Skip to main content
Erschienen in: Diagnostic Pathology 1/2013

Open Access 01.12.2013 | Short report

Lack of SF3B1 R625 mutations in cutaneous melanoma

verfasst von: Bastian Schilling, Nicola Bielefeld, Antje Sucker, Uwe Hillen, Lisa Zimmer, Dirk Schadendorf, Michael Zeschnigk, Klaus G Griewank

Erschienen in: Diagnostic Pathology | Ausgabe 1/2013

Abstract

Background

Melanoma is a deadly disease affecting people worldwide. Genetic studies have identified different melanoma subtypes characterized by specific recurrently mutated genes and led to the successful clinical introduction of targeted therapies. Hotspot mutations in SF3B1 were recently reported in uveal melanoma. Our aim was to see if these mutations also occur in cutaneous melanoma.

Findings

We analyzed a cohort of 85 cutaneous melanoma including 22 superficial spreading, 24 acral-lentiginous, 36 nodular, and 3 lentigo-maligna melanomas. Exon 14 of SF3B1, containing the site of recurrent mutations described in uveal melanoma, was sequenced in all samples. Additionally, NRAS exon 1 and 2 and BRAF exon 15 were sequenced in all, KIT exons 9, 11, 13, 17, and 18 in 30 samples. High numbers of BRAF and NRAS mutations were identified with frequencies varying according to melanoma subtype. None of the samples were found to harbor a SF3B1 mutation.

Conclusions

We conclude that recurrent mutations in codon 625 of SF3B1 as reported in uveal melanoma are not present in most types of cutaneous melanoma. This highlights the genetic differences between cutaneous and uveal melanoma and the need for subtype specific therapeutic approaches.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1746-1596-8-87) contains supplementary material, which is available to authorized users.

Competing interests

Dirk Schadendorf is on the advisory board or has received honararia from Roche, Genetech, Novartis, Amgen, GSK, BMS, Boehringer Ingelheim, and Merck. All other authors have nothing to declare.

Authors’ contributions

Literature search: BS, LZ, MZ, DS, KGG Study design: BS, AS, DS, MZ, KGG Data collection: NB, AS, BS, UH, KGG Data analysis: BS, NB, AS, KGG Data interpretation: BS, LZ, DS, MZ, UH KGG Manuscript writing: all authors. All authors read and approved the final manuscript.
Abkürzungen
ALM
Acral-lentiginous melanoma
SSM
Superficial spreading melanoma
NM
Nodular melanoma
LMM
Lentigo maligna melanoma.

Introduction

Malignant melanoma is a devastating disease worldwide [1, 2]. Curative management of melanoma is limited to the stage of localized disease. Once metastatic spread has occurred, prognosis of patients is poor. However, a number of promising new treatment regimens have been introduced recently, showing for the first time a therapy induced increase in overall survival [3, 4].
Over the last couple of decades a number of genetic alterations have been identified in melanoma. Activating driver mutations in genes such as NRAS[5] and BRAF[6] were identified in cutaneous melanoma. Losses of tumor suppressors such as CDKN2A and PTEN have been well documented [7]. In uveal melanoma a different set of genes shows recurrent mutations, including GNAQ and GNA11[8, 9], with activating mutations as well as in BAP1[10] showing inactivating mutations. The distinct mutation profiles of cutaneous and uveal melanoma are striking and support a model of different developmental pathways. However there is some overlap in tumor biology as ~80% of blue nevi, which are benign melanocytic tumors of the skin, also harbor GNAQ or GNA11 mutations, [8] and BAP1 mutations can be found in both cutaneous nevi and cutaneous melanoma [1114].
Both genetic and immunohistological assays are becoming more and more relevant in determining the dignity and prognosis of melanocytic neoplasms [1518]. Further refining which biomarkers are relevant in which settings should allow pathologists and clinicians to make more detailed diagnostic calls, leading to appropriate follow-up and treatment decisions.
Recently a recurrent mutation hotspot in SF3B1 affecting codon 625 was found in 18.6% of uveal melanoma [19]. SF3B1 mutations had been previously detected in myeloid malignancies such as CLL (chronic lymphoid leukemia) and MDS (myelodysplastic syndrome) [20, 21] and also reported in breast cancer [22]. SF3B1 is a splice factor, with mutations expected to result in altered pre mRNA splicing. However the exact target of altered splicing is unknown and might be cell type dependent [22].
The goal of our study was to analyze if SF3B1 mutations not only play a role in uveal, but also in cutaneous melanoma.

Material and methods

Sample selection and histopathology

Cutaneous melanoma samples were obtained from the tumor bank of the Department of Dermatology, University Hospital, University Duisburg-Essen. The study was done with approval of the local ethics committee of the University of Duisburg-Essen.

DNA isolation

10 μm-thick sections were cut from formalin-fixed, paraffin-embedded tumor tissues. The sections were deparaffinized and manually microdissected according to standard procedures. Genomic DNA was isolated using the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions.

Direct (Sanger) sequencing

Nested PCR was performed to amplify BRAF exon 15 and NRAS exon 1 and 2 and sequenced as previously described [23]. Sequencing of KIT exons 9, 11, 13, 17, and 18 was performed similarly. The first 120 base pairs of SF3B1 exon 14 (covering codons 603–641) were sequenced using the forward primer – TGTTTACATTTTAGGCTGCTGGT and reverse primer – GCCAGGACTTCTTGCTTTTG. After purification with the QIAquick PCR Purification Kit (Qiagen) PCR products were used as templates for sequencing in both directions. The sequencing chromatogram files were examined, and mutations were identified using Chromas software (version 2.01, University of Sussex, Brighton, United Kingdom).

Results

Sample cohort

The cohort included tumors from 51 males and 34 females, including 22 superficial spreading, 24 acral-lentiginous, 36 nodular, and 3 lentigo-maligna melanomas, with an average Breslow tumor thickness of 3.62 mm. The average thickness between subtypes varied; acral-lentiginous melanoma (ALM) = 4.54 mm, nodular melanoma (NM) = 4.47 mm, superficial spreading melanoma (SSM) = 1.9 mm and lentigo maligna melanoma (LMM) = 0.53 mm.

NRAS, BRAF, and KIT mutations

We analyzed 85 cutaneous melanomas in total. BRAF Exon 15 and NRAS Exon 1 and 2 were analyzed for presence of mutations by Sanger sequencing (Table 1). We identified 36 BRAF mutations (35 p.V600E, 1 p.V600K) and 19 NRAS mutations (11 p.Q61K, 3 p.Q61L, 5 p.Q61R). In total, 65% of tumors showed either a BRAF or NRAS mutation (42% BRAF, 22% NRAS). As reported previously, the mutations were found to be mutually exclusive. Prevalence of BRAF and NRAS mutations varied by histologic subtype; ALM - 33% BRAF, 13% NRAS, NM - 42% BRAF, 25% NRAS, and SSM - 60% BRAF, 23% NRAS mutations. Presence of KIT mutations was analyzed in 30 cases. 18 of these were in ALM in which the highest percentage of KIT mutations would be expected (18/24 ALM total = 75%) [2426]. One ALM sample was found to harbor a p.N505H (c.1513A > C) mutation/variant. We further analyzed 7 NM, 4 SSM, and 1 LMM, not identifying any KIT mutations.
Table 1
Table of sequencing results
 
Oncogene mutation status
SF3B1
Total
WT
BRAF V600
NRAS Q61
NA
WT
 
Count
Count
%
Count
%
Count
%
Count
%
Count
%
SSM
22
4
18.2%
13
59.1%
5
22.7%
1
4.5%
21
95.5%
NM
36
12
33.3%
15
41.7%
9
25.0%
3
8.3%
33
91.7%
ALM
24
13
54.2%
8
33.3%
3
12.5%
0
.0%
24
100.0%
LMM
3
1
33.3%
0
.0%
2
66.7%
0
.0%
3
100.0%
WT, Wildtype; SSM, Superficial spreading melanoma; NM, Nodular melanoma; ALM, Acral lentiginous melanoma; LMM, Lentigo maligna melanoma. NA, Not available (amplification failed or sequence reads were ambiguous).

SF3B1 analysis

The first 120 base pairs of exon 14, containing the location of the known hotspot mutation at codon 625, were sequenced in all 85 samples. In four samples amplification failed or sequence reads were ambiguous. None of the remaining 81 samples showed a mutation in SF3B1 as seen in a control sample from a uveal melanoma (Figure 1).

Discussion

Genetic classification of different melanoma subtypes has become very important, especially with the introduction of effective therapies targeting genetic alterations such as BRAF[3, 4] and KIT mutations [25]. A detailed understanding of the genetic events occurring in different tumors will most likely prove critical to further improving the therapeutic modalities for metastasized melanoma patients.
The distribution of activating oncogene mutations in BRAF and NRAS in our cohort is comparable to those reported elsewhere [7]. Overall 65% of melanoma had a BRAF or NRAS mutation in a mutually exclusive pattern. Of the three melanoma subtypes analyzed in considerable numbers (SSM, NM, ALM), percentages of BRAF and NRAS mutations combined were highest in SSM reaching 82%, lower in NM with 67% and lowest in ALM with 46%. The KIT mutation/variant identified in an ALM sample led to a p.N505V change. This is not reported to be a frequent mutation in cutaneous melanoma [27]. However p.N505H (c.1513A > C) is listed as a “variant of unknown origin” in a gastrointestinal stromal tumor in the COSMIC database [28]. The cutaneous ALM sample lacked mutations in BRAF or NRAS which could support a potential relevance, as typically KIT mutations are found to be mutually exclusive with BRAF and NRAS mutations [26]. The p.N505H (c.1513A > C) change could however also represent a rare germ-line variant, which we could not check as corresponding normal DNA was not available.
We obtained high quality sequencing results allowing analysis of exon 14 and in particular codon 625 of SF3B1 in 81 samples and found no mutations. This argues against a major role for SF3B1 in tumorigenesis or progression of cutaneous melanoma. In uveal melanomas, mutations were primarily found in tumors with a favorable prognosis [19]. Future studies could analyze if SF3B1 mutations occur in benign cutaneous melanocytic tumors (nevi) or potentially in sites other than in codon 603–641 of exon 14 of SF3B1.
In recent years genetic analyses identified a number of key genes involved in melanoma formation or progression. Interestingly, almost all of those described in cutaneous melanoma are not known to be relevant in uveal melanoma [29, 30]. In contrast, genetic alterations in uveal melanoma such as GNAQ and GNA11 mutations were also found in selected cases of cutaneous melanoma and are frequently found in blue nevi (benign cutaneous melanocytic tumors) [9]. BAP1 inactivating mutations are found in cutaneous nevi and melanoma, although considerably less frequently than in uveal melanoma [12]. Our current study would signify that SF3B1 mutations, occurring in almost 20% of uveal melanoma, [19] do not play a major role in cutaneous melanoma. We believe this highlights once more the genetic differences between uveal and cutaneous melanoma and the need for development of melanoma subtype specific therapies.

Acknowledgments

We would like to thank Iris Moll, Sabine Prass, and Marion Schwamborn for their excellent technical support.
Financial disclosure
The research was supported by a grant from the MERCUR-Stiftung. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://​creativecommons.​org/​licenses/​by/​2.​0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Competing interests

Dirk Schadendorf is on the advisory board or has received honararia from Roche, Genetech, Novartis, Amgen, GSK, BMS, Boehringer Ingelheim, and Merck. All other authors have nothing to declare.

Authors’ contributions

Literature search: BS, LZ, MZ, DS, KGG Study design: BS, AS, DS, MZ, KGG Data collection: NB, AS, BS, UH, KGG Data analysis: BS, NB, AS, KGG Data interpretation: BS, LZ, DS, MZ, UH KGG Manuscript writing: all authors. All authors read and approved the final manuscript.
Anhänge

Authors’ original submitted files for images

Below are the links to the authors’ original submitted files for images.
Literatur
1.
Zurück zum Zitat Siegel R, Naishadham D, Jemal A: Cancer statistics, 2012. CA Cancer J Clin. 2012, 62: 10-29. 10.3322/caac.20138.CrossRefPubMed Siegel R, Naishadham D, Jemal A: Cancer statistics, 2012. CA Cancer J Clin. 2012, 62: 10-29. 10.3322/caac.20138.CrossRefPubMed
2.
Zurück zum Zitat Flaherty KT, Hodi FS, Fisher DE: From genes to drugs: targeted strategies for melanoma. Nat Rev Cancer. 2012, 12: 349-361. 10.1038/nrc3218.CrossRefPubMed Flaherty KT, Hodi FS, Fisher DE: From genes to drugs: targeted strategies for melanoma. Nat Rev Cancer. 2012, 12: 349-361. 10.1038/nrc3218.CrossRefPubMed
3.
Zurück zum Zitat Chapman PB, Hauschild A, Robert C, Haanen JB, Ascierto P, Larkin J, Dummer R, Garbe C, Testori A, Maio M: Improved survival with vemurafenib in melanoma with BRAF V600E mutation. N Engl J Med. 2011, 364: 2507-2516. 10.1056/NEJMoa1103782.PubMedCentralCrossRefPubMed Chapman PB, Hauschild A, Robert C, Haanen JB, Ascierto P, Larkin J, Dummer R, Garbe C, Testori A, Maio M: Improved survival with vemurafenib in melanoma with BRAF V600E mutation. N Engl J Med. 2011, 364: 2507-2516. 10.1056/NEJMoa1103782.PubMedCentralCrossRefPubMed
4.
Zurück zum Zitat Flaherty KT, Infante JR, Daud A, Gonzalez R, Kefford RF, Sosman J, Hamid O, Schuchter L, Cebon J, Ibrahim N: Combined BRAF and MEK inhibition in melanoma with BRAF V600 mutations. N Engl J Med. 2012, 367: 1694-1703. 10.1056/NEJMoa1210093.PubMedCentralCrossRefPubMed Flaherty KT, Infante JR, Daud A, Gonzalez R, Kefford RF, Sosman J, Hamid O, Schuchter L, Cebon J, Ibrahim N: Combined BRAF and MEK inhibition in melanoma with BRAF V600 mutations. N Engl J Med. 2012, 367: 1694-1703. 10.1056/NEJMoa1210093.PubMedCentralCrossRefPubMed
5.
Zurück zum Zitat Ball NJ, Yohn JJ, Morelli JG, Norris DA, Golitz LE, Hoeffler JP: Ras mutations in human melanoma: a marker of malignant progression. J Invest Dermatol. 1994, 102: 285-290. 10.1111/1523-1747.ep12371783.CrossRefPubMed Ball NJ, Yohn JJ, Morelli JG, Norris DA, Golitz LE, Hoeffler JP: Ras mutations in human melanoma: a marker of malignant progression. J Invest Dermatol. 1994, 102: 285-290. 10.1111/1523-1747.ep12371783.CrossRefPubMed
6.
Zurück zum Zitat Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, Teague J, Woffendin H, Garnett MJ, Bottomley W: Mutations of the BRAF gene in human cancer. Nature. 2002, 417: 949-954. 10.1038/nature00766.CrossRefPubMed Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, Teague J, Woffendin H, Garnett MJ, Bottomley W: Mutations of the BRAF gene in human cancer. Nature. 2002, 417: 949-954. 10.1038/nature00766.CrossRefPubMed
7.
Zurück zum Zitat Curtin JA, Fridlyand J, Kageshita T, Patel HN, Busam KJ, Kutzner H, Cho KH, Aiba S, Brocker EB, LeBoit PE: Distinct sets of genetic alterations in melanoma. N Engl J Med. 2005, 353: 2135-2147. 10.1056/NEJMoa050092.CrossRefPubMed Curtin JA, Fridlyand J, Kageshita T, Patel HN, Busam KJ, Kutzner H, Cho KH, Aiba S, Brocker EB, LeBoit PE: Distinct sets of genetic alterations in melanoma. N Engl J Med. 2005, 353: 2135-2147. 10.1056/NEJMoa050092.CrossRefPubMed
8.
Zurück zum Zitat Van Raamsdonk CD, Bezrookove V, Green G, Bauer J, Gaugler L, O’Brien JM, Simpson EM, Barsh GS, Bastian BC: Frequent somatic mutations of GNAQ in uveal melanoma and blue naevi. Nature. 2009, 457: 599-602. 10.1038/nature07586.PubMedCentralCrossRefPubMed Van Raamsdonk CD, Bezrookove V, Green G, Bauer J, Gaugler L, O’Brien JM, Simpson EM, Barsh GS, Bastian BC: Frequent somatic mutations of GNAQ in uveal melanoma and blue naevi. Nature. 2009, 457: 599-602. 10.1038/nature07586.PubMedCentralCrossRefPubMed
9.
Zurück zum Zitat Van Raamsdonk CD, Griewank KG, Crosby MB, Garrido MC, Vemula S, Wiesner T, Obenauf AC, Wackernagel W, Green G, Bouvier N: Mutations in GNA11 in uveal melanoma. N Engl J Med. 2010, 363: 2191-2199. 10.1056/NEJMoa1000584.PubMedCentralCrossRefPubMed Van Raamsdonk CD, Griewank KG, Crosby MB, Garrido MC, Vemula S, Wiesner T, Obenauf AC, Wackernagel W, Green G, Bouvier N: Mutations in GNA11 in uveal melanoma. N Engl J Med. 2010, 363: 2191-2199. 10.1056/NEJMoa1000584.PubMedCentralCrossRefPubMed
10.
Zurück zum Zitat Harbour JW, Onken MD, Roberson ED, Duan S, Cao L, Worley LA, Council ML, Matatall KA, Helms C, Bowcock AM: Frequent mutation of BAP1 in metastasizing uveal melanomas. Science. 2010, 330: 1410-1413. 10.1126/science.1194472.PubMedCentralCrossRefPubMed Harbour JW, Onken MD, Roberson ED, Duan S, Cao L, Worley LA, Council ML, Matatall KA, Helms C, Bowcock AM: Frequent mutation of BAP1 in metastasizing uveal melanomas. Science. 2010, 330: 1410-1413. 10.1126/science.1194472.PubMedCentralCrossRefPubMed
11.
Zurück zum Zitat Wiesner T, Murali R, Fried I, Cerroni L, Busam K, Kutzner H, Bastian BC: A distinct subset of atypical Spitz tumors is characterized by BRAF mutation and loss of BAP1 expression. Am J Surg Pathol. 2012, 36: 818-830. 10.1097/PAS.0b013e3182498be5.PubMedCentralCrossRefPubMed Wiesner T, Murali R, Fried I, Cerroni L, Busam K, Kutzner H, Bastian BC: A distinct subset of atypical Spitz tumors is characterized by BRAF mutation and loss of BAP1 expression. Am J Surg Pathol. 2012, 36: 818-830. 10.1097/PAS.0b013e3182498be5.PubMedCentralCrossRefPubMed
12.
Zurück zum Zitat Wiesner T, Obenauf AC, Murali R, Fried I, Griewank KG, Ulz P, Windpassinger C, Wackernagel W, Loy S, Wolf I: Germline mutations in BAP1 predispose to melanocytic tumors. Nat Gen. 2011, 43: 1018-1021. 10.1038/ng.910.CrossRef Wiesner T, Obenauf AC, Murali R, Fried I, Griewank KG, Ulz P, Windpassinger C, Wackernagel W, Loy S, Wolf I: Germline mutations in BAP1 predispose to melanocytic tumors. Nat Gen. 2011, 43: 1018-1021. 10.1038/ng.910.CrossRef
13.
Zurück zum Zitat Carbone M, Ferris LK, Baumann F, Napolitano A, Lum CA, Flores EG, Gaudino G, Powers A, Bryant-Greenwood P, Krausz T: BAP1 cancer syndrome: malignant mesothelioma, uveal and cutaneous melanoma, and MBAITs. J Trans Med. 2012, 10: 179-10.1186/1479-5876-10-179.CrossRef Carbone M, Ferris LK, Baumann F, Napolitano A, Lum CA, Flores EG, Gaudino G, Powers A, Bryant-Greenwood P, Krausz T: BAP1 cancer syndrome: malignant mesothelioma, uveal and cutaneous melanoma, and MBAITs. J Trans Med. 2012, 10: 179-10.1186/1479-5876-10-179.CrossRef
14.
Zurück zum Zitat Njauw CN, Kim I, Piris A, Gabree M, Taylor M, Lane AM, DeAngelis MM, Gragoudas E, Duncan LM, Tsao H: Germline BAP1 inactivation is preferentially associated with metastatic ocular melanoma and cutaneous-ocular melanoma families. PLoS One. 2012, 7: e35295-10.1371/journal.pone.0035295.PubMedCentralCrossRefPubMed Njauw CN, Kim I, Piris A, Gabree M, Taylor M, Lane AM, DeAngelis MM, Gragoudas E, Duncan LM, Tsao H: Germline BAP1 inactivation is preferentially associated with metastatic ocular melanoma and cutaneous-ocular melanoma families. PLoS One. 2012, 7: e35295-10.1371/journal.pone.0035295.PubMedCentralCrossRefPubMed
15.
Zurück zum Zitat Moore MW, Gasparini R: FISH as an effective diagnostic tool for the management of challenging melanocytic lesions. Diagn Pathol. 2011, 6: 76-10.1186/1746-1596-6-76.PubMedCentralCrossRefPubMed Moore MW, Gasparini R: FISH as an effective diagnostic tool for the management of challenging melanocytic lesions. Diagn Pathol. 2011, 6: 76-10.1186/1746-1596-6-76.PubMedCentralCrossRefPubMed
16.
Zurück zum Zitat Bauer J, Bastian BC: Distinguishing melanocytic nevi from melanoma by DNA copy number changes: comparative genomic hybridization as a research and diagnostic tool. Dermatol Ther. 2006, 19: 40-49. 10.1111/j.1529-8019.2005.00055.x.CrossRefPubMed Bauer J, Bastian BC: Distinguishing melanocytic nevi from melanoma by DNA copy number changes: comparative genomic hybridization as a research and diagnostic tool. Dermatol Ther. 2006, 19: 40-49. 10.1111/j.1529-8019.2005.00055.x.CrossRefPubMed
17.
Zurück zum Zitat Nodin B, Fridberg M, Jonsson L, Bergman J, Uhlen M, Jirstrom K: High MCM3 expression is an independent biomarker of poor prognosis and correlates with reduced RBM3 expression in a prospective cohort of malignant melanoma. Diagn Pathol. 2012, 7: 82-10.1186/1746-1596-7-82.PubMedCentralCrossRefPubMed Nodin B, Fridberg M, Jonsson L, Bergman J, Uhlen M, Jirstrom K: High MCM3 expression is an independent biomarker of poor prognosis and correlates with reduced RBM3 expression in a prospective cohort of malignant melanoma. Diagn Pathol. 2012, 7: 82-10.1186/1746-1596-7-82.PubMedCentralCrossRefPubMed
18.
Zurück zum Zitat Schimming TT, Grabellus F, Roner M, Pechlivanis S, Sucker A, Bielefeld N, Moll I, Schadendorf D, Hillen U: pHH3 immunostaining improves interobserver agreement of mitotic index in thin melanomas. Am J Dermatopathol. 2012, 34: 266-269. 10.1097/DAD.0b013e31823135a3.CrossRefPubMed Schimming TT, Grabellus F, Roner M, Pechlivanis S, Sucker A, Bielefeld N, Moll I, Schadendorf D, Hillen U: pHH3 immunostaining improves interobserver agreement of mitotic index in thin melanomas. Am J Dermatopathol. 2012, 34: 266-269. 10.1097/DAD.0b013e31823135a3.CrossRefPubMed
19.
Zurück zum Zitat Harbour JW, Roberson ED, Anbunathan H, Onken MD, Worley LA, Bowcock AM: Recurrent mutations at codon 625 of the splicing factor SF3B1 in uveal melanoma. Nat Gen. 2013, 45 (2): 133-135. 10.1038/ng.2523. Epub 2013 Jan 13CrossRef Harbour JW, Roberson ED, Anbunathan H, Onken MD, Worley LA, Bowcock AM: Recurrent mutations at codon 625 of the splicing factor SF3B1 in uveal melanoma. Nat Gen. 2013, 45 (2): 133-135. 10.1038/ng.2523. Epub 2013 Jan 13CrossRef
20.
Zurück zum Zitat Papaemmanuil E, Cazzola M, Boultwood J, Malcovati L, Vyas P, Bowen D, Pellagatti A, Wainscoat JS, Hellstrom-Lindberg E, Gambacorti-Passerini C: Somatic SF3B1 mutation in myelodysplasia with ring sideroblasts. N Eng J Med. 2011, 365: 1384-1395. 10.1056/NEJMoa1103283.CrossRef Papaemmanuil E, Cazzola M, Boultwood J, Malcovati L, Vyas P, Bowen D, Pellagatti A, Wainscoat JS, Hellstrom-Lindberg E, Gambacorti-Passerini C: Somatic SF3B1 mutation in myelodysplasia with ring sideroblasts. N Eng J Med. 2011, 365: 1384-1395. 10.1056/NEJMoa1103283.CrossRef
21.
Zurück zum Zitat Quesada V, Conde L, Villamor N, Ordonez GR, Jares P, Bassaganyas L, Ramsay AJ, Bea S, Pinyol M, Martinez-Trillos A: Exome sequencing identifies recurrent mutations of the splicing factor SF3B1 gene in chronic lymphocytic leukemia. Nat Gen. 2012, 44: 47-52.CrossRef Quesada V, Conde L, Villamor N, Ordonez GR, Jares P, Bassaganyas L, Ramsay AJ, Bea S, Pinyol M, Martinez-Trillos A: Exome sequencing identifies recurrent mutations of the splicing factor SF3B1 gene in chronic lymphocytic leukemia. Nat Gen. 2012, 44: 47-52.CrossRef
22.
Zurück zum Zitat Ellis MJ, Ding L, Shen D, Luo J, Suman VJ, Wallis JW, Van Tine BA, Hoog J, Goiffon RJ, Goldstein TC: Whole-genome analysis informs breast cancer response to aromatase inhibition. Nature. 2012, 486: 353-360.PubMedCentralPubMed Ellis MJ, Ding L, Shen D, Luo J, Suman VJ, Wallis JW, Van Tine BA, Hoog J, Goiffon RJ, Goldstein TC: Whole-genome analysis informs breast cancer response to aromatase inhibition. Nature. 2012, 486: 353-360.PubMedCentralPubMed
23.
Zurück zum Zitat Houben R, Becker JC, Kappel A, Terheyden P, Brocker EB, Goetz R, Rapp UR: Constitutive activation of the Ras-Raf signaling pathway in metastatic melanoma is associated with poor prognosis. J Carcinogen. 2004, 3: 6-10.1186/1477-3163-3-6.CrossRef Houben R, Becker JC, Kappel A, Terheyden P, Brocker EB, Goetz R, Rapp UR: Constitutive activation of the Ras-Raf signaling pathway in metastatic melanoma is associated with poor prognosis. J Carcinogen. 2004, 3: 6-10.1186/1477-3163-3-6.CrossRef
24.
Zurück zum Zitat Beadling C, Jacobson-Dunlop E, Hodi FS, Le C, Warrick A, Patterson J, Town A, Harlow A, Cruz F, Azar S: KIT gene mutations and copy number in melanoma subtypes. Clin Cancer Res J Am Assoc Cancer Res. 2008, 14: 6821-6828. 10.1158/1078-0432.CCR-08-0575.CrossRef Beadling C, Jacobson-Dunlop E, Hodi FS, Le C, Warrick A, Patterson J, Town A, Harlow A, Cruz F, Azar S: KIT gene mutations and copy number in melanoma subtypes. Clin Cancer Res J Am Assoc Cancer Res. 2008, 14: 6821-6828. 10.1158/1078-0432.CCR-08-0575.CrossRef
25.
Zurück zum Zitat Carvajal RD, Antonescu CR, Wolchok JD, Chapman PB, Roman RA, Teitcher J, Panageas KS, Busam KJ, Chmielowski B, Lutzky J: KIT as a therapeutic target in metastatic melanoma. JAMA. 2011, 305: 2327-2334. 10.1001/jama.2011.746.PubMedCentralCrossRefPubMed Carvajal RD, Antonescu CR, Wolchok JD, Chapman PB, Roman RA, Teitcher J, Panageas KS, Busam KJ, Chmielowski B, Lutzky J: KIT as a therapeutic target in metastatic melanoma. JAMA. 2011, 305: 2327-2334. 10.1001/jama.2011.746.PubMedCentralCrossRefPubMed
26.
Zurück zum Zitat Curtin JA, Busam K, Pinkel D, Bastian BC: Somatic activation of KIT in distinct subtypes of melanoma. J Clin Oncol J Am Soc Clin Oncol. 2006, 24: 4340-4346. 10.1200/JCO.2006.06.2984.CrossRef Curtin JA, Busam K, Pinkel D, Bastian BC: Somatic activation of KIT in distinct subtypes of melanoma. J Clin Oncol J Am Soc Clin Oncol. 2006, 24: 4340-4346. 10.1200/JCO.2006.06.2984.CrossRef
28.
Zurück zum Zitat Forbes SA, Bindal N, Bamford S, Cole C, Kok CY, Beare D, Jia M, Shepherd R, Leung K, Menzies A: COSMIC: mining complete cancer genomes in the Catalogue of Somatic Mutations in Cancer. Nucleic Acids Res. 2011, 39: D945-950. 10.1093/nar/gkq929.PubMedCentralCrossRefPubMed Forbes SA, Bindal N, Bamford S, Cole C, Kok CY, Beare D, Jia M, Shepherd R, Leung K, Menzies A: COSMIC: mining complete cancer genomes in the Catalogue of Somatic Mutations in Cancer. Nucleic Acids Res. 2011, 39: D945-950. 10.1093/nar/gkq929.PubMedCentralCrossRefPubMed
29.
Zurück zum Zitat Krauthammer M, Kong Y, Ha BH, Evans P, Bacchiocchi A, McCusker JP, Cheng E, Davis MJ, Goh G, Choi M: Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma. Nat Gen. 2012, 44: 1006-1014. 10.1038/ng.2359.CrossRef Krauthammer M, Kong Y, Ha BH, Evans P, Bacchiocchi A, McCusker JP, Cheng E, Davis MJ, Goh G, Choi M: Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma. Nat Gen. 2012, 44: 1006-1014. 10.1038/ng.2359.CrossRef
30.
Zurück zum Zitat Hodis E, Watson IR, Kryukov GV, Arold ST, Imielinski M, Theurillat JP, Nickerson E, Auclair D, Li L, Place C: A landscape of driver mutations in melanoma. Cell. 2012, 150: 251-263. 10.1016/j.cell.2012.06.024.PubMedCentralCrossRefPubMed Hodis E, Watson IR, Kryukov GV, Arold ST, Imielinski M, Theurillat JP, Nickerson E, Auclair D, Li L, Place C: A landscape of driver mutations in melanoma. Cell. 2012, 150: 251-263. 10.1016/j.cell.2012.06.024.PubMedCentralCrossRefPubMed
Metadaten
Titel
Lack of SF3B1 R625 mutations in cutaneous melanoma
verfasst von
Bastian Schilling
Nicola Bielefeld
Antje Sucker
Uwe Hillen
Lisa Zimmer
Dirk Schadendorf
Michael Zeschnigk
Klaus G Griewank
Publikationsdatum
01.12.2013
Verlag
BioMed Central
Erschienen in
Diagnostic Pathology / Ausgabe 1/2013
Elektronische ISSN: 1746-1596
DOI
https://doi.org/10.1186/1746-1596-8-87

Weitere Artikel der Ausgabe 1/2013

Diagnostic Pathology 1/2013 Zur Ausgabe

Neu im Fachgebiet Pathologie

Molekularpathologische Untersuchungen im Wandel der Zeit

Open Access Biomarker Leitthema

Um auch an kleinen Gewebeproben zuverlässige und reproduzierbare Ergebnisse zu gewährleisten ist eine strenge Qualitätskontrolle in jedem Schritt des Arbeitsablaufs erforderlich. Eine nicht ordnungsgemäße Prüfung oder Behandlung des …

Vergleichende Pathologie in der onkologischen Forschung

Pathologie Leitthema

Die vergleichende experimentelle Pathologie („comparative experimental pathology“) ist ein Fachbereich an der Schnittstelle von Human- und Veterinärmedizin. Sie widmet sich der vergleichenden Erforschung von Gemeinsamkeiten und Unterschieden von …

Gastrointestinale Stromatumoren

Open Access GIST CME-Artikel

Gastrointestinale Stromatumoren (GIST) stellen seit über 20 Jahren ein Paradigma für die zielgerichtete Therapie mit Tyrosinkinaseinhibitoren dar. Eine elementare Voraussetzung für eine mögliche neoadjuvante oder adjuvante Behandlung bei …

Personalisierte Medizin in der Onkologie

Aufgrund des erheblichen technologischen Fortschritts in der molekularen und genetischen Diagnostik sowie zunehmender Erkenntnisse über die molekulare Pathogenese von Krankheiten hat in den letzten zwei Jahrzehnten ein grundlegender …