Introduction
The classical IFN family cytokines, such as types I and II IFNs, are known to play an important role in both innate and adaptive immune responses during viral infection and autoimmune inflammation. Type III IFNs, or IFN-λs, are a newly described member of the IFN family, including IFN-λ1 (IL-29), IFN-λ2 (IL-28A) and IFN-λ3 (IL-28B). Each member of type III IFNs signals through the heterodimeric receptor complex, including the IFN-λR (IL-28Rα) chain and IL-10 receptor type 2 (IL-10R2) chain [
1,
2]. IL-28Rα expression is cell-specific, whereas IL-10R2 is broadly expressed in most cell types, such as type I IFN receptors [
2]. Type III IFNs bind to their receptors and activate the Janus kinase/signal transducers and activators of transcription (JAK-STAT), mitogen-activated protein kinase and Akt signaling pathways to induce antiviral, antiproliferative, antitumor and immune responses [
3‐
5]. Although the antiviral activity has been studied extensively during the past decade, the immunoregulatory role of type III IFNs in immune cells is still poorly understood.
The evidence for an immunoregulatory role of IL-29 is derived mostly from
in vitro studies. For example, IL-29 inhibits the release of IL-13 in T cells [
6,
7]; increases the production of IL-6, IL-8 and IL-10 in macrophages [
8]; and induces the secretion of IL-6 and TNF from CD14
+ T cells [
9] as well as IL-4 and IL-13 from mast cells [
10]. Investigators in a recent study reported that IL-29 induces the secretion of chemokines IFN-γ-inducible protein 10, monokine induced by IFN-γ and IL-8 in peripheral blood mononuclear cells (PBMCs) [
11,
12] in patients with systemic lupus erythematosus (SLE), implying its involvement in SLE pathogenesis. Significantly, our recent study was the first showing that IL-29 was highly expressed in PBMCs, serum, synovial fluid and synovium in rheumatoid arthritis (RA) patients [
13]. However, little is known about what triggers the expression of IL-29 and how elevated IL-29 levels drive synovial inflammation during RA development.
It has recently been postulated that the interaction of genetic and environmental factors contributes to RA pathogenesis. For instance, Toll-like receptors (TLRs) may recognize cytomegalovirus [
14,
15] and Epstein-Barr virus [
16] and trigger autoimmunity in the host. TLRs are phylogenetically conserved molecules that recognize pathogen-associated molecular patterns and eliminate invading pathogens by activation of immune responses. In RA, several TLRs, including TLR2, TLR3, TLR4 and TLR7, are highly expressed in the synovial tissues [
17], and the ligands of TLRs induce the expression of cytokines (IL-1β, IL-6 and IFN-α), chemokines (IL-8) and matrix metalloproteinases on synovial fibroblasts (FLSs) [
18‐
21], which contributes to RA synovial inflammation. Interestingly, proinflammatory cytokines such as IL-1β itself further upregulate TLR expression on FLSs [
22,
23], suggesting autoamplification of inflammation in RA-FLS through interaction of TLRs and cytokines.
This notion is further supported by the evidence that IFNs are able to modulate TLR-mediated cytokine production in immune cells. It has been shown that IFN-α enhances the expression of TLR3 and TLR7, leading to increased production of IL-6 and TNF-α in RA-FLS [
24]. In addition, TLR4- and TLR8-induced p40 subunit of IL-12 (IL-12p40) production is increased by IL-29 in human monocyte-derived macrophage [
25]. Despite this evidence, whether IL-29 is also involved in TLR-induced proinflammatory cytokine production in RA-FLS has not been reported. Considering that both IL-29 and TLRs could elevate mRNA levels of IL-6 and IL-8 in RA-FLS, we examined the effect of IL-29 on TLR-mediated IL-6 and IL-8 production contributing to RA inflammation.
In the present study, we show for the first time that TLR2, TLR3 and TLR4 engagement on RA-FLS induces endogenous IL-29, which further enhances IL-6 and IL-8 expression by upregulation of TLR2, TLR3 and TLR4 expression. Our findings demonstrate that, in addition to its potent antiviral activity, IL-29 plays an important role in modulating cytokine production in RA-FLS, which may enhance immune responses to the pathogens contributing to RA inflammation.
Methods
Reagents
TRIzol reagent and SYBR Green I stain were purchased from Invitrogen (Carlsbad, CA, USA). ExScript RT reagent kit and SYBR Premix Ex Taq were obtained from TaKaRa (Dalian, China). Human IL-29 ELISA kits were purchased from Adlitteram Diagnostic Laboratories (San Diego, CA, USA), human IL-6 and IL-8 ELISA kits were obtained from ExCell Biology Inc (Shanghai, China). Cell proliferation reagent WST-1 was purchased from Roche Diagnostics GmbH (Roche Applied Science, Mannheim, Germany). A cell fixation permeabilization kit and Cytofix/Cytoperm solution were purchased from BD Pharmingen (San Jose, CA, USA), fluorescein isothiocyanate (FITC)-conjugated anti-human TLR2 (clone TL2.1), phycoerythrin-conjugated anti-human TLR3 (clone TLR3.7) and TLR 4 (clone HTA125) monoclonal antibody or isotope control were obtained from eBioscience (San Diego, CA, USA). DMEM and FBS were purchased from Gibco (Carlsbad, CA, USA). Recombinant human IL-29 and TNF-α were purchased from Peprotech (Rocky Hill, NJ, USA). Polyinosinic-polycytidylic acid (poly(I:C)) and peptidoglycan (PGN) were obtained from Invivogen (San Diego, CA, USA). Lipopolysaccharide (LPS) was purchased from Sigma-Aldrich (St Louis, MO, USA).
Cell culture
Human rheumatoid fibroblast-like synoviocyte MH7A cells were isolated from intra-articular soft tissue of the knee joints of RA patients and were established as a cell line by transfection with the Simian virus 40 T antigen [
26]. The cell line was kindly provided by Dr David Yu (University of California, Los Angeles, CA, USA), and ethical approval for their use was waived by the Review Board of the First Affiliated Hospital of Nanjing Medical University. MH7A cells were cultured in DMEM supplemented with 10% FBS, 100 U/ml penicillin and 100 μg/ml streptomycin at 37°C in a humidified atmosphere of 5% CO
2 in air. Details regarding primary RA fibroblast isolation and culture can be found in Additional file
1.
Stimulation of synovial fibroblasts
To study functional upregulation of IL-29, we stimulated MH7A cells with various concentrations of IL-29 (1, 10 and 100 ng/ml) or TNF-α (10 ng/ml) for 24 hours. After incubation, the cell supernatants were collected for analysis of IL-6 and IL-8 production measured by ELISA as described below.
To study functional upregulation of TLR2, TLR3 and TLR4, we cultured MH7A cells with IL-29 (100 ng/ml) for 24 hours and subsequently stimulated cells with the TLR2, TLR3 and TLR4 ligand PGN (2.5 μg/ml), poly(I:C) (25 μg/ml) or LPS (100 ng/ml), respectively. After a further 24 hours, MH7A cells were collected for analysis of IL-6 and IL-8 expression by real-time PCR.
To study TLR expression, we provoked MH7A cells with various concentrations of IL-29 (1, 10 and 100 ng/ml) or TNF-α (10 ng/ml; positive control) for 24 hours. After incubation, MH7A cells were collected for analysis of TLR2, TLR3 and TLR4 expression by real-time PCR and flow cytometry assay.
To study IL-29 expression, we stimulated MH7A cells with TLR2, TLR3 or TLR4 ligand PGN (2.5 μg/ml), poly(I:C) (25 μg/ml) or LPS (100 ng/ml) for 24 hours, respectively. After incubation, the cells were collected for analysis of IL-29 gene expression by real-time PCR and analysis of cell supernatants for IL-29 protein expression by ELISA.
Viability assay by MTT
Cell viability was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay after MH7A cell incubation with IL-29. Briefly, MH7A cells (5 × 103) were incubated in a 96-well, flat-bottomed culture plate in a final volume of 200 μl/well culture medium with or without IL-29 (100 ng/ml) for 24 hours in a humidified atmosphere (37°C at 5% CO2). Next, 20 μl of cell proliferation reagent WST-1 were added to each well and incubated for a further 4 hours. After incubation, the plates were shaken thoroughly for 1 minute, and the absorbance was measured at 450 nm and 630 nm using an ELISA plate reader (BioTek, Winooski, VT, USA).
Semiquantitative RT-PCR and quantitative real-time PCR analysis
The mRNA expression of the IL-29 complex, receptor IL-28Rα and IL-10R2, in MH7A cells was determined by semiquantitative PCR. Total RNA from the cells was isolated using TRIzol reagent. The cDNA was prepared using the ExScript RT reagent kit according to the manufacturer’s instructions and then was amplified by PCR with specific primers for human IL-28Rα (5′-ACCTATTTTGTGGCCTATCAGAGCT-3′ and 5′-CGGCTCCACTTCAAAAAGGTAAT-3′), IL-10R2 (5′-GGCTGAATTTGCAGATGAGCA-3′ and 5′-GAAGACCGAGGCCATGAGG-3′), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5′-AGAAGGCTGGGGCTCATTTG-3′ and 5′-AGGGGCCATCCACAGTCTTC-3′). The conditions for each amplification were as follows: 95°C for 45 seconds, 40 cycles of denaturation at 95°C for 30 seconds, annealing temperatures at 59°C for 30 seconds and extension at 72°C for 35 seconds. The PCR products were electrophoresed on 2.0% agarose gels, stained with SYBR Green I Nucleic Acid Gel Stain (Invitrogen) and visualized by using a gel imaging system (ChemiDoc XRS + System; Bio-Rad Laboratories, Hercules, CA, USA).
The mRNA of IL-29, IL-6, IL-8, TLR2, TLR3 and TLR4 in MH7A cells was determined by real-time PCR. Briefly, after synthesizing cDNA from the total RNA by using the ExScript RT reagent kit, real-time PCR was performed using SYBR
Premix Ex Taq on a sequence detection system (Eppendorf, Hamburg, Germany). Each reaction contained 12.5 μl of 2× SYBR Green Master Mix, 1 μl of 10 μM primers and 1 μl of cDNA to a total volume of 20 μl. The thermal cycling conditions included an initial denaturation step at 95°C for 30 seconds, followed by 40 cycles of 5 seconds at 95°C and 30 seconds at 60°C. Primer sequences for human IL-29, IL-6, IL-8, TLR2, TLR3, TLR4 and GAPDH are summarized in Table
1. Relative gene expression was determined by the 2
-ΔΔCt method.
Table 1
Gene primers for quantitative PCR analysis
Human IL-29 | GAAGCAGTTGCGATTTAGCC | GAAGCTCGCTAGCTCCTGTG |
Human IL-6 | AACCTGAACCTTCCAAAGATGG | TCTGGCTTGTTCCTCACTACT |
Human IL-8 | CATACTCCAAACCTTTCCACCCC | TCAGCCCTCTTCAAAAACTTCTCCA |
Human TLR2 | TGTTGCAAGCAGGATCCAAAG | CACAAAGTATGTGGCATTGTCCAG |
Human TLR3 | GGACTTTGAGGCGGGTGTT | TGTTGAACTGCATGATGTAC CTTGA |
Human TLR4 | AGGATGATGCCAGCATGATGTC | TCAGGTCCAGGTTCTTGGTTGAG |
Human GAPDH | AGAAGGCTGGGGCTCATTTG | AGGGGCCATCCACAGTCTTC |
ELISA analysis
The amounts of secreted IL-29, IL-6 and IL-8 in culture supernatants of MH7A cells were measured by ELISA according to the manufacturer’s instructions.
Flow cytometry analysis
After incubation with IL-29, MH7A cells were pelleted by centrifugation at 450 g for 5 minutes, then fixed and permeabilized by using a cell fixation permeabilization kit. Briefly, thoroughly resuspended cells were added to 100 μl of BD Cytofix/Cytoperm solution and incubated for 20 minutes at 4°C. Cells were then incubated with FITC-conjugated rat anti-human TLR2, TLR3 and TLR4 monoclonal antibody or isotope control, respectively (at a final concentration 4 μg/ml), at 4°C for 30 minutes. After cells were washed, they were analyzed on a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA, USA).
Statistical analysis
Statistical analyses were performed with SPSS software (SPSS, Inc, Chicago, IL, USA), and all figures were drawn using GraphPad Prism 5.0 software (GraphPad Software, La Jolla, CA, USA). Data were expressed as means ± SD. Differences between two groups were calculated using Student’s t-test for parametric data and the Mann–Whitney U test for nonparametric data. For all experiments, P < 0.05 was taken as significant.
Discussion
In our previous study, we reported that IL-29 may contribute to synovial inflammation during RA pathogenesis. In this study, we further investigated the underlying molecular mechanism by which IL-29 contributes to RA inflammation. We examined whether IL-29 affects cytokine production in response to TLR ligands to determine its affect on the classical pattern recognition initiated by FLS-driven responses. Our results show for the first time that IL-29 is able to enhance TLR2, TLR3 and TLR4 expression in RA-FLS, leading to increased production of IL-6 and IL-8. This conclusion is supported by the following observations: (1) IL-29 induces IL-6 and IL-8 mRNA and protein expression in RA-FLS; (2) IL-29 increases mRNA and protein expression of TLR2, TLR3 and TLR4 in RA-FLS; and (3) TLR2, TLR3 and TLR4 ligands elevate the expression of IL-6 and IL-8 in RA-FLS.
IL-29 has been shown to activate monocytes and macrophages to produce a restricted panel of cytokines. Jordan
et al. reported that IL-29 alone, in the absence of TLR ligands, induced high levels of IL-6 and IL-8 by human monocytes, which was further enhanced by LPS [
8]. However, several other groups were unable to observe the induction of IL-6 and IL-8 by IL-29 in the absence of TLR ligands because no IL-29 receptor was unexpressed in human primary monocytes [
25,
27,
28]. We previously reported that MH7A cells express IL-28Rα (the specific receptor of IL-29) evidenced by immunofluorescence staining [
13]. In the present study, we show that the complex receptor of IL-29, including IL-28Rα and IL-10R2, is expressed in both human primary RA-FLSs and RA-FLS cell line MH7A cells. Therefore, RA-FLSs are responsive to IL-29 and may release IL-6 and IL-8 in the absence of TLR ligands. We also found the increased protein expression of IL-6 and IL-8 in RA-FLSs after IL-29 stimulation, which is in agreement with the change in mRNA level of IL-6 and IL-8 after IL-29 stimulation, as we reported in our previous study. Induction of IL-6 and IL-8 (an important chemoattractant for neutrophils) by IL-29 suggests a link between the innate and adaptive response and early recruitment of inflammatory cells to the site of inflammation by IL-29.
In addition to induction of IL-6 and IL-8 production by IL-29 in RA-FLSs, we also observed that IL-29 enhances TLR2, TLR3 and TLR4 mRNA and protein expression in RA-FLSs. This is important because TLR and its ligands are abundant in RA synovium, which is needed for the initiation of a chronic and persisting inflammatory response in RA. TLR2 and TLR4 elicit immune responses on binding of antigens from bacteria and endogenous ligands, leading to the production of inflammatory mediators. TLR3 serves as a receptor for viral nucleic acids and have a key role in antiviral immunity. To the best of our knowledge, upregulation of TLR2, TLR3 and TLR4 by IL-29 in RA-FLS has not been previously reported.
Taken together, our data provide valid evidence that IL-29 could trigger cytokines and TLRs expression in FLS cell line and primary cells. Considering that we previously reported that synovial macrophages and fibroblasts might be the source of the high expression of IL-29 in inflamed joint of RA, it is possible that high levels of IL-29 derived from either synovial macrophages or fibroblasts in turn contribute to RA pathogenesis.
In addition, the ligands of TLR2, TLR3 and TLR4 are reported to induce IL-29 production in dendritic cells and macrophages [
29]. In line with this, our supplementary data also document that stimulation of TLR2, TLR3 and TLR4 leads to an increased production of IL-29 in RA-FLSs for the first time (see Additional file
7: Figure S6). Considering that macrophages produce IL-29 early in the course of viral infection [
30], it is tempting to speculate that the induction of IL-29 is an early event following challenge with bacterially or virally derived pathogens. IL-29 subsequently activates RA-FLSs to release IL-6, IL-8 or other proinflammatory cytokines via TLR-mediated signaling and contributes to the chronic inflammation in RA. The exact mechanism underpinning the augmented TLR response after preincubation with IL-29 is not yet understood. On the basis of our data, we conclude that this phenomenon results from increased expression of TLR2, TLR3 and TLR4.
Acknowledgements
We thank Dr Bingruo Wu of Albert Einstein College of Medicine of Yeshiva University for critical comments. This project was sponsored by grants from the National Natural Science Foundation of China (30901332, 81172845 and 81273294), the Key Project of the Natural Science Foundation of Jiangsu Province, China (BK2011851 and BK2012875), the Graduate Innovation Project of Jiangsu Province, China (CXZZ11-0701), and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
LX, XF, WG and DG performed experiments. FW, WT and MZ contributed to drafting the manuscript and to study design and data analysis. All authors read and approved the final manuscript.