). In a preliminary study, we have shown a significant infiltration of both CD4 and CD8 T cells into the SNpc 30 days post injection in F344 rats (with complete T cell population) injected with AAV9-α-syn when compared with AAV9-GFP injected rats (Supplemental Figure 3A-D). The F344 rats injected with AAV9-α-syn showed a significant increase (One-way ANNOVA F (3, 10) = 120.7, p < 0.05; Tukey’s multiple comparison, p < 0.0001) in the number of CD4 and CD8 positive T cells when compared to the GFP injected controls (Supplemental Figure 3E). These results indicate that T cells infiltrate into SN at a time that coincides with microglial upregulation of MHCII in response to oligomeric α-syn expression, supporting that T cells may be involved in microglial upregulation of MHCII.

We quantified dopamine neuron loss, microglial MHCII expression, αsyn oligomers, CD4, and CD8 T cells in nude and heterozygous nude rats at 60 (8 weeks) days timepoint. To understand the relationship between the timeline of neuron loss, microglial activation, and T cell infiltration post α-syn injection, we analyzed heterozygous nude rats injected with either AAV9-GFP or AAV9-α-syn at 2-week intervals. A progressive loss of dopamine neurons was observed in heterozygous nude rats injected with AAV9-α-syn with progressive loss over time (Two-way ANOVA p < 0.05; treatment: F (1, 24) = 243.8, p < 0.01; timepoint: F (3, 24) = 55.62, p < 0.01; post hoc analysis: Tukey’s multiple comparison test) (Fig. 6a). Similarly, a gradual increase in the number of activated microglia expressing MHCII was observed with time coinciding with neuron loss (Two-way ANOVA p < 0.001; treatment: F (1, 24) = 60.63, p < 0.0001; timepoint: F (3, 24) = 12.43, p < 0.0001; post hoc analysis: Tukey’s multiple comparison test) (Fig. 6d). However, the expression of Iba1 and α-syn33 oligomers in SNpc (normalized to TH expression) increased at 15 (2 weeks) and 30 (4 weeks) days and remained stable over time up to 60 (8 weeks) days (Two-way ANOVA p < 0.0001; treatment: F (1, 24) = 36.01, p < 0.0001; post hoc analysis: Tukey’s multiple comparison test) (Fig. 6b, c). Concurring with microglial MHCII expression, the number of both CD4 and CD8 T cells also increased progressively with time in SNpc of heterozygous rats expressing αsyn (Fig. 6e, f). In Fig. 6g, we show the relationship between all of these events. The changes that most closely coincide with loss of TH staining are the expression of MHCII, CD4, and CD8 T cell. Thus, although microglia respond to the presence of α-synuclein by showing upregulation of Iba1 and changes in morphology (as shown in Fig. 3), this remains stable over time, the loss of TH more closely follows the expression of MHCII and T cell infiltration.

Our results show that T cells infiltration coincides with the expression of MHCII in microglia in response to expression of α-syn in the SNpc. In order to test if the microglia from nude rats show normal expected pro-inflammatory responses to other stimuli such as LPS and TNF-α, we isolated primary microglial cells from nude and heterozygous nude rats and exposed them to LPS (1 ng/ml) or TNF-α (50 ng/ml) in vitro. From both genotypes, we isolated around 2 million microglia per brain showing no differences in absolute numbers of microglia in untreated rats. Following LPS exposure, the amount of TNF-α secreted in the media was tested using ELISA (Fig. 7a). Microglial cells isolated from both nude and heterozygous nude rats secreted equivalent amounts of TNF-α in response to LPS treatment, demonstrating that the lack of T cells in the nude rats does not alter the microglial cell’s ability to respond to the pro-inflammatory stimulation by LPS. Furthermore, extraction of RNA from isolated microglial cells exposed to either LPS or TNF-α demonstrated that induction of the pro-inflammatory genes, TNF-α, MHCII, IL1β, and IL6 using qRT-PCR, were similar in microglia cells from both nude and heterozygous nude rats (Fig. 7b-e). These results suggest that microglia from nude and heterozygous nude rats are able to respond equally to various pro-inflammatory stimuli and further underscore that the lack of increased MHCII expression in response to α-synuclein in the athymic nude rats is due to the absence of T cells and not due to a reduction in response to other pro-inflammatory activators. Further work is needed to explore the specific subtype of T cell and its role in the stimulation of the microglial response.