Cell culture and adipocyte differentiation
3T3-L1 cells were obtained from American Type Culture Collection (Manassas, VA) and grown in Dulbecco's modified Eagle's medium (DMEM) (Invitrogen, Carlsbad, CA) supplemented with 10% (v/v) fetal calf serum (Irvine Scientific, Santa Ana, CA), 1 mM sodium pyruvate, 0.1 mM non-essential amino acids, 2 mM L-glutamine, 100 μg/ml streptomycin sulfate, and 100 units/ml penicillin. Cells were cultured at 37°C with 10% CO2 and passaged twice weekly. To differentiate 3T3-L1 cells into adipocytes, cells were incubated with 250 nM dexamethasone, 450 μM 3-isobutyl-1-methylxanthine, and 167 nM insulin for 2 days, followed by 167 nM insulin for an additional 3 days.
siRNA Transfection and PCR analysis
Purified Silencer® pre-designed small interfering RNA (siRNA) directed toward mouse lipoprotein lipase (LPL) was synthesized by Ambion Inc. (Austin, TX). The target sequence for the siLPL is on exon 2, with a sense sequence of GCAAAUUUGCCCUAAGGACtt and an antisense sequence of GUCCUUAGGGCAAAUUUGCtt. Cells were transfected with siRNA (100 nM) using DharmaFECT™ 3 transfection reagent according to the manufacturer's specific protocol for 3T3-L1 cells (Dharmacon, Inc., Lafayette, CO). Total RNA was purified from cells using RNeasy (Qiagen, Valencia, CA) and converted to cDNA using TaqMan Reverse Transcriptase (Applied Biosystems, Branchburg, NJ). LPL, leptin, apoCII, apoCIII, and β-actin expression levels were measured by quantitative Real Time PCR analysis (qRT-PCR) of cDNA samples. Primers specific for LPL [GenBank:NM_008509] were designed to amplify 231 base pairs flanking intron 4. Primer sequences for LPL were: upstream, CTGCTGGCGTAGCAGGAAGT; downstream, GCTGGAAAGTGCCTCCATTG. Primers specific for leptin [GenBank:NM_008493] were designed to amplify 213 base pairs flanking intron 2. Primer sequences for leptin were: upstream, TGACACCAAAACCCTCATCA; downstream, TCATTGGCTATCTGCAGCAC. Primers specific for apoCII [GenBank: NM_009695] were designed to amplify 147 base pairs flanking intron 2. Primer sequences for apoCII were: upstream, GCAGGGCTCCCTCTTAAGTT; downstream, AAAATGCCTGCGTAAGTGCT. Primers specific for apoCIII [GenBank: NM_023114] were designed to amplify 99 base pairs flanking intron 3. Primer sequences for apoCIII were: upstream, GGCTGGATGGACAATCACTT; downstream, TGGTTGGTCCTCAGGGTTAG. Primers specific for β-actin [GenBank:NM_007393] were designed to amplify 287 base pairs flanking intron 3. Primer sequences for β-actin were: upstream, CCTGAACCCTAAGGCCAACC; downstream, CAGCTGTGGTGGTGAAGCTG. qRT-PCR was performed using ABsolute QPCR SYBR Green Mix (Fisher Scientific, Atlanta, GA) with the following cycling parameters: 1 cycle, 95°C, 15 min; 40 cycles, 95°C, 15 sec, 60°C, 1 min. β-actin mRNA levels were measured in parallel with identical cycling conditions and used to normalize values obtained for LPL, leptin, apoCII, and apoCIII expression. Relative quantitation was performed using the comparative CT method. For this analysis, the amount of target message (LPL, leptin, apoCII, or apoCIII in siRNA-treated adipocytes) was normalized to the internal reference (β-actin) and compared to the calibrator (LPL, leptin, apoCII, or apoCIII in untreated adipocytes).
For straight RT-PCR reactions of leptin, apoCII, apoCIII and β-actin, isolated mRNA was reverse transcribed as described above and cDNA amplification was performed using TaKaRa Ex Taq™ (Fisher Scientific, Atlanta, GA) with the following cycling parameters: 1 cycle, 95°C, 2 min; 40 cycles, 95°C, 30 sec, 60°C, 30 sec, 72 °C 1 min. Amplified products were separated on 3% agarose gels and stained with Gel Star® (Cambrex, Rockland, ME).
LPL enzymatic activity
Cells, grown in 6-well plates, were rinsed twice with phosphate buffered saline, pH 7 (PBS), and incubated with 200 μg/ml heparin (from porcine intestinal mucosa, 180 USP units/mg, Sigma, St. Louis, MO) prepared in PBS for 15 min at 25°C. Following incubation, the heparin solution was centrifuged (15,000 × g, 5 min, 4°C) to remove cell debris and mixed with an equal volume of 2 mM p-nitrophenyl butyrate (PNPB). Absorbance at 405 nm was recorded following a 10 min incubation using a Genesys UV Spectrophotometer. LPL activity is reported as the amount of p-nitrophenol product formed over the 10 min incubation. The molar extinction coefficient of p-nitrophenol at 405 nm is 11,000 M-1cm-1.
Palmitate-albumin complexes
Palmitate (sodium salt), purified bovine LPL, and fatty acid-free albumin were purchased from Sigma. Palmitate-albumin complexes were prepared as follows. Palmitate was dissolved in 3% albumin (wt/v) to a final concentration of 10 mM in 1X Hank's Balanced Salt Solution. The mixture was slowly heated to 50°C and stirred overnight. The mixture was then cooled to 37°C, stirred for an additional 3 hours and sterile filtered through a 0.2 μm syringe filter. Protein was quantified using the BCA™ Protein Assay Kit (Pierce, Rockford, IL).
Nile Red staining and quantitation
Cells were rinsed twice with PBS, pH 7, and trypsinized with phenol red-free 0.05% Trypsin-EDTA (Invitrogen Corporation, Grand Island, NY) for 5 min at 37°C. Cells were fixed in suspension with 0.5% paraformaldehyde (v/v) in PBS for 10 min at 25°C. A stock solution of 1 mg/ml Nile Red (Sigma, St. Louis, MO) was prepared in acetone and added to the cell preparation to a final concentration of 5 μg/ml. Cells were incubated at 25°C for 30 min in the dark. Flow cytometry was performed using a FACScan flow cytometer (λexcitation 488 nm; λemission 585 nm). Nile Red fluorescence was quantitated using a Shimadzu RF-1501 spectrofluorophotometer (λexcitation 488 nm; λemission 560 nm).