Background
Melanoma is the most aggressive skin cancer but is highly resistant to available therapies [
1]. Rapid cell proliferation during tumorigenesis is mainly associated with two major events, abnormalities in chromatin structure and functional defects (mutations) in tumor suppressor genes and/or oncogenes [
2]. Recently, modifications in the chromatin structure by the loss or gain of DNA methylation and post-translational histone modifications have emerged as important contributors in tumor formation [
3]‐[
5]. The delicate balance between histone acetyl transferases (HATs) and histone deacetylases (HDACs) regulate the state of histone acetylation [
6]. HDACs include HDAC-1, 2, 3 and 8 belongs to Class I that are found in nucleus, HDAC-4, 5, 7 and 9 belongs to class IIa and HDAC-6 and 10 belongs to class IIb and shuttle between nucleus and cytoplasm of the cell [
7]. A delicate balance between histone acetyl transferases (HATs) and histone deacetylases at the histone H3 and H4 tails of core nucleosomal complex affects chromatin folding and chromosomal movement required for transcription that leads to normal cell growth. In general histone tails (i.e N terminal tails) are subjected to wide variety of post-translational modifications that includes acetylation, methylation, phosphorylation, ubiquitination, citrullination, ADP-ribosylation and SUMOylation[
2]. Such modifications control the ability of the histone tails to interact with key chromatin or transcriptional regulators. Among various modifications, acetylation and deacetylation plays a central role in controlling transcriptional activity in malignant cells [
8]‐[
10]. Histone acetylation leads to transcriptional activation where as deacetylation leads to transcriptional repression or silencing [
11]. The histone acetylating enzymes (HATs) and histone deacetylating enzymes (HDACs) can be targeted to specific regions of the genome results in maintenance of acetylation based epigenetic code. This code will be read by non-histone proteins that bind in an acetylation dependent manner or through direct effects on chromatin structure [
10,
12]. Studies on HDACs, associated with several oncogenes and tumor suppressor genes indicate the potential involvement of HDACs in tumorigenesis [
13,
14]. In addition, the pattern of histone acetylation as well as distribution of stable methylation and phosphorylation represents a functional code that is recognized by the non-histone protein complexes involved in the regulation of gene transcription [
15]‐[
17]. However, their role in tumor formation has not been critically analyzed.
Cell cycle progression is primarily controlled by a family of cyclin-dependent kinases that can be negatively regulated by CDK inhibitor
p21
WAF1
[
14]. In many cases,
p21
WAF1
activity is coupled with the histone acetylation at the promoter level [
18]. The novelty of plant chrysin is to delocalize stable histone methylation that corroborates with other histone modifications for blocking rapid cell proliferation in various tumor cells. More over plant flavonoids favour the localized modifications in the chromatin organization at the p21 promoter in tumor cells that are distinct from other HDAC inhibitors such as TSA, SAHA etc. Apart from p21, STAT proteins were found to regulate the transcriptional activation of genes that are involved in cell cycle and cell death such as Bcl-xL, caspases, Fas, TRAIL and p21 [
19]. Signal transducers and activators of transcription (STATs) are latent cytoplasmic transcription factors that mediate various responses such as cell proliferation, survival, apoptosis and differentiation. STAT proteins including STAT-1, 3, 5 bind to the DNA and regulate the functions of cell death and cell proliferation respectively [
20]. Among the different STAT proteins available in the cell only STAT-1 was found to regulate the process of cell death by transcriptional mechanism involving activation of death promoting genes as well as non-transcriptionally by interacting with TRADD, p53 or HDAC [
21].
Chrysin and its analogues are a group of poly phenolic compounds that are found in fruits, vegetables, olive oil, tea and red wine [
22]. Plants produce flavonoids as secondary metabolites for protection against micro organisms, U.V.light, spread of disease and gives colour to flowers. Chrysin is 5,7-dihydroxy flavone that was found to be cytotoxic with EC
50 value of 100 μM in wide range of cell lines such as breast (MCF-7, MDA-MB-231 cells), colon (Lovo, DLD-1) and prostate cancer cells [
23,
24]. Emerging evidences have shown that Histone deacetylase inhibitors (HDACi) such as Trichostatin A (TSA), NBM-HD-1, 3, 3' Diindolyl methane (DIM) were found to be not only inhibit histone deacetylase activity but also decrease the Akt activity that eventually lead to growth inhibition as well as apoptosis [
25]‐[
28]. Recent studies have shown the Akt inhibitory activity and apoptotic inducing nature of chrysin [
29,
30]. But the exact molecular mechanism of action of chrysin was not studied. In the present study we have identified that chrysin functions as HDAC-8 inhibitor and how chrysin controls the cell cycle and cause G1 cell cycle arrest by regulating various cell cycle proteins and histone modifications (H3acK14, H4acK12, H4acK16 and H3K9 me2) at p21 promoter. Here we establish the role of STAT response element (−684/−692) in the transcriptional activity of p21.
Discussion
Cancer is caused by abnormal cell cycle progression. Mammalian cell cycle progression involves the activities of cyclins and cdks. The balance between the activation and inhibition of cyclin/ Cdk inhibitor proteins decide whether cell will proceed through cell cycle or cause cancer [
41,
42]. Chrysin caused 50 % cytotoxicity than other analogs and this result is in corroboration with the fact that only two hydroxyl groups in AC rings of flavonoid were responsible for effective cytotoxicity. Increase or decrease of -OH groups in flavonoids would lead to loss of potent cytotoxicity [
23]. Flowcytometric analysis with chrysin treatment caused an increase in G1 phase cells with concomitant decrease in the number of S and G2/M phase cells, thus confirming G1 cell cycle arrest nature of the compound (Figure
2). Increased time duration of incubation lead to increase of G0 and G1 phase cells. Similar to chrysin, the other HDAC inhibtors such as SAHA and NaB (sodium butyarte) cause G1 cell cycle arrest in neuronal stem cells [
43].
Recent developments revealed that HDAC inhibitors are gaining interest as potential anti-cancer drugs due to their ability to reactivate epigenetically silenced genes in cancerous cells and there by control growth arrest, apoptosis and differentiation [
44]. The HDAC activity within the cells can be altered by direct inhibition of HDAC enzyme as well as changes in HDAC protein expression. We found decrease in the level of HDAC-8 protein as well as enzyme activity in the chrysin treated melanoma cells (neoplastic) (Figure
3). Similarly decrease in activity and protein levels of HDACs was observed in the case of recent studies on HDAC inhibitors such as Allyl mercaptan (AM), NBM-HD-1, apigenin [
26,
33,
45]. It is a well established concept that HDAC inhibitors induce apoptotic response in a P53-dependent and independent ways [
46]. In our study we have observed induction of p21 protein and mRNA in A375 cells with drastic reduction in the p53 protein, level indicating chrysin mediated p21 induction is independent of p53 status in A375 melanoma cells. The p53 independent induction of p21 activity was observed in studies on TSA and Apigenin, a well known flavonoid. This mechanism was reported to be cell type dependent (Figure
4) [
1,
33].
Typical to HDAC inhibitor, chrysin and its analogues can arrest cell growth and induce
p21
WAF1
transcription [
47‐
49], but its mechanism of action is quite different from known HDAC inhibitors (TSA). It selectively enhances the accumulation of acetylated histones and STAT proteins at the STAT binding site of the
p21
WAF1
promoter (Figure
5). Indeed, the novelty of the plant chrysin is to delocalize methyl group from the histone H3 lysine 9 from the STAT response element (−692 to −684) (Figure
6). Reduced histone methylation by treatment with chrysin acts sequentially or in concert with the elevated histone acetylation that might form a complex “histone code”. Such fine-tuning in the chromatin structure precisely in STAT responsive sequence might recognize the non-histone proteins for the transcriptional activation of cdk-inhibitor
p21
WAF1
gene [
15,
16,
50].
Further, the modulations of histone methylation and acetylation by chrysin might initiate several levels of chromatin modification in the multiple sites such as −684 to −692, −2549 to −2557 required for transcriptional regulation of p21 gene [
51]. The histone methylation functions to regulate the chromatin organization directly by affecting higher order packaging of chromatin fiber and is required for the gene transcription and DNA repair mechanism by changing the accessibility of DNA to several transcriptional factors [
52,
53]. It is known that histone lysine methylation of H3k4 is associated with promoters of actively transcribed genes [
54] where as H3K9 lysine methylation is associated with heterochromatin formation [
55]. Jumonji-C (jmjC) domain containing enzymes constitute the largest class of histone demthylases which includes JMJD2c and LSD1 and is linked particularly in prostate cancer [
56]. Thus we propose that histone tail modifications by the plant chrysin such as methylation and acetylation of lysine are the prominent epigenetic marks that regulate the binding of different transcriptional factors [
57‐
59]. Consistent with this notion, histone modification will allow the recruitment of STAT family of proteins at STAT binding sites in the
p21
WAF1
promoter [
60,
61].
The mode of action of chrysin is distinct from the known HDAC inhibitors such as SAHA and TSA. Treatment of SAHA and TSA inhibits LSD1, the known histone lysine demethylase I which demethylate both mono as well as dimethyl lysine 4 of histone H3 that lead to the chromatin modification at the
p21
WAF1
promoter [
62]. But function of chrysin is unique and novel from known HDAC inhibitors which decrease the H3k9 dimethylation at the p21
WAF1 promoter.
Emerging evidence has indicated p53 independent transcriptional activation of p21 include STAT1, MyoD1 and BRCA1 [
63]. Precisely, this study also shows a new regulatory relationship between
p21
WAF1
and STAT proteins via epigenetic modulation [
64]. The changes in the histone code of the chromatin in or near STAT binding sites by the chrysin can increase accessibility of the STAT-1& 3 proteins that lead to activate STAT mediated induction of
p21
WAF1
expression (Figure
7). Earlier studies indicated the involvement of STAT-1 dependent and p53-independent expression of p21 controlling apoptosis [
38]. These results not only suggest that chromatin remodeling within the STAT responsive sites can control transcriptional regulation but also demonstrate that modification in core histone tails by chrysin might activate STAT signals in A375 cells. STAT activated signals in response to IFN-gamma are directly involved in regulating
p21
WAF1
expression [
65]. Nevertheless our findings led to propose a chrysin based novel epigenetic pathway of
p21
WAF1
regulation by which an increased recruitment of STAT-1and-3 to proximal responsive region from the transcriptional start site in the
p21 promoter that maintain a pivotal role in the
p21
WAF1
up regulation. We speculate that some unknown binding factors may form a complex with STAT1/3/5 proteins
in vivo in the presence of chrysin to facilitate STAT1, 3 & 5 for easy recognition and accessibility to the two STAT binding sites. It could be very interesting to identify such chrysin-regulated proteins that bind to STAT binding sites.
In fact, our studies indicate that modification of chromatin structure in response to histone acetylation and methylation of the two responsive sites is sufficient to allow the transcriptional activation of
p21
WAF1
presumably via STAT proteins (Figure
8). These findings demonstrate a possible working model of chrysin for not only regulating cell cycle but also connect epigenetic modulation of
p21
WAF1
promoter and STAT signaling pathway as well. The functional importance of STAT region in the promoter activation was highly elucidated. In this study we found that chrysin treatment caused decrease in the protein level of NF-kB dependent genes such as Bcl-xL, survivin that lead to cell death (apoptosis) by enhancing the activity of caspase-3.Thus chrysin can be used as a single drug when compared with combinatorial therapy such as recently used HDAC inhibitor and demethylating agent (Aza Cytidine).
Methods
Chemical structure and extraction of natural compounds
The dried stem bark of dundilum tree, Oroxylum indicum was grinded and extracted consecutively with hexane in a soxhlet apparatus. Solid residue (2.5 g) in the hexane extract was filtered and subjected to silica gel (60–120 mesh) column chromatography to isolate two major fractions (F1 & F2). Fraction F1 was purified on silica gel column chromatography (60–120) eluted with 0.5 % MeoH in Chloroform to isolate methoxy chrysin (0.25 g). Similarly, Fraction F2 was subjected to repeated column chromatography with the elution of 2 % MeoH in Chloroform to isolate oroxylin A (1.2 g) and chrysin (0.8 g). The purification, chemical structure and characterization of all three compounds were determined via extensive spectroscopic NMR, ESI-MS, and HPLC methods. The conserved methyl oxide and hydroxyl group are shown in the chemical structure of small flavonoid compounds.
Cell culture
A375 ( human melanoma), U3A (Fibrosarcoma) cell lines were maintained in DMEM ( Dulbecco’s Modified Eagle’s Medium). Whereas K562 ( human Leukemia) cell line was maintained in RPMI media. All three cell lines were supplemented with 10 % FCS, 1 % pencillin/ streptomycin & 5 % glutamine. These cell lines were grown at 370 C in a humidified chamber containing 5 % CO2.
MTT assay
Cell viability was assessed by the MTT assay, a mitochondrial function assay. It is based on the ability of viable cells to reduce the MTT to insoluble formazan crystals by mitochondrial dehydrogenase. A375 cells were seeded in a 96-well plate at a density 10,000 cells/well. After overnight incubation, cells were treated with compounds chrysin, methoxy chrysin, oroxylin A at a final concentration of 40 μM and Trichostatin A (TSA) at a final concentration of 4 μM and incubated for 24 h. Medium was then discarded and replaced with 10 μL MTT dye. Plates were incubated at 37°C for 2 h. The resulting formazan crystals were solubilized in 100 μL extraction buffer. The optical density (O.D) was read at 570 using micro plate reader (Multimode Varioskan Flash Instrument-Themo Scientific Ltd).
Cell Cycle Analysis
5 X 105 A375 cells were seeded in 60 mm dish and were allowed to grow for 24 h. Compounds chrysin, oroxylin A, methoxy chrysin at 40 μM final concentration as well as TSA (positive control) at 4 μM final concentration were added to the culture media, and the cells were incubated for an additional 24, 48 and 72 h. Cells were harvested with Trypsin-EDTA, fixed with ice-cold 70 % ethanol at 4°C for 30 min, washed with PBS and incubated with 1 mg/ml RNase A solution (Sigma) at 37°C for 30 min. Cells were collected by centrifugation at 2000 rpm for 5 min and further stained with 250 μL of DNA staining solution [10 mg of Propidium Iodide (PI), 0.1 mg of trisodium citrate, and 0.03 mL of Triton X-100 were dissolved in 100 mL of sterile MilliQ water at room temperature for 30 min in the dark]. The DNA contents of 20,000 events were measured by flow cytometer (DAKO CYTOMATION, Beckman Coulter, Brea, CA). Histograms were analyzed using Summit Software.
Protein extraction and Western blot analysis
5 X 105 A375 cells were seeded in 60 mm dish and were allowed to grow for 24 h. 40 μM concentration of chrysin and 4 μM concentration of TSA were added to the culture media, and the cells were incubated for an additional 24 h. Total cell lysates from cultured A375 cells were obtained by lysing the cells in ice-cold RIPA buffer (1X PBS, 1 % NP-40, 0.5 % sodium deoxycholate and 0.1 % SDS) and containing 100 μg/mL PMSF, 5 μg/mL Aprotinin, 5 μg/mL leupeptin, 5 μg/mL pepstatin and 100 μg/mL NaF. After centrifugation at 12,000 rpm for 10 min, the protein in supernatant was quantified by Bradford method (BIO-RAD) using Multimode varioskan instrument (Thermo-Fischer Scientifics). Fifty micrograms of protein per lane was applied in 12 % SDS-polyacrylamide gel. After electrophoresis, the protein was transferred to polyvinylidine difluoride (PVDF) membrane (Amersham Biosciences). The membrane was blocked at room temperature for 2 h in 1X TBS + 0.1 % Tween20 (TBST) containing 5 % blocking powder (Santacruz). The membrane was washed with TBST for 5 min, and primary antibody was added and incubated at 4°C overnight. P53, p21, p27, cyclin D1, cdk2, cdk4, Bcl-xL and STAT-1, 3, 5a antibodies were purchased from Santacruz and Millipore companies. Survivin, active caspase-3 and β-actin were purchased from Imgenex company. Membranes were washed with TBST three times for 15 min and the blots were visualized with chemiluminescence reagent (Thermo Fischer Scientifics Ltd.). The X-ray films were developed with developer and fixed with fixer solution purchased from Kodak Company.
HDAC- 8 assay
The HDAC-8 fluorimetric drug discovery kit is based on the unique fluoro de lys HDAC-8 substrate and developer combination. Here the compound was incubated with the fluoro de lys substrate and HDAC-8 (BML-SE 145) for 30 min to observe the inhibitory activity of plant flavonoids (Oroxylin, methoxy-chrysin, chrysin) at a final concentration of 40 μM and known HDAC inhibitor TSA at 4 μM on the HDAC-8 protein. The deacetylation of substrate sensitizes the substrate and developer will produce fluorophore (Enzo Life Sciences USA). The fluorescent readings recorded using Multimode varioskan instrument (Thermo scientific, USA).
HDAC-1/2 assay
The HDAC-1 and 2 calorimetric assay drug discovery kit is based on the unique Color de lys substrate and developer combination. Here the compound was incubated with the de Color lys substrate and HDAC-1 and 2 (BML-K 1137) for 30 minutes to observe the inhibitory activity of plant flavonoids ( Oroxylin, methoxy-chrysin, chrysin ) at 40 μM and known HDAC inhibitor TSA at 4 μM on the HDAC-1 and 2 proteins. The deacetylation of substrate sensitizes the substrate and developer will produce yellow colour that can be measured by absorption of 405 nm (Enzo Life Sciences USA). The calorimetric readings recorded using Multimode varioskan instrument (Thermo scientific, USA).
Histone isolation and Western Blotting
The A375 were initially incubated with DMSO, TSA (4 μM) and Chrysin (40 μM) separately in 100 mm dishes with noted concentration for the stipulated time and followed by the washes with cold PBS (2–3 times). The cell lysate was passed through 26 G syringe 10 times and centrifuged at 12,000 g for 20 sec. The pellet was washed briefly with the lysis buffer and again centrifuged. 0.4 N HCl/10 % glycerol was added and incubated in 4°C while shaking. The supernatant was precipitated with 100 % TCA and incubated on ice for 1 h. After centrifugation, histone pellet was washed with acetone/0.02 N HCl, dried and dissolved in water. The histones were run on SDS gel, transferred to nylon membranes and probed overnight at 4°C with rabbit anti-acetyl Histone 3 lysine14, rabbit anti-acetyl Histone 4 lysine 12, rabbit anti-acetyl Histone H4 lysine 16, rabbit anti-dimethyl Histone3 lysine 9 , Histone H3 and Histone H4 (Upstate cell signaling solutions) 1:2000 diluted in 1X TBST and 3 % BSA with 0.02 % Sodium Azide. Appropriate Santa Cruz HRP conjugated secondary antibodies (1:3000) were used. Super Signal West Pico Chemiluminescent Substrate from Pierce was used as per manufacturer’s protocol for developing the blots.
Indirect Immuno-fluorescence of interphase nuclei
The Colcimid-treated (0.1 μg/ml media for 4–5 hrs) cells were trypsinized and precipitated at 200 g, and incubated in 75 mM KCl for 15 min at 37°C and further centrifuged at 100 g. The pellet was dissolved in 5 ml KCl. 300 μl was then mounted on the glass slides at 1000 rpm for 8 min. The slides were fixed in 3.7 % formaldehyde, washed twice with PBS, and treated with PBS containing 0.1 % Triton X-100 and 0.02 % Sodium Azide for 45 min at RT to permeabilize cells. After a wash with PBS, the slides were incubated with the primary antibody overnight at 4°C at 1:200 dilutions with PBT. The slides were washed with PBS for 10 min and incubated in goat serum diluted in PBT (1:50) for 30 min at RT. After PBS wash for 30 min, the slides were counterstained with DAPI and further visualized using confocal microscopy.
We have estimated accumulation of modified histones on the chromosomal arms by indirect Immuno-fluorescence. Briefly, metaphase cell spreads on the slides were incubated for 1 h at 37°C in a humid chamber with serial dilutions with either primary H3 dimethyl Lys-9 (1:50) or Lys-14 acetyl H3 (1:75) Lys 12 acetyl H4 (1:100) antisera, Lys 16 acetyl H4 (1:100) antisera and washed in KCM (120 mM KCl, 20 mM NaCl, 10 mM Tris-Cl- pH 8.0, 0.5 M EDTA, 0.1 % Triton). We had then added Cy3-conjugated, affinity-purified, donkey anti-rabbit IgG antibody (Jackson Immuno-Research) diluted 1:100 in KCM, and incubated the mixture for 30 min at room temperature. Chromosomes were further washed with KCM and fixed in 4 % formaldehyde for 10 min at room temperature. After a wash in sterile water, chromosomes were counterstained with DAPI, mounted the cover slips with anti-fade media (Vectashield) and viewed on a Zeiss Axiophot fluorescence microscope.
Chromatin Immunoprecipitation Assay (ChIP)
Chromatin immunoprecipitation assay was conducted as described earlier [
14] Supplementary protocol). The optimal reaction conditions for PCR were determined for each primer pair. Parameters were denaturation at 95°C for 1 min and annealing at 60°C for 1 min, followed by elongation at 72°C for 1 min. PCR products were analyzed by 2.5 % agarose/ethidium bromide gel electrophoresis. Different primer pairs used for
p21
WAF1
ChIP analysis (Supplementary materials).
Immunoprecipitation
A375 Cells were washed twice with PBS, scraped and resuspended in 250 μl of lysis buffer [50 mM Tris (pH-8), 120 mM NaCl, 0.5 % Nonidet P-40, 50 mM NaF, 1 mM sodium orthovanadate, 100 μg of polymethylsulfonyl fluoride/ml, 20 μg of aprotinin/ml, and 10 μg of leupeptin/ml]. The lysates were incubated on ice for 1 h followed by centrifugation at 12,000 rpm for 10 min to remove the insoluble materials. For immunoprecipitations, precleared 0.5 to 1 mg of whole-cell lysates were immunodepleted with p21antibody for 2 h. To this antibody complex, protein A/G agarose (Invitrogen, Inc.) beads were added for 1 h and kept at 4°C in an end-to-end shaker. The beads were washed thrice with lysis buffer without protease inhibitors. 1× Laemmli buffer was added to the beads, samples were boiled and loaded on to SDS-PAGE for western blot analysis using antibodies against STAT-1, 3, 5a.
Real time PCR Analysis
Total cellular RNA from cells was isolated by Trizol and RNase-Free DNase treatment carried out to remove DNA contaminants. RNA was purified by RNeasy Mini Kit (Qiagen, Germany). Three micrograms of RNA was used for first strand cDNA synthesis using SuperScriptTM (Invitrogen, USA). Real-Time PCR (ABI 7900) was performed. P21 promoter primer sequences for the four different regions were included in the supplementary information.
Luciferase assay
A375 cells were transfected with wild-type p21-Luc promoter plasmid (1 μg) and CMV-β-galactosidase plasmid (β-gal) (500 ng); mut-p21-Luc promoter plasmid (STAT region is mutated) and CMV-βgal plasmid combinations according to standard transfection protocol. This is followed by compound treatment [chrysin (40 μM), TSA (4 μM)]. The luciferase and β-galactosidase values were determined for each sample separately using Multimode Varioskan Flash (Thermo scientific) instrument. β-gal values were used for normalization.Each experiment was repeated three times and stanadard deviations were derived. Lipofectamine 2000 (Invitrogen) was used as transfection reagent.
Transcriptional Run-On Analysis
Nuclei were prepared and run-on transcription assays were performed as previously described [
14] (supplementary protocol).
Reverse-Transcription PCR
Total RNA was isolated from the cells treated with chrysin (40 μM) and TSA (4 μM) for 24 h was treated with RNase free DNAse and column purified. Three microgram of RNA was taken for first strand synthesis using superscript reverse transcriptase enzyme (Invitrogen) and PCR was carried using the following primers against P21 (FP-5’ atgaaattcaccccctttcc3’ and RP-5’ccctaggctgtgctcacttc3’), STAT-1 (FP-5’ ccgttttcatgacctcctgt 3’ and RP-5’tgaatattccccgactgagc3’) and GAPDH (FP-5’ acagtcagccgcatcttctt 3’ and RP-5’ acaagcttcccgttctcag 3’) was used as internal control.
Competing interests
The authors declare that they have no competing interests.