Background
Prostate cancer (PCa) is the most frequent malignancy, and the second-leading cause of cancer-related mortality in men in Western countries [
1,
2]. In tumors confined to the prostate, radical prostatectomy and radiotherapy are effective, however, for late stage disseminated disease, current therapies are merely palliative [
2,
3]. Androgen deprivation therapy (ADT) is a usual first-line systemic therapy for advanced PCa and is also used as an adjuvant to local therapy for high-risk diseases. Although a majority of patients initially respond to ADT, the responses in advanced disease are transient and almost all cancers eventually develop castration resistance [
1‐
4]. Castration-resistant prostate cancer (CRPC) is associated with a very poor prognosis, and the treatment of which remains a serious clinical challenge [
1‐
4].
Indolethylamine-
N-methyltransferase (INMT), also named as aromatic alkylamine N-methyltransferase, indolamine N-methyltransferase, arylamine N-methyltransferase, thioether S-methyltransferase, amine N-methyltransferase, nicotine N-methyltransferase, is a methyltransferase that transfers one or more methyl groups from the methyl donor
S-adenosyl-l-methionine (SAM) to the substrates [
5‐
7]. INMT functions as thioether S-methyltransferase and is active with a variety of thioethers and the corresponding selenium and tellurium compounds, including 3-methylthiopropionaldehyde, dimethyl selenide, dimethyl telluride, 2-methylthioethylamine, 2-methylthioethanol, methyl-n-propyl sulfide and diethyl sulfide [
8]. INMT also catalyzes the N-methylation of indoles such as tryptamine and structurally related compounds [
5‐
7]. As indicated in its aliases, INMT also catalyzes the (N)-methylation of many other different substrates, however, these methylation substrates are largely unknown.
INMT activity is increased in schizophrenia and stress-related psychoses in humans [
9]. INMT colocalizes with the sigma-1 receptors in primate spinal cord motoneurons containing unique synapses called C-terminals [
10]. These findings suggest that INMT may serve as a target for the treatment of amyotrophic lateral sclerosis (ALS) and schizophrenia [
9,
10]. Deregulation of INMT expression in primary cancer of lung and prostate has been reported [
11,
12], however, the role of INMT in cancer is unknown.
Here, we show that INMT whose expression is highly increased in CRPC promotes PCa castration resistance via detoxification of anticancer metabolites. INMT knockdown or treatment with INMT inhibitor N,N-dimethyltryptamine (DMT) significantly suppresses CRPC development. Histone-Lysine N-Methyltransferase SMYD3 is one of the major epigenetic regulators that promote INMT expression in CRPC, treatment with SMYD3 inhibitor suppresses INMT expression and inhibits CRPC development. INMT knockdown significantly increases the anticancer efficacy of the exogenous selenium compounds methaneseleninic acid (MSA) and Se-(Methyl)selenocysteine hydrochloride (MSC) as well as Bis(7)-tacrine, an endogenous methylation metabolite substrate of INMT.
Discussion
It has been suggested that the emergence of castration resistance involves the development of cellular adaptive survival pathways in an androgen-depleted environment [
1‐
4]. Several mechanisms for the castration resistance have been proposed, including the continuous role of AR signaling or the activation of other signaling transduction pathways in CRPC that lead to either enhanced activity of AR and its coactivators or bypassing AR in the presence of low levels or even in the absence of androgen [
1,
2], the trans-differentiation of PCa stem cells into androgen-independent (AI) cell-types [
1,
2], and the inflammatory signaling in both tumor microenvironment and in PCa cells that promotes the emergence of PCa castration resistance [
14,
39,
40]. In present study, we demonstrate that increased expression of INMT in PCa cells drives PCa castration resistance. INMT promotes CRPC growth and development via methylation and detoxification of the anticancer metabolites that are produced in cancer cells and/or released from tumor microenvironment.
INMT is a member of a large family of
N-methyltransferases that can methylate a variety of small molecule acceptors such as tryptamine, serotonin, and other endogenous compounds [
20]. INMT activity is increased in schizophrenia and stress-related psychoses in humans [
9]. INMT has been suggested as a therapeutic target for the treatment of amyotrophic lateral sclerosis (ALS) and schizophrenia [
9,
10]. Deregulation of INMT expression in primary cancer of lung and prostate has been reported [
11,
12], however, the role of INMT in cancer is unknown. In present study, we demonstrate that the expression of INMT is highly increased in CRPC. Knockdown of INMT as well as treatment with INMT inhibitor N,N-dimethyltryptamine (DMT) [
20] significantly inhibits CRPC development in mouse models. It is worth mentioning that the finding in our report is not inconsistent with the previous report that the expression of INMT is downregulated in primary PCa [
11], as our studies show INMT expression is very significantly increased in CRPC cells when compared with primary PCa cells.
INMT functions as thioether S-methyltransferase and is active with a variety of selenium compounds [
8]. Methylselenol is considered as the active metabolite for the anticancer effect of methyl-selenium compounds while dimethyl selenoxide, dimethyl selenide and trimethylselenonium have no or much less anticancer activity as they are rapidly metabolized and excreted [
29]. Two methylselenol prodrugs, MSA and MSC, are effective in suppression of cancer cell proliferation and growth [
33,
34]. Our studies demonstrate that knockdown of INMT significantly increases the anticancer effect of MSA and MSC in vitro and in CRPC mouse models, suggesting that the combination of MSC and INMT inhibition would be an efficient way for the treatment of CRPC.
INMT catalyzes the N-methylation of indolamines, aromatic alkylamines, indolamines, amines, nicotine and structurally related compounds [
5‐
7]. As N-methylation of endogenous and xenobiotic compounds leads to the degradation of the compounds [
5], INMT may promote CRPC growth and development by detoxification of the anticancer metabolites that are produced in cancer cells and/or existed in tumor microenvironment. In present study we employ bioinformatics and metabolomics tools to screen substrate candidates of INMT in CRPC cells, and we have identified a group of metabolites that are unmethylated and increased in INMT knockdown CRPC tumors. Importantly, our studies demonstrate that treatment with one of the most increased metabolites in INMT-KD cells, Bis(7)-tacrine, significantly suppresses CRPC growth and development in vitro and in animal models. Our studies suggest that Bis(7)-tacrine and its derivatives would be potent anticancer agents for the treatment of CRPC.
Tacrine, a potent, selective and reversible acetylcholinesterase (AChE) and butyrylcholinesterase (BChE) inhibitor, approved for clinical use by the U.S. Food and Drug Administration (FDA) for the treatment of mild to moderate Alzheimer’s disease (AD) in 1993, is no longer indicated for Alzheimer’s treatment due to its hepatotoxicity [
41]. However, tacrine has been used to design new non-toxic, multi-target compounds for AD, such as Bis(7)-tacrine. Compared with tacrine, Bis(7)-tacrine has few side effects, higher bioavailability, and superior efficacy [
42].
Our studies also demonstrate that SET and MYND Domain containing 3 (SMYD3) is one of the major epigenetic regulators of INMT expression in CRPC. SMYD3 is a member of the lysine methyltransferase family of proteins, and plays an important role in the methylation of various histone and non-histone targets. It can specifically methylate ‘Lys-4’ of histone H3, and ‘Lys-5’ of histone H4 [
25,
43]. SMYD3 can also form a complex with RNA polymerase II and bind to DNA containing 5′-CCCTCC-3′ or 5′-GAGGGG-3′ sequences presented in the promoter region that transactivates a set of downstream genes, including oncogenes, homeobox genes and genes associated with cell-cycle regulation [
25]. Due to the abnormal expression of SMYD3 in tumors, it is projected as a prognostic marker in various solid cancers [
25]. In the present study we demonstrate that both mouse and human INMT promoters contain SMYD3 DNA binding motif, treatment with SMYD3 inhibitor BCl-121 [
28] significantly inhibits INMT expression and suppresses CRPC development in mouse models. It should be mentioned that our studies suggest that SMYD3 is the major epigenetic regulator of INMT expression in CRPC, which do not exclude the regulation of INMT expression by many other factors, such as the transcription factors.
Our studies are not only providing new insights into the molecular mechanisms underlying castration resistance, but also developing novel therapeutic strategies and new agents for the treatment of advanced PCa. The new strategies include: (1) the INMT inhibitors, for instance DMT; (2) the SMYD3 inhibitors; (3) the metabolite substrates of INMT, for instance, Bis(7)-tacrine; (4) the combination of INMT inhibition with the selenium compounds or the metabolite substrates of INMT.
Importantly, some of these INMT inhibitors and the INMT methylation substrates are currently either in clinical trials or used in clinic for noncancer diseases [
18,
19]. For instance, MSC is currently in clinical trial for treatment of diffuse large B-Cell lymphoma that has relapsed or not responded to treatment (NCT00829205), and the INMT inhibitor DMT has been consumed as a powerful psychedelic drug and has historically been prepared by various cultures for ritual purposes as an entheogen [
18,
19]. Thus, targeting INMT or/and its methylation substrates for the treatment of human advanced PCa is not only efficient, but also immediate practicable.
Materials and methods
Cell culture and reagents
Myc-CaP, an androgen sensitive mouse prostate cancer cell line, is derived from c-Myc transgenic mouse. LNCaP (a human androgen sensitive prostate carcinoma cell line), DU145 and PC3 cell lines are purchased from American Type Culture Collection (ATCC). These cell lines were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin, and incubated in a humidified incubator with 5% CO2 at 37 °C. Myc-CaP cells and DU145 cells stably expressing control shRNA (Sigma), INMT shRNA (Sigma) or SMYD3 shRNA (Sigma) were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and puromycin (10 μg/mL). Myc-CaP cells engineered to stably express control vector and pCMV-INMT were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and hygromycin (100 μg/mL). DMT was purchased from Cayman Chemical company, bis(7)-Tacrine, BCl-121, Methylseleninic acid (MSA), and Se-(Methyl)selenocysteine hydrochloride (MSC) were purchased from Sigma.
Cell proliferation assay
The CellTiter 96® Non-Radioactive Cell Proliferation Assay kit (Promega) was used to measure cell proliferation according to manufacturer’s instructions. In brief, cells were seeded into 96-well plates, after the cells cultured to indicated time-points, the MTT dye solution was added. After being incubated at 37 °C for 4 h in cell culture incubator, the Solubilization Solution/Stop Mix was added to each well, and the plates were measured at wavelength of 570 nm with 630 nm as reference wavelength using a 96-well plate reader.
RNA isolation and real-time PCR analysis
The mRNA level of INMT was quantified using real-time polymerase chain reaction (RT-PCR) analysis. In brief, total RNA was purified from PPC and CRPC tissues using Qiagen RNeasy Mini Kit (Qiagen) according to the manufacturer’s recommendations. The cDNA was synthesized from the extracted RNA by reverse transcription using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher). Quantitative real-time PCR (qRT-PCR) was performed using SYBR Green qPCR Supermix (Solis BioDyne) according to the manufacturer’s protocol on BIO-RAD iQ5 real-time PCR Detection System (BIO-RAD). The mRNA level of INMT was normalized to the housekeeper gene GAPDH. The primers used for qRT-PCR were listed as following: mINMT-F: CCTACGACTGGTCCTCCATAGTG, mINMT-R: CTTCTGAGCTTGGCTTCCTTCT; mGAPDH-F: AGGTCGGTGTGAACGGATTTG, mGAPDH-R: TGTAGACCATGTAGTTG AGGTCA.
Western blotting
Whole cell lysates or tissue extracts were separated by SDS-PAGE gel and then transferred to polyvinylidene fluoride membranes (PVDF) (Millipore). After being blocked in 5% nonfat milk solution for 1 h at room temperature, the membranes were incubated using specific primary antibodies for INMT (Abcam) and β-Actin (Santa Cruz) at 4 °C overnight. Followed by HRP-conjugated second antibody incubation, chemoluminescence detection was performed by using the Pierce ECL Western Blotting Reagents (Thermo Scientific).
Chromatin immunoprecipitation (ChIP)
Chromatin immunoprecipitation (ChIP) was performed by using ChIP-IT Express kit (Active Motif) according to manufacturer’s instructions. Briefly, PPC or CRPC cells were fixed with 1% formaldehyde for 10 min, and then glycine was used to quench the reaction. Then the fixed cells were collected and suspended in ice-cold lysis buffer. Enzymatic shearing cocktail, provided with this kit, was added to shear the chromatin, then EDTA was added to stop the shearing reaction. Before the ChIP reaction with specific antibody, the sheared chromatin was pre-cleared with Protein A/G agarose beads. The supernatant was incubated with primary antibody or normal IgG overnight at 4 °C. Protein A/G agarose beads with antibody bound protein/DNA complexes were collected after centrifugation. The chromatin was eluted, reverse crosslinked, and treated with proteinase K to get DNA. PCR was performed to detect the ChIP-enriched DNA. The primers used for PCR are as following: INMT(− 127/− 11)-F: ATCTCCAGGGACCCTAGCTC, INMT(− 127/− 11)-R: CACACAGCTGTCCAGACTCC.
To screening potentially endogenous metabolism substrates of INMT in CRPC, Myc-CaP cells stably expressing control shRNA (Control) or INMT shRNA (INMT-KD) were subcutaneously inoculated in pre-castrated FVB male mice. When the tumors reached about 500 mm
3, the mice were euthanized and tumors were collected. 1.2 mL of cold MeOH:H
2O (4:1, v/v) will be added into 20 mg Control or INMT-KD CRPC tissues. Then the tissues were homogenized by homogenizer, and sonicated in ice bath for 10 min. The mixtures will then be transferred to 2.0 mL Eppendorf vials and rinsed with additional 200 μL extraction solvent. To precipitate proteins, the samples were incubated for 1 h at − 20 °C, followed by 15 min centrifugation at 13,000 rpm at 4 °C. The supernatant were evaporated to dryness in a vacuum concentrator. The dry extracts were then reconstituted in ACN:H
2O (1:1, v/v), normalized by tissue weight, sonicated for 10 min, and centrifuged 15 min at 13000 rpm and 4 °C to remove insoluble debris. The supernatants were transferred to HPLC vials for high-performance liquid chromatography (HPLC) coupled with mass spectrometry (HPLC-MS) analysis [
44,
45]. The Metlin database of The Scripps Research Institute was used to search potentially endogenous metabolism substrates of INMT based on m/z value.
Paraffin-embedded human prostate cancer samples
The study was approved by the Medical Ethics Committee of the affiliated Hospital, Zhengzhou University, and the informed consent was obtained from all the patients involved with the tissue samples. Specimens for paraffin-embed were from patients with prostate cancer who had treatment from September 2012 to 2015 at the affiliated Hospital. The clinical and pathological data of these patients were obtained from the patients’ records retrospectively.
Immunohistochemistry (IHC)
The human prostate tumor tissue samples were stained with antibody against INMT (Invitrogen). The procedure of IHC was performed as previously described method [
39]. In brief, after being treated with xylene, 100% ethanol, 95% ethanol, 80% ethanol, H
2O, PBS, paraffin-embedded tissue samples were treated with antigen retrieval solution (Sigma). the tissue samples were incubated with the INMT primary antibody in 5% blocking serum at 4 °C overnight, after recovering 1 h at room temperature, then incubated with biotinylated secondary antibody, followed by avidin-biotinylated peroxidase complex (ABC kit) (VECTOR LABORATORIES). Finally, tissue samples were stained with DAB (3,3′-Diaminobenzidine) (VECTOR LABORATORIES) and hematoxylin. The staining results were evaluated by two independent pathologists (double-blinded) at the same time to obtain the percentage of tumor cell stained and its corresponding score (1: < 25%, 2: 25–50%, 3: > 50%) as well as the staining intensity (1-negative, 2-weak, 3-moderate, and 4-strong).The nuclear staining fraction (NF) was assigned a score of 1 (0–25%), 2 (26–50%), 3 (> 50%), and Nuclear staining intensity (NI) was noted as 1 (weak) and 2 (strong). Subsequently, a combined Nuclear score (NS) was calculated by multiplying NF and NI (range of 1 to 6).
Animal models
FVB male mice (6 week-old) were used for mouse allograft. The mouse experimental protocols were approved by the Scripps Florida Institutional Animal Care and Use Committee and followed the guidelines of the National Institutes of Health. To investigate the expression of INMT in PPC and CRPC, 1 × 106 Myc-CaP cells per point was mixed with Matrigel (Corning) and inoculated into FVB mice subcutaneously. When the tumor size reached about 500 mm3, some of the mice were euthanized and tumors (PPC) were collected, and the left mice were castrated, the Myc-CaP allografts shrink, and later re-grew to become CRPC, then these mice were euthanized and tumors (CRPC) were collected for further experiments. To examine the role of INMT in CRPC development, pre-castrated FVB male mice were subcutaneously inoculated with 5 × 105 Myc-CaP cells stably expressing control shRNA (Control) or INMT shRNA (INMT-KD), or with Myc-CaP cells stably expressing control vector (Control) or INMT overexpression (INMT-OE), mixed in Matrigel. Rag1−/− mice were used as human xenograft mouse model to examine the role of INMT in human CRPC development. Five mice for each group were included. Tumor growth was monitored and measured as indicated days.
Quantification and statistical analysis
Differences between two groups are examined for statistical significance using Student’s t-test. All p values are two-tailed, and p < 0.05 was considered statistically significant (*, p < 0.05; **, p < 0.01;***, p < 0.001). Data are represented as means ± SEM.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.