miR-552 promotes ovarian cancer progression by regulating PTEN pathway

In total, 80 cases of tumor tissues and their corresponding adjacent noncancerous tissues were obtained from ovarian cancer patients in Cao county people’s hospital from 2012 to 2017, detailed clinicopathological features of the patients is described in online Additional file 1: Table S1. Fifteen cases of tumor tissues and their metastases tissues were obtained from ovarian cancer patients in Cao county people’s hospital from 2013 to 2016. Fifteen cases of tumor tissues and their recurrence tumor tissues were obtained from ovarian cancer patients in Cao county people’s hospital from October 2014 to March 2016. Human ovarian cancer and adjacent normal tissues were immediately snap-frozen in liquid nitrogen and stored at − 80 °C. All of the patients provided signed informed consent. The medical ethics committee of Cao county people’s hospital approved the retrieval method for cancer specimens.

HO8910 and HGSOC cells were purchased from Chinese Academy of Sciences, Shanghai, China. The ovarian cancer cells were cultured in RPMI-1640 medium supplemented with 10% fetal calf serum (FCS; Invitrogen, Carlsbad, CA, USA). The cultures were dissociated with 0.5% trypsin and transferred to new six-well plates biweekly. The lenti-vector expressing miR-552 sponge or miR-552 mimic and their control virus were purchased from Shanghai GenePharma (Shanghai, China). LV3-has-miR-552 mimics (5′- AACAGGTGACTGGTTAGACAA − 3′) can mimic high levels of endogenous mature miR-552 in cells. The miR-552 sequence +loop+ reverse complementation (incomplete complementation) was inserted into the vector to express shRNA, which was then cut into mature miR-552. LV3-has-miR-552 sponge (5′- TTGTCTAACCAGTCACCTGTT − 3′) is that the complete reverse complementary sequence (inhibitor) of miRNA, linked by linker, which adsorbs the binding miRNA (it may adsorb but not degrade, or it may lead to degradation of miRNA), resulting in miRNA not functioning biologically. LV3-has-miR-552 mimics and LV3-has-miR-552 sponge were packaged as a lentivirus. The lentivirus titers are about 1 × 10⁸ TU/ml. HO8910 and HGSOC cells were seeded into 6-well plate and then added 100 μl lentivirus. The stable infectants were screening by using puromycin [18].

HO8910 and HGSOC cells were seeded into a six-well plate until they reached 60–70% confluence. Transfection of si-PTEN or its negative control was performed in each well in the absence of serum with siRNA transfection reagent according to the manufacturer’s instructions (Polyplus, Illkirch, France). The sequence of si-PTEN is as follows: 5′- CCACAGCUAGAACUUAUCAAATT − 3′. This siRNA interrupt PTEN transcript variant 1and transcript variant 2. The siRNA was purchased from Shanghai GenePharma (Shanghai, China).

For cell proliferation analysis, ovarian cancer cells were seeded in 96-well plates (3 × 10³ cells per well). ATP activity was measured using a Cell Counting Kit-8 at indicated time points. ATP activity was measured using a Cell Counting Kit-8 at indicated time points. The procedure was as follows: The cell suspension (100 μl/well) was inoculated in a 96-well plate, and the plate was pre-incubated in a humidified incubator at 37 °C for 1 h. This was followed by the addition of 10 μl of the CCK-8 solution to each well of the plate, and incubation of the plate for 1 h in the incubator. Finally, the absorbance was measured at 450 nm using a microplate reader (Synergy H1; BioTek Instruments, Inc., Winooski, VT, USA) [19].

For colony formation assay, ovarian cancer cells were cultured in 12-well plates (3 × 10³ cells/well). The cells were incubated at 37 °C for 7 days and then fixed with with 10% neutral formalin for > 4 h. The cells were dyed with crystal violet (Beyotime, Haimen, China). The cells were photographed under a microscope (Olympus, Tokyo, Japan).

For cell EdU immunofluorescence staining, ovarian cancer cells were seeded into 96-well plates and performed using the EdU Kit (RiboBio). The results were quantified with a Zeiss axiophot photomicroscope (Carl Zeiss) and Image-Pro plus 6.0 software.

For cell migration experiments, 2 × 10⁵ ovarian cancer cells were seeded into the upper chamber of a polycarbonate transwell in serum-free RPMI-1640 medium. The lower chamber was added with RPMI-1640 medium containing 20% FBS as chemoattractant. The cells were incubating for 12 h and the chamber was fixed with 10% neutral formalin for > 4 h. The cells were dyed with crystal violet (Beyotime). The cells were then counted under a microscope (Olympus) and the cell number is expressed as the average number of the cells in each field.

For cell invasion experiments, 2 × 10⁵ ovarian cells were seeded into the upper chamber of a polycarbonate transwell in serum-free RPMI-1640 medium. The lower chamber was added with RPMI-1640 medium containing 20% FBS as chemoattractant. The cells were incubating for 24 h and the chamber was fixed with 10% neutral formalin for > 4 h. The cells were dyed with crystal violet (Beyotime). The cells were then counted under a microscope (Olympus) and the cell number is expressed as the average number of the cells in each field.

For detection of mature miR-552, total RNA was subjected to reverse transcription using a TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems). qRT-PCR analysis of miR-552 expression was carried out using TaqMan MicroRNA assay kits (Applied Biosystems). Results were normalized to U6 snRNA using the comparative threshold cycle (Ct) method. The miR-552 primer sequences were forward: 5′ AACAGGTGACTGGTTAGACAA 3′, U6 primer sequences were forward: 5′ ATTGGAACGATACAGAGAAGATT 3′.

The total cells RNA were extracted by using Trizol reagent (Invitrogen, 15596–018). Total cDNAs were synthesized by ThermoScript TM RT-PCR system (Invitrogen, 11146–057). The total mRNA amount presented in the cells was measured by RT-PCR using the ABI PRISM 7300 sequence detector (Applied Biosystems). The PTEN primer sequences were forward: 5′ TCCCAGACATGACAGCCATC 3′, reverse: 5′ TGCTTTGAATCCAAAAACCTTACT 3′. The β-actin was used as reference for relative expression calculation and its primer sequences were forward: 5′ GGCCCAGAATGCAGTTCGCCTT 3′, reverse: 5′ AATGGCACCCTGCTCACGCA 3′.

Thirty micrograms of proteins were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis and then transferred to the nitrocellulose membrane. The membrane was blocked with 5% non-fat milk and incubated with the primary antibody for 1.5 h. The protein band, specifically bound to the primary antibody, was detected using an IRDye 800CW-conjugated secondary antibody and LI-COR imaging system (LI-COR Biosciences). The primary antibodies were PTEN (1:1000; # 9188, Cell Signaling Technology) and GAPDH (1:5000; #5174, Cell Signaling Technology).

The luciferase assays were carried out using the Dual-luciferase Reporter Assay System (Promega, Madison, WI, USA). Briefly, cells were co-transfected with miR-552 mimics or miR-control and pMIR-reporter luciferase vector containing a specific sequence of wild-type or mutant PTEN fragment, using siRNA transfection (Invitrogen, NY, USA). Cells were collected and lysed for luciferase detection 48 h after transfection. The relative luciferase activity was normalized against to the Renilla luciferase activity.

All statistical analyses were performed using GraphPad Prism (GraphPad Software, Inc. La Jolla, USA). Statistical analysis was carried out using t test or Bonferroni Multiple Comparisons Test: *p < 0.05. A p value of less than 0.05 was considered statistically significant.

To explore the role of miR-552 in ovarian cancer progression, we measured the expression of miR-552 in a large set of human OC tissues. As shown in Fig. 1a, miR-552 expression was markedly elevated in OC tissues compared to paired non-tumorous tissues. We also examined miR-552 in metastasis and recurrence OC tissues, which showed that miR-552 expression was notably increased in metastasis and recurrence OC tissues (Fig. 1b and c). We further sought to determine whether upregulation of miR-552 was associated with OC patients’ prognosis. Using the online bioinformatics tool Kaplan-Meier plotter [20], we found that patients with increased miR-552 expression had worse overall survival (OS) (Fig. 1d).

To elucidate the effect of miR-552 on ovarian cancer cells behavior, HO8910 and HGSOC cells were infected by miR-552 sponge and stable infectants were established (Fig. 2a). As shown in Fig. 2b, miR-552 depletion repaired the proliferation of ovarian cancer cells markedly. In addition, ovarian cancer cells stably interfered with miR-552 sponge to form fewer and smaller colonies compared with control cells (Fig. 2c). Consistently, 5-ethynyl-2′-deoxyuridine (EdU) staining confirmed that miR-552 knockdown also inhibited ovarian cancer cells growth (Fig. 2d).

To further confirm the effect of miR-552 on ovarian cancer cells proliferation, HO8910 and HGSOC cells were infected by miR-552 mimic and stable infectants were established (Fig. 3a). As shown in Fig. 3b, miR-552 overexpression dramatically enhanced the proliferation of ovarian cancer cells. In addition, HO8910 and HGSOC cells stably overexpressing miR-552 formed more and bigger colonies compared with their control cells (Fig. 3c). Consistently, EdU staining also confirmed that ectopic expression of miR-552 inhibited ovarian cancer cells growth (Fig. 3d). Taken together, the above data showed that miR-552 promoted ovarian cancer cells growth.

To explore the role of miR-552 in ovarian cancer cells metastasis, transwell assay was performed, showing that the migration ability was impaired in miR-552 inferencing ovarian cancer cells (Fig. 4a and b). In addition, matrigel invasion chamber assay revealed that miR-552 knockdown attenuated the invasiveness of ovarian cancer cells (Fig. 4c and d).

To further elucidate the role of miR-552 in ovarian cancer cells metastasis, transwell assay was performed, showing that the migration ability was enhanced in ovarian cancer cells overexpressing miR-552 (Fig. 5a and b). Furthermore, matrigel invasion chamber assay revealed that miR-552 overexpression increased the invasiveness of ovarian cancer cells (Fig. 5c and d). Collectively, our results demonstrate that miR-552 disrupted the metastatic potential of ovarian cancer cells.

Next, we attempted to identify the target genes of miR-552 that may be involved in ovarian cancer cells expansion. Bioinformatics analysis suggested that PTEN mRNA harbored a putative miR-552 binding site in its 3′-UTR (Fig. 6a). To further explore whether miR-552 directly regulates PTEN expression via interaction with its 3′-UTR, the wild-type or mutant PTEN 3′-UTR reporter plasmids were transfected into miR-552 overexpression ovarian cancer cells and their control cells. The luciferase activity of wild-type reporter was significantly inhibited in the presence of miR-552 (Fig. 6b). However, miR-552-mediated repression of the reporter expression was abolished by mutation of the miR-552 binding site in the PTEN 3′-UTR. Moreover, PTEN mRNA and protein expression was also downregulated in miR-552 overexpression ovarian cancer cells (Fig. 6c and d). There was a significant negative correlation between miR-552 and PTEN mRNA expression in human OC tissues (Fig. 6e).

To investigate the role of PTEN in miR-552-mediated progression of ovarian cancer cells, special PTEN siRNA was used (Fig. 6f). Moreover, PTEN siRNA dramatically attenuated the distinct growth capacity between miR-552 overexpression ovarian cancer cells and control cells (Fig. 6g). Consistently, PTEN siRNA also abolished the discrepancy of metastasis between miR-552 overexpression ovarian cancer cells and their control cells (Fig. 6h), suggesting that miR-552 promoted ovarian cancer cell progression by directly target PTEN pathway.