Phosphorylation of transglutaminase 2 (TG2) at serine-216 has a role in TG2 mediated activation of nuclear factor-kappa B and in the downregulation of PTEN

PKA that plays an important role in the pathogenesis of a number of NF-κB related diseases also phosphorylates TG2 at Ser²¹⁶ residue [9, 10, 27]. PKA induced phosphorylation of TG2 at Ser²¹⁶ was further confirmed using MEF ^tg-/- cells overexpressing Myc tagged wild-type TG2 and Ser216Ala-TG2 mutant (m-TG2) lacking Ser²¹⁶ phosphorylation site (Figure 1A). Since TG2 activates NF-κB, we explored whether PKA induced phosphorylation of TG2 at Ser²¹⁶ play a role in TG2 mediated activation of NF-κB and subsequent downregulation of PTEN. To determine this, MEF ^tg2-/- cells were transfected with Myc tagged wild-type TG2 and Ser216Ala-TG2 mutant (m-TG2). Expression level of wild-type TG2 and m-TG2 was confirmed by immunoblotting using anti-Myc antibody (Figure 1B). 48 h post-transfection, cells were incubated with db-cAMP in the presence and absence of a PKA specific inhibitor H89 and processed for further analysis [9, 10]. Western immunoblot analysis revealed that overexpression of TG2 was sufficient to significantly downregulate PTEN (may be due to adequate basal PKA activity in these cells) in comparison to empty vector transfected control group (Figure 1B-C). Furthermore, db-cAMP stimulation led to further decrease in PTEN protein level that was partially protected in the presence H89 (Figure 1 B-C). On the contrary, m-TG2 fails to decrease PTEN protein levels even after db-cAMP induced PKA activation suggesting involvement of Ser²¹⁶ in the downregulation of PTEN (Figure 1B-C). A similar change in the phosphorylation of PTEN was found using p-PTEN specific monoclonal antibody (Figure 1B-C). This antibody detects endogenous levels of PTEN only when phosphorylated at Ser³⁸⁰, Thr³⁸² and Thr³⁸³. These phosphorylation sites are present at the carboxy-terminal noncatalytic regulatory domain, which regulates its stability and play an important role in the regulation of its biological activity [28, 29]. Interestingly, an apparent difference in PTEN and pPTEN levels was found in cells expressing m-TG2 with and without db-cAMP treatment. This would indicate that in addition to Ser²¹⁶, additional serine residue(s) in TG2 is also involved in this process and is consistent with the phosphorylation level of TG2 and m-TG2 observed in response to db-cAMP in MEF ^tg2-/- cells (Figure 1A).

The NF-κB/Rel transcription factors are present in the cytosol in an inactive state associated with the inhibitory IκB proteins (20). Activation occurs via phosphorylation of IκB followed by proteasome-mediated degradation that results in the release and nuclear translocation of active NF-κB (20,22). As a prelude to NF-κB activation, we examined IκBα protein levels in cells overexpressing TG2 and m-TG2. IκBα was found to be significantly downregulated in TG2 overexpressing cells in comparison to empty vector transfected and m-TG2 overexpressing cells with db-cAMP stimulation (Figure 1B-C). No significant difference was found between m-TG2 overexpressing cells and empty vector transfected control group (Figure 1 B-C). To confirm that TG2 induced downregulation of PTEN is a consequence of NF-κB activation, we performed luciferase reporter-gene assay using a pNF-κB-MetLuc2-reporter. A significant upregulation of luciferase activity was observed in cells transfected with TG2 in comparison with empty vector transfected cells (Figure 1D). However, an increase in luciferase activity was not observed in m-TG2 transfected cells (Figure 1D). Most importantly, the luciferase activity inversely correlated with PTEN levels suggesting involvement of NF-κB in this process (Figure 1D). Collectively, these data suggest that phosphorylation of TG2 at Ser²¹⁶ facilitates TG2 mediated activation of NF-κB and downregulation of PTEN.

To verify that TG2 induced activation of NF-κB and the downregulation of PTEN as observed in TG2 overexpressing MEF ^tg2-/- is not cell specific and pertinent to TG2 protein, experiments were repeated using MCF-7 and T-47D breast cancer cells. A similar downregulation of PTEN protein level in MCF-7 and T-47D cells were found as in the case of MEF ^tg2-/- cells overexpressing TG2 (Figure 2A-B). However, a differential effect on phospho-PTEN was observed in MCF-7 and T-47D in response to db-cAMP stimulation (Figure 2A-B). These differences may be attributed to differences in the prevailing signaling pathways in MCF-7 and T-47D cells that are known to target TG2. For example, TG2 has been identified as a target protein in EGFR signaling and EGFR expression level significantly differ in these two cell types [30, 31]. Furthermore, similar to MEF ^tg2-/- cells, pNF-κB-MetLuc2-reporter gene activity was upregulated in both cell lines overexpressing TG2 (Figure 2C). Taken together these data further confirms a role of TG2 phosphorylation in the activation of NF-κB and in the downregulation of PTEN.

To determine whether TG2 mediated down regulation of PTEN occurs at the protein level or is a consequence of attenuated transcription, PTEN mRNA expression level was analyzed by real-time PCR in MEF ^tg2-/- , MCF-7 and T47D cells overexpressing TG2 and m-TG2. A significant decrease in PTEN mRNA expression was found only in cells overexpressing TG2 but not in m-TG2 overexpressing cells in comparison with empty vector transfected control group suggesting that TG2 mediated downregulation of PTEN occurs at the transcription level (Figure 3).

TG2 has been implicated in the activation of Akt and PTEN is a major negative regulator of the phosphatidylinositol 3 kinase (PI3K)/Akt signaling pathway [19, 32]. The main substrates of PTEN are inositol phospholipids generated by the activation of PI3K [33]. To investigate whether TG2 mediated activation of NF-κB and Akt are interconnected, we determined the phosphorylation status of Akt-Ser⁴⁷³, which is an important downstream substrate of PI3K and known to be upregulated in a number of cancers. In all three cell lines examined that is MEF ^tg2-/- , MCF-7 and T-47D, Akt phosphorylation was found to be increased in cells overexpressing TG2 in comparison with empty vector transfected control group (Figure 4). No difference in Akt phosphorylation was observed in cells overexpression m-TG2 in comparison with empty vector control group. However, a difference was apparent in Akt phosphorylation between cells overexpressing TG2 and m-TG2 which was significantly higher in TG2 overexpressing MEF ^tg2-/- and MCF-7 cells with db-cAMP treatment (Figure 4). Unlike MEF ^tg2-/- and MCF-7, an increase in Akt phosphorylation was observed in m-TG2 overexpressing T-47D cells in comparison with empty vector transfected control cells with db-cAMP stimulation. Most importantly, Akt activation directly correlated with the activation of NF-κB and inversely correlated with the downregulation of PTEN. Taken together, these data suggest that phospho-TG2 mediated activation of NF-κB and Akt are interconnected with each other and involves downregulation of PTEN.

To determine the functional consequence of the loss of phosphorylation at Ser²¹⁶ in TG2, we studied the effect of overexpression of TG2 and m-TG2 on cell migration using a two chamber technique. Overexpression of TG2 alone led to significant increase in the migration of MEF ^tg2-/- cells in comparison to empty vector transfected control cells which was further enhanced after db-cAMP stimulation (Figure 5). Furthermore, db-cAMP effect was significantly reduced in the presence of PKA inhibitor H89 suggesting a role of PKA in this process. On the contrary, m-TG2 overexpressing cells had no significant effect on cell migration in comparison with empty vector transfected control group even after db-cAMP treatment (Figure 5). However, a difference in cell migration was apparent between TG2 and m-TG2 in response to db-cAMP stimulation which was significantly lower in m-TG2 expressing cells suggesting a role of TG2 phosphorylation in TG2 mediated cell migration. Similarly, TG2 effect on cell migration was also inhibited by Akt inhibitor MK-2206 suggesting a role of Akt in TG2-induced cell migration (Figure 5).

Akt and NF-κB activation is known to facilitate cell survival and cell proliferation in a number of cancers [34]. Since TG2 modulates phosphorylation of Akt at residues known to be involved in Akt activation, we evaluated the progression of MEF ^tg2-/- and MCF-7 breast cancer cells overexpressing TG2 and m-TG2 through the cell cycle phases by FACS analysis. An increased progression of MEF ^tg2-/- and MCF-7 cells through the S phase was found in TG2 overexpressing cells (Figure 6). In MEF ^tg2-/- cells, an increase of ~27% was observed whereas in MCF-7 cells an increase of ~54% was found in comparison to empty vector transfected control group (Figure 6). However, a difference in the range of 30-38% was observed in m-TG2 overexpressing MEF ^tg2-/- and MCF-7 cells through S phase in comparison with TG2 transfected cells, which was lower in m-TG2 overexpressing cells (Figure 6). Taken together, these data suggest that the loss of TG2 phosphorylation at Ser²¹⁶ residue leads to significant reduction in cell progression through S phase.

MEF ^tg2-/- cells were obtained from TG2 null mice [9, 10]. MCF-7 and T47D breast cancer cells were obtained from American Type Culture Collection (Danvers, MA) and cell culture reagents and fetal bovine serum from Invitrogen (Carlsbad, CA). Akt (#9916) and PTEN (#9652) sampler kit and anti-Myc (#2272) antibodies were purchased from Cell Signaling Technology (Danvers, MA) and HRP-conjugated secondary antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA) and enhanced chemiluminescence (ECL) reagents from Promega (Madison, WI). Other reagents were purchased from Sigma-Aldrich (Oakville, ON) or as otherwise stated.

TG2 knockout C57BL/6 mice were generously provided by Dr. Nikolaos Frangogiannis (Baylor College of Medicine, Houston, Texas, USA) with permission from Dr. Gerry Melino (University of Leicester, UK). Experiments involving mice were performed as approved by the Animal Care Committee of the University of Manitoba.

MEF and breast cancer cell culture and treatments were performed as described before [9, 10]. The pCMV vector containing Myc tagged human TG2 (Myc-TG2, Origene Technology, USA) was used to generate TG2 mutant. Ser216Ala-TG2 mutant lacking Ser²¹⁶ phosphorylation sites was made by a site-directed mutagenesis kit using two complementary nucleotide primers (forward, 5' CTCCCGCCGCAGCGCCCCCGTCTACGTG 3' and reverse, 5' CACGTAGACGGGGGCGCTGCGGCGGGAG 3') containing desired mutation and Myc-TG2 as the template. Authenticity of all constructs was confirmed by DNA sequencing. Transfections with various constructs were performed using FuGENE HD transfection reagent (Roche, Germany) according to the manufacturer’s instructions. Cells treatments were performed 48 h post-transfection. Cell culture medium was exchanged for serum free media, and cells were serum starved for 6 h. Subsequently cells were treated with db-cAMP (100 μM) for 1 h or as otherwise stated in the presence and absence of PKA inhibitor H89 (100 nM).

Cell lysates were prepared using lysis buffer (Sigma-Aldrich), containing protease inhibitor cocktail as described previously [9]. Protein concentrations of lysates were determined by the Bradford protein assay with bovine serum albumin (BSA) as the standard. Proteins were resolved on 10% SDS-PAGE and transferred onto nitrocellulose membranes. Membranes were blocked in 5% blocking grade milk and processed for incubation with primary and HRP-conjugated secondary antibodies [9, 10]. Protein band was visualized using ECL and Kodak film.

Total RNA was extracted using RNA easy plus mini kit (Qiagen, Canada) from MEF ^tg-/- and breast cancer cells transfected with empty vector, wild type TG2 and mutant-TG2 (m-TG2, lacking Ser²¹⁶ phosphorylation site) constructs. The cDNA was synthesized from total RNA (1 μg) using reverse transcriptase and oligo-deoxythymidine primers [42]. The following primers were used for amplification of cDNA using real-time PCR: PTEN, forward 5’-AAGACCATAACCCACCACAGC-3’ and reverse 5’-TCATTACACCAGTTCGTCCCT-3’; GAPDH, forward 5’-CATCACCATCTTCCAGGAGCG-3’ and reverse 5’-TGACCTTGCCCACAGCCTTG-3’. Amplification conditions used were 40 cycles of denaturation for 30 s at 94°C, 30 s annealing at 50°C, and 30 s extension at 72°C.

Cell cycle analysis was performed by fluorescence activated cell sorting (FACS) as described before [9]. In brief, MEF ^tg-/- cells were transfected with various TG2 plasmids for 48 hours. Subsequently cells were collected by trypsinization, pelleted at 800 x g for 10 min, and fixed in 70% ethanol. DNA content was evaluated by flow cytometry with propidium iodide (PI) staining.

MEF ^tg2-/- cells were used for the cell motility assays. Polycarbonate filters (Thermo scientific, 8 um pore size) with cells which were transfected with various TG2 constructs were placed in wells of 6-well plates. Incubation was carried out with and without db-cAMP (100 μM) in the presence and absence of PKA inhibitor H89 (100 nM). The filters were removed and fixed in 1:10 diluted formalin for 1 h at RT. Cells on upper filter surface were removed carefully with cotton swab. The filters were stained in hematoxylin for 10 min, and cells on the lower surface of the filter were counted under a light microscope [43].

MEF ^tg2-/- and breast cancer cells were co-transfected with TG2 and pNFkB-MetLuc2-Reporter (Clontech, Mountain View, CA) constructs as per manufacturer’s protocol. Subsequently, cells were serum-starved for 6 hours, treated with 100 μM db cAMP for 1.5 h. Samples of supernatant media (100 μL) were collected. Subsequently 10 μL of 1 x substrate/reaction buffer was added to each sample and activity was measured using a Luminometer (Lumat LB 9507). The transfection efficiency was normalized by adding substrate buffer to cell lysates of each sample and light signals were recorded using a Luminometer [42].

Experimental results are shown as means ± SEM. One-way ANOVA with Dunnett’s test was used for multiple comparisons. P values <0.05 were considered significant difference.