Skip to main content
Erschienen in: BMC Cancer 1/2016

Open Access 01.12.2016 | Research article

Aspirin inhibits epithelial-to-mesenchymal transition and migration of oncogenic K-ras-expressing non-small cell lung carcinoma cells by down-regulating E-cadherin repressor Slug

verfasst von: Poulami Khan, Argha Manna, Shilpi Saha, Suchismita Mohanty, Shravanti Mukherjee, Minakshi Mazumdar, Deblina Guha, Tanya Das

Erschienen in: BMC Cancer | Ausgabe 1/2016

Abstract

Background

Cancer metastasis is one of the most common causes of treatment failure and death in cancer patients. It has been acknowledged that aberrant activation of epithelial-to-mesenchymal transition (EMT) program, endows cancer cells with metastatic competence for which E-cadherin switch is a well-established hallmark. Suppression of E-cadherin by its transcriptional repressor Slug is thus a determining factor for EMT. Here, we aimed at discerning (i) the molecular mechanisms that regulate Slug/E-cadherin axis in oncogenic K-ras-expressing non-small cell lung carcinoma (NSCLC) cells, and (ii) the effect of aspirin in modulating the same.

Methods

The migratory behaviour of NSCLC cell line A549 were deciphered by wound healing assay. Further assessment of the molecular mechanisms was done by western blotting, RT-PCR, confocal microscopy, chromatin immunoprecipitation and small interfering RNA (siRNA)-mediated gene silencing.

Results

Here we report that in oncogenic K-ras-expressing A549 cells, Ras/ERK downstream Elk-1 forms p-Elk-1-p300 complex that being directly recruited to SLUG promoter acetylates the same to ensure p65NFκB binding for transcriptional up-regulation of Slug, a transcriptional repressor of E-cadherin. Aspirin inhibits EMT and decelerates the migratory potential of A549 cells by down-regulating Slug and thereby up-regulating E-cadherin. Aspirin impedes activation and nuclear translocation of p65NFκB, essential for this transcription factor being available for SLUG promoter binding. As a consequence, Slug transcription is down-regulated relieving A549 cells from Slug-mediated repression of E-cadherin transcription, thereby diminishing the metastatic potential of these oncogenic Ras-expressing NSCLC cells.

Conclusions

Cumulatively, these results signify a crucial role of the anti-inflammatory agent aspirin as a novel negative regulator of epithelial-to-mesenchymal transition thereby suggesting its candidature as a promising tool for deterring metastasis of highly invasive K-ras-expressing NSCLC cells.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​s12885-016-2078-7) contains supplementary material, which is available to authorized users.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

TD conceptualized the project, designed the experiments, edited the manuscript; PK executed most of the experiments, analyzed related results and wrote the manuscript; AM and SS performed immunoflurescence and ChIP assays, analyzed experiments and interpreted results; SM (Suchismita Mohanty) did western blotting experiments; SM (Shravanti Mukherjee) performed migration assays; MM carried out transfections and DG did RT-PCR experiments. All authors read and approved the final manuscript.
Abkürzungen
DN-K-ras
Dominant negative K-ras
EMT
Epithelial-mesenchymal transition
IκBα-SR cDNA
Inhibitory kappa beta super repressor complementary DNA
MMP-2
Matrix metalloproteinase-2
MMP-9
Matrix metalloproteinase-9
NSAID
Non-steroidal anti-inflammatory drug
NSCLC
Non-small cell lung carcinoma
PE
Phycoerythrin

Background

The major cause of severity and incurability of NSCLCs is due to establishment of cancer cells as metastatic entity. The initiation of tumor metastasis involves increased migratory and invasive capabilities. During tumor progression, tumor cells acquire molecular expression of mesenchymal markers and loss the expression of epithelial markers to result in epithelial to mesenchymal transition (EMT) and subsequent tumor metastasis [1]1. EMT is a precisely regulated process through which epithelial cells lose polarity and cell to cell junction and gain a fibroblast-like morphology [2]2. An important hallmark of EMT, during which the cell skeleton undergoes rearrangement, is the loss of expression of the cell to cell adhesion molecule, E-cadherin which is one of the most important indicators of epithelial phenotype [3]3. E-cadherin is thus a suppressor of invasion and metastasis and its down-regulation provokes the development of malignant epithelial cancers [46]4,5,6. Several developmentally important genes that induce EMT have been shown to act as E-cadherin repressors [7]7. Suppression of E-cadherin expression by its transcriptional suppressor—Slug plays a crucial role in epithelial to mesenchymal transition. Slug, a member of the Snail family of transcriptional repressors, is capable of repressing E-cadherin expression in epithelial cells via the E-box elements in the proximal E-cadherin promoter [7]8 and thereby triggering EMT [79]9,10,11, suggesting that it may act to promote invasion. Slug expression has been shown to have a strong correlation with loss of E-cadherin in cancer cells [7]12, suggesting Slug to be a likely in vivo repressor of E-cadherin expression in metastatic cancers.
It is well known that, human cancers with oncogenic mutation in Ras allele are highly aggressive and are associated with poor prognosis. K-ras mutational status has been found to be closely associated with both primary tumors and metastases for more than 90 % of the patients with lung cancer [10, 11]13,14. Most K-ras mutations in NSCLCs have been found at codon 12 resulting in constitutive activation of Ras proteins that regulates cell junctions in lung epithelial cells through Cox-2 induction and indulges the process of tumor metastasis [1214]15,16,17. There are several reports signifying NFκB as an important downstream target of Ras-activated signal transduction pathways [15]18. Interestingly, correlation between increased activity of NFκB and expression of K-ras has been revealed in recent years [16, 17]19,20. In fact the activity of transcriptional activation domain of NFκB, i.e., RelA/p65 subunit, was found to be increased significantly in Ras-transformed cells [18]21. In an oncogenic K-ras-induced lung cancer mouse model, genetic alteration of p65 has been found to reduce tumorigenesis [19]22. Arsura et al. has reported aberrant activation of classical NFκB in Ras-transformed rat liver epithelial cells due to increased phosphorylation and degradation of IκBα protein [20]23. Many reports also indicate the involvement of RelA/p65 in metastatic potential of tumors [2123]24,25,26. According to Huber et al., while NFκB plays a crucial role in the induction of EMT in Ras-transformed mammary epithelial cells, blocking NFκB activity suppresses EMT phenotype [24]27. However, the exact molecular mechanism underlying the contribution of p65NFκB in oncogenic K-ras-expressing NSCLC cells invasive responses like EMT and metastasis, for which E-cadherin is a key inhibitory factor, is yet to be delineated.
Accumulating clinical and epidemiological evidences also provides a quite clear and strong link between inflammation and cancer progression. The non-steroidal anti-inflammatory drug aspirin is recently being reported to reduce risk of cancer initiation and progression and suggested to be used to target several tumor properties, including tumor cell migration [25]28. Regular use of aspirin has also been observed to decrease the risk of non-small cell lung carcinoma [2628]29,30,31, thereby suggesting that NSCLCs could be targeted by using aspirin. However, there is no detailed study on the anti-migratory role of aspirin in EMT and NSCLC cells' migration.
In a recent study, using paired colon cancer cell lines that differ in the expression of mutant K-ras, Wang et al. [29]32 identified that Slug is selectively required for the survival of cancer cells with mutant K-ras. They further showed that Slug is regulated by the Ras pathway and is very important for activated Ras induced EMT. This and other findings support Slug as a target for treatment of a broad spectrum of human cancers that have undergone EMT, associated at least in part with mutational activation of Ras [30]33.
This study elaborates that Ras-down-stream Elk-1-p300 complex acetylates and unwinds SLUG promoter to make it accessible for p65NFκB binding which is a pre-requisite for Slug transcription that subsequently leads to E-cadherin down-regulation. Further exploration focuses on the role of anti-inflammatory agent aspirin in up-regulating E-cadherin to inhibit EMT in oncogenic K-ras-expressing NSCLC cells, A549. In gist, aspirin represses the expression of Slug, a known negative regulator of E-cadherin, by blocking the activation of p65 subunit of NFκB and its translocation to nucleus. As a result, E-cadherin gets up-regulated which in turn decelerates the metastatic potential of these highly metastatic NSCLC cells. We therefore, project FDA-approved anti-inflammatory drug aspirin as a novel negative regulator of epithelial-to-mesenchymal transition, thereby signifying its candidature for deterring cancer metastasis.

Results

Oncogenic K-ras induces a pro-invasive EMT phenotype in NSCLC cells in a Slug-dependent pathway involving E-cadherin suppression

We first sought to evaluate the effects of oncogenic K-ras on the migratory response of wild-type p53-expressing NSCLC cells. To this end, we used A549 cells having K-ras mutation at codon 12 which is responsible for its oncogenic property, and compared its migratory potential with wild type K-ras-bearing H1299 cells that were p53-reconstituted (p53+/+). Results of wound healing assay showed higher migratory potential of A549 cells than p53-reconstituted H1299 cells (Fig. 1a) suggesting that the metastasizing capacity of cancer cells might be dependent on K-ras status, since all other conditions were same in the two cell lines. Validating this hypothesis, when dominant negative (DN) mutant form of RAS (N17-NRAS) was introduced in A549 cells (Fig. 1b, right panel), reduction in the migratory capacity of these transfectants was observed as compared to parental cells (Fig. 1b, left and middle panels). These results together confirm the contribution of oncogenic K-ras in migration of NSCLC cells. In addition to oncogenic K-ras, mutated p53 are also reported to correlate with metastatic phenotype and play gain-of-function role in oncogenesis. In line with this, two p53 mutants that are commonly found in human cancer and that have been extensively used to study role of p53, in cell migration are R273H (R270H in mice), which directly compromises DNA binding, and R175H (R172H in mice), which causes a global conformational distortion of p53 [31]34. These mutations inhibit p53’s ability to act as a transcription factor, accounting for their reduced ability to function as tumor suppressors. For this, to further check the role of mutant p53 in migration of NSCLCs, oncogenic K-ras expressing mutant p53 bearing NSCLC cell line NCI-H522 was used for wound healing migration assay (Additional file 1: Figure S1). Along with this, H1299 cells were transfected with p53 R175H clone (wild type K-ras mutated p53 system) and performed for wound healing assay. Conjointly our data revealed that presence of both oncogenic K-ras and p53 shows highest migratory capacity followed by oncogenic K-ras expressing NSCLCs. Migration potential of mutant p53 follows migration potential of oncogenic K-ras expressing NSCLCs. However, the lowest migration potential among the four sets is showed by wild type p53 expressing wild type Ras bearing sample. This in turn indicates that oncogenic K-ras accelerates the capacity of mutant p53 to induce migration.
Next, we attempted to investigate the mechanism underneath oncogenic K-ras-induced NSCLC cells migration. For the same, we compared the expression of the well known epithelial marker E-cadherin in oncogenic K-ras-bearing parental A549 cells and DN-K-ras reconstituted A549 cells, since loss of E-cadherin has been reported to endorse tumor metastasis [32]35. Convincingly, confocal images revealed increase in E-cadherin expression in DN-K-ras reconstituted A549 cells as compared to the parental oncogenic K-ras-expressing A549 cells (Fig. 1c, upper panel). In line with this, RT-PCR (Fig. 1c, lower left panel) and western blot (Fig. 1c, lower right panel) experiments further showed that in contrast to A549 cells, E-cadherin expression increased in DN-K-ras-reconstituted A549 cells. Role of E-cadherin in K-ras mediated retardation of NSCLCs migration was re-confirmed when E-cadherin-siRNA transfected-A549 cells exhibited increased migration over control siRNA-transfected cells (Fig. 1d).
Next, we aimed at exploring the molecular mechanism underneath oncogenic K-ras-mediated inhibition of E-cadherin. Multiple evidences indicate that the metastatic spread of cancer cells is strongly regulated by Slug, a transcriptional repressor of E-cadherin [32]36. To evaluate if Slug-dependent E-cadherin repression is relevant for oncogenic K-ras-induced invasiveness, we correlated the levels of Slug expression to K-ras status in parental as well as DN-K-ras-transfected A549 cells. Results of Fig. 1e depicted reduced expression of Slug both at transcriptional (Fig. 1e, upper panel) and translational (Fig. 1e, lower panel) levels in A549 cells with DN-K-ras when compared to parental A549 cells, while silencing Slug (Fig. 1f, right panel) restored E-cadherin levels at both mRNA (Fig. 1f, upper left panel) and protein levels (Fig. 1f, lower left panel), thereby further validating our hypothesis. In a parallel experiment, transfection of DN-K-ras in Slug-silenced (Fig. 1f, right panel) set reduced migration than the control ones (Fig. 1f, middle panel), thereby indicating that oncogenic K-ras uses Slug to induce malignant cell responses.

Oncogenic K-ras induced migration occurs through transcriptional up-regulation of Slug

From previous results we hypothesized that, oncogenic K-ras induces migration through up-regulation of Slug. To further investigate the complete signalling pathway up-stream of Slug, we studied downstream components of Ras/Raf/MEK/ERK pathway, MEK and ERK, and silenced them individually with MEK-siRNA (Fig. 2a, upper right panel) and ERK-siRNA (Fig. 2a, lower right panel), respectively, in oncogenic K-ras-bearing A549 cells. Both the transfectants showed increased expression of E-cadherin as well as decreased expression of Slug than control A549 cells, at both mRNA (Fig. 2a, upper left panel) and protein (Fig. 2a, lower left panel) levels. In line with this, percent cell migration was lower for MEK-siRNA- or ERK-siRNA-transfected A549 cells than control ones (Fig. 2b).
Interestingly, although silencing MEK/ERK led to Slug down-regulation, neither MEK nor ERK has any DNA-binding domains and, therefore, is not considered as transcription factors [33]37. Considering this information, we next searched for the contribution of another downstream transcription factor and observed the contribution of Elk-1, a direct substrate of ERK [34]38, in Slug repression. Moreover, the ETS family transcription factor Elk-1 is known as the downstream effecter molecule of all three MAPK pathways, i.e. p38 MAPK, JNK and ERK pathways but through different residues [35]39. ERK can bind to Elk-1 in the D-domain, which is located N-terminal from the C-terminal transcriptional domain (C-domain), and phosphorylate S383 and S389 in this domain [36]40. ERK-induced Elk-1 phosphorylation leads to enhanced DNA-binding and TCF-mediated transcriptional activation [37]41. Therefore, in our system, we designed battery of overlapping primer sets for SLUG promoter (Fig. 2c) and our chromatin immunoprecipitation (ChIP) assay demonstrated four putative binding sites of Elk-1 on the SLUG promoter, two on promoter 1 (−329 to −228 and −265 to −129) (Fig. 2d, upper panel) and two on promoter 2 (−496 to −384 and −181 to −40) (Fig. 2d, lower panel). Further search showed that in comparison to the control cells, Elk-1 expression did not show any significant change while the activation of Elk-1 was decreased in both DN-K-ras-expressing, MEK-siRNA-transfected and ERK-siRNA-transfected A549 cells (Fig. 2e, left panel). Since the changes in phophorylation of Elk-1 are relatively small, densitometric analysis of the same was represented in the right panel of Fig. 2e. In our next experiment, binding of p-Elk-1 on SLUG promoter was found to be decreased in DN-K-ras-reconstituted A549 cells than oncogenic K-ras-expressing control A549 cells (Fig. 2f). In keeping with our previous experiment where DN-K-ras-reconstituted A549 cells showed down-regulation of Slug mRNA levels than the control ones (Fig. 1e), these results directly proved the role of K-ras-downstream p-Elk-1 for Slug up-regulation.

Oncogenic K-ras in association with p65NFκB, up-regulates Slug transcription in A549 cells

It has been documented that in A549 cells, p65NFκB is over-expressed [38]42 and p65/RelA subunit of NFκB is functionally activated by Ras for efficiently promoting tumorigenesis [39]43. A very recent report also indicates binding of p65NFκB on SLUG promoter in A549 cells [40]44. Keeping these in mind, we next aimed at determining whether the interaction between Elk-1 and p65NFκB influences Slug expression and the mechanism behind it. Our search revealed four putative p65NFκB binding sites adjacent to p-Elk binding sites on SLUG promoter (Fig. 3a). We further aimed at verifying whether absence of oncogenic K-ras hampers binding of p65NFκB to SLUG promoter or not. Our ChIP analysis showed inhibition in p65NFκB binding in DN-K-ras reconstituted set (Fig. 3b). Next to check whether bindings of both oncogenic K-ras and p65NFκB are essential for Slug transcription to occur, we inhibited p65NFκB nuclear translocation by transfecting A549 cells with IκBα-SR-cDNA or silenced Elk-1-upstream ERK by transfecting A549 cells with ERK-siRNA (Fig. 3c). In both the cases, Slug transcription was found to be down-regulated similarly than control A549 cells (Fig. 3c). These results depict that the presence of both active p65NFκB and p-Elk-1 is pre-requisite for Slug expression to occur.
To understand the exact molecular mechanism underlying chromatin modification in our system, we checked the acetylation status of SLUG promoter under different conditions. To that end, either DN-K-ras or IκBα-SR-cDNA was transfected individually or in combination. In the control cells, where both oncogenic K-ras and p65NFκB were present, and in IκBα-SR-cDNA-transfected sets acetylation of SLUG promoter was observed. However, in cells transfected with DN-K-ras alone or in combination with IκBα-SR-cDNA, no acetylation of SLUG promoter could be seen (Fig. 3d). Since, in DN-K-ras transfected set, chromatin acetylation was absent and p65NFκB binding was hampered, these results highlighted that p-Elk1 is responsible for chromatin acetylation and thus for p65NFκB binding on SLUG promoter.
Since, Elk-1 is reported to form a pre-assembled complex with p300 and p300 acts like a co-activator in complexes that contain Elk-1, we proposed that in our system Elk-1 recruits p300 to acetylate SLUG promoter. Our co-immunoprecipitation experiment with p-Elk-1 and p300 confirmed our hypothesis (Fig. 3e). All these results further validated the co-operation of p-Elk-1 and p65NFκB for Slug up-regulation. Moreover, the parallel between gain of anti-migratory functions of oncogenic K-ras and p65NFκB is compatible with the concept of mutant K-ras acting as a promoting factor for the tumor migratory activity of p65NFκB.

Aspirin inhibits migration through down-regulation of Slug and up-regulation of E-cadherin

We next aimed to use FDA approved non-steroidal anti-inflammatory drug aspirin, which is a known p65NFκB inhibitor [41, 42]45,46 and is reported to reduce risk for cancer initiation and progression to its users [4345]47,48,49. Additionally, several reports suggest that aspirin could be targeted for several other tumor properties including tumor migration [4648]50,51,52. However, there are no detail studies indicating anti-migratory role of aspirin on NSCLCs.
Interestingly, results of Fig. 4a depicted decrease in percent cell migration with increasing doses of aspirin (0, 0.5, 2.5 and 5 mM). Since, recent report indicates that aspirin reaches human plasma level at only 2.5 mM concentration [49]53; we used same concentration for our further experiments. Importantly, this dose was observed to be non-toxic towards normal cell like PBMCs (Fig. 4b), thereby verifying this as the effective non-toxic anti-migratory dose of aspirin. Results of Fig. 4c further showed the time-dependence of the anti-migratory effect of aspirin 2.5 mM concentration. Interestingly, 2.5 mM of aspirin was also found to be non-toxic for upto 24 h (Fig. 4d).
Next, to explore whether this aspirin-induced anti-migratory effect is mediated by Slug/E-cadherin axis, we performed RT-PCR and western blotting for E-cadherin and Slug with or without 2.5 mM dose of aspirin (Fig. 4e). Interestingly, while expressions of both E-cadherin mRNA (Fig. 4e, left panel) and protein (Fig. 4e, right panel) were induced upon aspirin treatment, those of Slug were decreased in aspirin-treated sets (Fig. 4e). In addition, expressions of other EMT marker proteins, vimentin, twist, MMP-2 and MMP-9, were down-regulated by aspirin (Fig. 4f). These results together indicated that the non-toxic anti-migratory dose of aspirin induced epithelial markers and consequently repressed mesenchymal markers to restrain migration of A549 cells.

Aspirin ensures Slug down regulation by inhibiting p65NFκB - nuclear translocation

NFκB plays a central and evolutionarily conserved role in coordinating the expression of various soluble pro-inflammatory mediators and leukocyte adhesion molecules. Several reports suggest that aspirin impedes cancer initiation and progression by inhibiting activation of NFκB pathway [50]54. Results of Fig. 5a demonstrated reduction in phosphorylation of IκBα upon aspirin treatment, total p65NFκB expression remaining same. This indulged us to further investigate whether aspirin constrains nuclear translocation of p65NFκB or not. Next in Fig. 5b we observed reduced nuclear expression of p65NFκB with increase in its cytosolic expression in A549 cells upon aspirin treatment (Fig. 5b). These results together highlight that aspirin treatment impedes activation and therefore nuclear translocation of p65NFκB in A549 cells.
Concurrently, ChIP analysis further depicted reduced binding of p65NFκB on SLUG promoter in aspirin-treated A549 cells as compared to the untreated ones (Fig. 5c). These results in correlation with our previous data suggest that aspirin retracts p65 NFκB-induced Slug transcription thereby inhibiting NSCLC cells migration.
In summary, Aspirin works to ensure Slug down-regulation by restraining NFκB nuclear translocation, a pre-requisite for SLUG promoter activation, in oncogenic K-ras expressing NSCLCs.

Discussion

The disappearance of epithelial phenotype and acquisition of mesenchymal phenotype constitute the basic molecular and morphological manifestations of EMT. This process increases cell mobility and constitutes a critical step in cell migration, which is associated with various biological processes, including cancer invasion and metastasis. Thus, the maintenance of epithelial phenotype and suppression of EMT have been increasingly recognized to be important for preventing cancer progression. During the execution of the EMT program many genes involved in cell adhesion, migration and invasion are transcriptionally altered, E-cadherin being one of the most important [51]55. Since E-cadherin functions as a key gatekeeper of the epithelial state, the partial loss of E-cadherin has been associated with carcinoma progression and poor prognosis in various human and mouse tumors [52]56. Evaluation of the molecular mechanisms involved in regulation of E-cadherin expression, therefore, might be a critical step in controlling EMT. Our present study has been mainly focused on the regulation of EMT by altering E-cadherin expression by the NSAID aspirin in oncogenic Ras-expressing NSCLC cells. Aspirin enhanced E-cadherin expression, which was conjointly associated with a loss in the migratory potential of these cells, via down-regulation of E-cadherin repressor Slug by inhibition of p65NFκB activation and its translocation to nucleus for SLUG promoter binding.
Our effort to explore the effects of oncogenic K-ras in aggravation of migration of NSCLC cells revealed that oncogenic K-ras-bearing NSCLCs induce migration via Slug/E-cadherin axis. In line with these findings there are reports describing that expression of oncogenic K-ras induces EMT and confers a metastatic phenotype on carcinomas by repressing the E-cadherin gene at the transcriptional level [53]57. Consistently, Shin et al. has demonstrated the implication of Ras-ERK signaling in Ras-induced transformation of epithelial cells into mesenchymal cells [54]58. Our results also showed that Ras/Raf downstream effector molecule Elk-1 plays a crucial role in NSCLC cells migration. In depth analysis denoted that Elk-1 gets activated by Ras/Raf/ERK pathway and forms a complex with p300 to acetylate SLUG promoter, thereby accelerating transcriptional activation of Slug. Supporting our observation, report of Li et al. evidenced that Elk-1 forms pre-assembled Elk-1-p300 complex which become active following phosphorylation of Elk-1 to ultimately lead to target gene transcription [55]59. That Elk-1 can interact with p300 both in vitro and in vivo through the C-terminus of Elk-1 and the N-terminus of p300 has already been documented [55]60. Such changes in interaction render a strong histone acetyltransferase activity in the Elk-1-associated complex that could play a critical role in chromatin remodelling and gene activation [55]61.
In previous studies, it has been revealed that in oncogenic K-ras-induced lung cancer mouse model, genetic alteration of p65 subunit of NFκB reduces tumorigenesis (19)62 thereby substantiating the contribution of p65NFκB in activated Ras-induced tumor formation. Indeed, genetic alteration of p65 leads to the tumor regression in K-ras-driven mouse tumor models [19]63. In contrast, activity of transcriptional active domain, i.e., p65NFκB, was found to be increased strikingly in Ras/Raf-transformed cells [20]64. However, such mutual interaction between the two oncogenic pathways in promoting cancer cell migration is yet to be revealed. Given that oncogenic K-ras mutations co-exist with p65NFκB over expression in A549 cells [38]65, we postulated that K-ras/NFκB axis might be an important target to curb migration in these NSCLC cells. Our findings that p65NFκB plays a pivotal role as a transcription factor to up-regulate Slug transcription for migration of oncogenic K-ras-expressing A549 cells indicated the possibility of EMT being regulated by the conjoint effort of both K-ras and p65NFκB pathways in these cells. While K-ras pathway brings about the acetylation of the SLUG promoter, commencement of Slug transcription occurs only through the binding of the transcription factor p65NFκB. Reports are there in support of Slug activation by NFκB to confer resistance to TNF-α-induced apoptosis in A549 cells [56]66. Further support comes from the role played by IKKα, inhibitor of NFκB that controls canonical TGFβ–SMAD signaling to regulate genes expressing Snail and Slug during EMT in pancreatic cancer cell line [57]67. Several other findings together with these suggest Slug as a molecular platform or a target for treatment of a range of metastatic cancers associated with mutational Ras.
The present study further signifies the effect of FDA-approved non-steroidal anti-inflammatory drug aspirin on highly invasive and migratory NSCLC cell line A549. Aspirin, i.e., acetyl salicylic acid, is known for decades to inhibit transcription of several genes including adhesion molecules and nitric oxides, which are known to regulate inflammatory pathways [58]68. One of such well studied targets of aspirin is p65NFκB [50]69, activation of which is associated with tumor progression and metastasis of several human tumor types [59]70. Yet, the effect of aspirin on the activation of p65NFκB differs according to cell type. Present study discusses the anti-migratory effect of this anti-inflammatory drug on lung epithelial cell A549. We observed that aspirin inhibits A549 cell migration by suppressing p65NFκB activation and translocation to the nucleus for binding to SLUG promoter, thereby resulting in the transcriptional down-regulation of Slug in these NSCLC cells. Our observation that aspirin restrains constitutively active NFκB in lung cancer cells concurs with recent studies demonstrating that aspirin can also inhibit inducible p65NFκB in cervical cancer and hepatoma cells [60]71.
Collectively, this study provides a complex molecular framework involving p65NFκB during MEK/ERK-mediated EMT. In that molecular network, p-Elk-1-p300 complex induces histone acetylation and unwinding of SLUG promoter to make access for NFκB on the same. Binding of p65NFκB on SLUG promoter, in turn, ensures Slug transcriptional up- regulation and subsequent Slug-dependent E-cadherin repression. In contrast, aspirin impedes nuclear translocation of p65NFκB thereby repressing Slug and consequently restoring E-cadherin levels. Therefore, by modulating the pro-migratory molecular architecture, aspirin nullifies the effect of oncogenic Ras-induced migration of NSCLCs. Altogether this study highlights the complexity of gene-regulation and demonstrates how aspirin abrogates effectors of EMT such as K-ras, which, via epigenetic alterations through a well-known MEK/ERK pathway, adds to p65NFκB functions to cause tumor metastasis (Fig. 6). Such activities of aspirin strongly support its candidature as a potential anti-migratory agent, suggesting the possibility of development of a treatment regimen in future for highly metastatic non-small cell lung carcinoma.

Conclusion

This preclinical study suggests aspirin as a potent anti-migratory agent to improve the therapeutic index of highly metastatic NSCLCs in which EMT, a pre-requisite for cancer cell migration, being programmed by the conjoint effort of both K-ras and NFκB pathways. Aspirin inhibited EMT and delayed migration of oncogenic K-ras-expressing NSCLC cells through inhibition of p65NFκB nuclear translocation that resulted in down-regulation of Slug, a transcriptional repressor of E-cadherin. Knowledge gathered from this study may open a new avenue in future for developing more effective treatment strategy for controlling highly invasive NSCLCs with oncogenic K-ras.

Methods

Cell culture and treatments

The non small cell lung cancer cell line A549 (K-ras v-12 mutated) H1299 and NCI-H522 were obtained from National Centre for Cell Science, Pune, India. The cells were routinely maintained in complete Dulbecco’s modified Eagle’s medium at 37 °C in a humidified incubator containing 5 % CO2 [61]72. Cells were allowed to reach confluency before use. Viable cell numbers were determined by Trypan blue exclusion test. Since this study involved only human cell lines and no human or animal participants or tissues, ethical clearance was not required.

Treatment of cells

Exponentially growing human non-small cell lung carcinoma cell line-A549 were seeded at a density of 2.5x106 cells/100 mm culture dishes (Becton Dickinson, Franklin Lakes, NJ) 24 h before aspirin treatment. Cells were treated with different concentrations of aspirin (Acetyl Salicylic Acid from MP Biomedicals) for different time points to select the optimum dose and time required to reduce cancer cell migration. 1 M stock solution of aspirin was prepared in DMSO and stored at −20 °C. Now, to reach final concentrations of 0.5, 2.5 or 5 mM of aspirin, 0.5 μL, 2.5 μL or 5 μL of stock solution was added, respectively, in 1 ml cell culture media. An equivalent amount of carrier (DMSO) was added to untreated cells as control to ensure that the observed effect was related to aspirin and not due to the solvent.

Wound healing assay

Cell migration was determined by means of bidirectional wound healing assay as described [62]73. Briefly, cells were grown to confluency in 12 well plates after which a sterile blade was used to scratch the monolayer of cells to form a bidirectional wound. Migration was quantitated by a semi-automated, computer-assisted procedure by a person blinded with respect to the experimental treatment. The data from triplicate wells were calculated as the mean ± S.E.M., the migration rate of control cells was taken as 100 % and healing rate of other plates were compared with control cells.

Immunofluorescence

For immunofluorescence, cells were grown on sterile glass coverslips at 37 °C for 24 h. Cells after treatment were washed briefly with PBS and fixed with 4 % formaldehyde for 20 min at 37 °C. Thereafter, cells were blocked for 2 h in a blocking buffer (10 % BSA in PBS) and then additionally incubated for another hour in PBS with 1.5 % BSA containing anti- E-cadherin antibody (Santa Cruz, CA, USA). After washing in PBS, cells were incubated with PE conjugated secondary antibody in PBS with 1.5 % BSA for 45 min at 37 °C in the dark. DAPI was used for nuclear staining. Coverslips were washed with PBS and mounted on microscopy glass slides with 90 % glycerol in PBS. Images were acquired using a confocal microscope (Carl Zeiss, Jena, Germany) [63]74.

Immunoblotting and co-immunoprecipitation

To obtain whole cell lysates, cells were homogenized in lysis buffer (20 mM Hepes, pH 7.5, 10 mM KCl, 1.5 mM MgCl2, 1 mM Na-EDTA, 1 mM Na-EGTA and 1 mM DTT) supplemented with protease and phosphatase inhibitor cocktails [64, 65]75,76. For direct western blot analysis, a total of 50 μg of protein was resolved using SDS-PAGE and transferred to nitrocellulose membrane and probed with specific antibodies, for example, anti-NFκB/-IκB/-slug/-E-cadherin/-MEK/-ERK/-Elk-1/-p-Elk-1/-p53(DO-1)/-p53(FL-393) antibodies (Santa Cruz, CA, USA), thereafter the immunoblots were visualized by chemiluminescence (GE Biosciences, NJ, USA). To study the interaction between Elk1 and p300, p300 immunocomplex from whole cell lysate was purified using p300 antibody and protein A-Sepharose beads (Invitrogen, MD). The immunopurified protein was immunoblotted with Elk-1 antibody. The protein of interest was visualized by chemiluminescence. Equal protein loading was confirmed with anti-α-actin and histone H1 antibodies (Santa Cruz, CA, USA) [66]77.

RT–PCR assay

Two microgram of the total RNA, extracted from cells with TRIzol Q16 reagent (Invitrogen, Carlsbad) was reverse transcribed and then subjected to PCR with enzymes and reagents of the RTplusPCR system (Eppendorf, Hamburg, Germany) using GeneAmpPCR 2720 (Applied Biosystems, CA, USA). The cDNAs were amplified with primers specific for E-cadherin (5′-GTCATCCAACGGGAATGCA-3′/5′-TGATCGGTTACCGTGATCAAAA-3′), Slug (5′-CTCACCTCGGGAGCATACAG-3′/5′-GACTTACACGCCCCAAGGATG-3′), GAPDH (internal control): (5′-CAGAACATCATCCTGCCTCT-3′/5′-GCTTGACAAAGTG GTCGTTGAG-3′) [67, 68]78,79.

Plasmids, siRNA and transfections

The expression constructs p53-cDNA, p53-R175H cDNA (kind gift from Moshe Oren, Weizmann Institute of Science), N17-NRas, IκB-SR and control pcDNA3.0 vectors (2 μg/million cells) were introduced into exponentially growing cells using lipofectamine-2000 (Invitrogen, Carlsbad) according to the protocol provided by the manufacturer. Stably expressing clones were isolated by limiting dilution and selection with G418 sulfate (1 mg/ml; Cellgro) and G418 resistant cells were cloned and screened by immunoflourescence or western blotting with specific antibodies. For endogenous silencing of specific genes, cells were transfected with 300 pmol of E-cadherin-/Slug-/MEK-/ERK-/control-siRNA using lipofectamine-2000 separately for 12 h. The mRNA and protein levels were determined by RT-PCR and western blotting, respectively [69]80.

Chromatin immunoprecipitation (ChIP)

ChIP assays were performed using a ChIP assay kit (Millipore, Darmstadt, Germany) according to the manufacturer’s instructions. PCR assay for identification of p-Elk-1 and NFκB binding regions on SLUG promoter was performed using the 12 different primer sets.
For promoter1:
1)
5′GACCCATACAACCCTTTTTCC3′/5′GGAACCACCGGACATTCTCT3′;
 
2)
5′GTGAGAGAATGTCCGGTGGT3′/5′CTCTAAAGGCAGGCTGATCG3′;
 
3)
5′TTCCAGTTCTTCCGATCAGC3′/5′GCCGCGTGCAAATTAAGTA3′;
 
4)
5′CTAACACGGTGACATGAGTAC3′/5′GACGCTCTCCTGGGACTCTG3′;
 
5)
5′CTCCAGGCCAGAGTCCCAG3′/5′GTTTGCCTTGCACAAAGACC3′.
 
For promoter 2:
1)
5′CGCTTCCCCCTTCCTTTTTC3′/5′CAGCCTCTGGTGTTAATGAGAGC3′;
 
2)
5′GGCTCTCATTAACACCAGAGG3′/5′CTGGCTTCAAGATGTGTTGCAG3′;
 
3)
5′CTTCCTTCTCCTTGCGAACAC3′/5′CAAGAGAGGTAACATCGCTCGG3′;
 
4)
5′CCCTCCTAGCTTCCAGAGAG3′/5′TCTGGTTCAAAATGGGCTG3′;
 
5)
5′CCTCTCCACGGAAATCTCAA3′/5′GCAAGAAAGATCCAAGCACAGC3′;
 
6)
5′CTGAACCTCTCAACTGTGATTGG3′/5′CTCTGAAGTCAACCGGCTC3′;
 
7)
5′CAGTTCGTAAAGGAGCCGG3′/5′CACGGCGGTCCTTAAAGCATC3′.
 
Extracted DNA (2 μl) was used for 45 cycles of amplification in 50 μl of reaction mixture under the following conditions: 95 °C for 30s, 56 °C for 30s, and 72 °C for 60 s. The PCR products were analysed by 2 % agarose gel electrophoresis [70]81.

Statistical analysis

Values are shown as standard error of mean, except otherwise indicated. Data were analyzed and, appropriate, significance (p < 0.05) of the differences between mean values was determined by a Student’s t test.

Acknowledgements

Authors like to acknowledge Dr. Arghya Adhikary for helping in cell culture experiments. Thanks are due to U. Ghosh for technical help. This work was supported by research grants from Council of Scientific and Industrial Research (CSIR), University Grants Commission (UGC), Department of Science and Technology (DST) and Department of Biotechnology (DBT), Government of India.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

TD conceptualized the project, designed the experiments, edited the manuscript; PK executed most of the experiments, analyzed related results and wrote the manuscript; AM and SS performed immunoflurescence and ChIP assays, analyzed experiments and interpreted results; SM (Suchismita Mohanty) did western blotting experiments; SM (Shravanti Mukherjee) performed migration assays; MM carried out transfections and DG did RT-PCR experiments. All authors read and approved the final manuscript.
Fußnoten
1
Thiery JP. Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer. 2002;2(6):442–454.
 
2
Lamouille S, Xu J, Derynck R. Molecular mechanisms of epithelial–mesenchymal transition. Nat Rev Mol Cell Biol. 2014;15(3):178–196.
 
3
Singhai R, Patil VW, Jaiswal SR, Patil SD, Tayade MB, Patil AV. E-Cadherin as a diagnostic biomarker in breast cancer. N Am J Med Sci. 2011;3(5):227–233.
 
4
Mareel M, Leroy A. Clinical, cellular and molecular aspects of cancer invasion. Physiol Rev. 2003;83(2):337–376.
 
5
Bremnes RM, Veve R, Gabrielson E, Hirsch FR, Baron A, Bemis L, et al. High-throughput microarray analysis used to evaluate biology and prognostic significance of the E-cadherin pathway in small cell lung cancer. J Clin Oncol. 2002;20(10):2417–2428.
 
6
Frixen UH, Behrens J, Sachs M, Eberle G, Voss B, Warda A, et al. E-cadherin-mediated cell-cell adhesion prevents invasiveness of human carcinoma cells. J Cell Biol. 1991;113(1):173–185.
 
7
Hajra KM, Chen DY, Fearon ER. The SLUG zinc-finger protein represses E-cadherin in breast cancer. Cancer Res. 2002;62(6):1613–1618.
 
8
Hajra KM, Chen DY, Fearon ER. The SLUG zinc-finger protein represses E-cadherin in breast cancer. Cancer Res. 2002;62(6):1613–1618.
 
9
Hajra KM, Chen DY, Fearon ER. The SLUG zinc-finger protein represses E-cadherin in breast cancer. Cancer Res. 2002;62(6):1613–1618.
 
10
Nieto MA. The snail superfamily of zinc-finger transcription factors. Nat Rev Mol Cell Biol. 2002;3(3):155–166.
 
11
Bolós V, Peinado H, Pérez-Moreno MA, Fraga MF, Esteller M, Cano A. The transcription factor Slug represses E-cadherin expression and induces epithelial to mesenchymal transitions: a comparison with Snail and E47 repressors. J Cell Sci. 2003;116(Pt 3):499–511.
 
12
Hajra KM, Chen DY, Fearon ER. The SLUG zinc-finger protein represses E-cadherin in breast cancer. Cancer Res. 2002;62(6):1613–1618.
 
13
Han CB, Li F, Ma JT, Zou HW. Concordant KRAS mutations in primary and metastatic colorectal cancer tissue specimens: a meta-analysis and systematic review. Cancer Invest. 2012;30(10):741–747.
 
14
Watanabe T, Kobunai T, Yamamoto Y, Matsuda K, Ishihara S, Nozawa K, et al. Heterogeneity of KRAS status may explain the subset of discordant KRAS status between primary and metastatic colorectal cancer. Dis Colon Rectum. 2011;54(9):1170–1178.
 
15
Wang XQ, Li H, Van Putten V, Winn RA, Heasley LE, Nemenoff RA. Oncogenic K-Ras Regulates Proliferation and Cell Junctions in Lung Epithelial Cells through Induction of Cyclooxygenase-2 and Activation of Metalloproteinase-9. Mol Biol Cell. 2009;20(3):791–800.
 
16
Peinado H, Olmeda D, Cano A. Snail, Zeb and bHLH factors in tumour progression: an alliance against the epithelial phenotype? Nat Rev Cancer. 2007;7(6):415–428.
 
17
Dohadwala M, Yang SC, Luo J, Sharma S, Batra RK, Huang M, et al. Cyclooxygenase-2–Dependent Regulation of E-Cadherin: Prostaglandin E2 Induces Transcriptional Repressors ZEB1and Snail in Non–Small Cell Lung Cancer. Cancer Res. 2006;66(10):5338–5345.
 
18
Rebollo A, A CM. Ras Proteins: Recent Advances and New Functions. Blood. 1999;94(9):2971–2980.
 
19
Hanson JL, AnestV, Madrid JR, Baldwin AS. Oncoprotein Suppression of Tumor Necrosis Factor-induced NFκB Activation Is Independent of Raf-controlled Pathways. J Biol Chem. 2003;278(37):34910–34917.
 
20
Liss AS, Bose HR. Characterization of ATF2 in Rel/NFκBoncogenesis reveals its role in the regulation of Ras signaling. Small GTPases. 2011;2(2):89–94.
 
21
Finco TS, Westwick JK, Norris JL, Beg AA, Der CJ, Baldwin AS, Jr. Oncogenic Ha-Ras-induced Signaling Activates NF-kB Transcriptional Activity, Which Is Required for Cellular Transformation. J Biol Chem. 1997;272(39):24113–24116.
 
22
Bassères DS, Ebbs A, E Levantini, AS Baldwin. Requirement of the NF-κB Subunit p65/RelA for K-Ras–Induced Lung Tumorigenesis. Cancer Res. 2010; 70(9):3537–3546.
 
23
Arsura M, Mercurio F, Oliver AL, Thorgeirsson SS, Sonenshein GE. Role of the IκB Kinase Complex in Oncogenic Ras- and Raf-Mediated Transformation of Rat Liver Epithelial Cells. Mol Cell Biol. 2000;20(15):5381–5391.
 
24
Liu Y, Mayo MW, Nagji AS, Smith PW, Ramsey CS, Li D, et al. Phosphorylation of RelA/p65 promotes DNMT-1 recruitment to chromatin and represses transcription of the tumor metastasis suppressor gene BRMS1. Oncogene. 2012;31(9):1143–1154.
 
25
Hoesel B, Schmid JA. The complexity of NF-κB signaling in inflammation and cancer. Mol Cancer. 2013;12:86.
 
26
Xiao J, Duan X, Yin Q, Miao Z, Yu H, Chen C, et al. The inhibition of metastasis and growth of breast cancer by blocking the NFκB signaling pathway using bioreducible PEI-based/p65 shRNA complex nanoparticles. Biomaterials. 2013;34(21):5381–5390.
 
27
Huber MA, Azoitei N, Baumann B, Grünert S, Sommer A, Pehamberger H, et al. NF-κB is essential for epithelialmesenchymal transition and metastasis in a model of breast cancer progression. J Clin Invest. 2004;114(4):569–581.
 
28
Fraser DM, Sullivan FM, Thompson AM, McCowan C. Aspirin use and survival after the diagnosis of breast cancer: a population-based cohort study. Br J Cancer. 2014;111(3):623–627.
 
29
Holick CN, Michaud DS, Leitzmann MF, Willett WC, Giovannucci E. Aspirin use and lung cancer in men. Br J Cancer. 2003;89(9):1705–1708.
 
30
Dyke ALV, Cote ML, Prysak G, Claeys GB, Wenzlaff AS, Schwartz AG. Regular Adult Aspirin Use Decreases the Risk of Non-Small Cell Lung Cancer among Women. Cancer Epidemiol Biomarkers Prev. 2008;17(1):148–157.
 
31
Moysich KB, Menezes RJ, Ronsani A, Swede H, Reid ME, Cummings KM, et al. Regular aspirin use and lung cancer risk. BMC Cancer. 2002;2:31.
 
32
Wang HL, Lopategui J, Amin MB, Patterson SD. KRAS Mutation Testing in Human Cancers: The Pathologist’s Role in the Era of Personalized Medicine. Adv Anat Pathol. 2010;17(1):23–32.
 
33
Wang Y, Ngo VN, Marani M, Yang Y, Wright G, Staudt LM, et al. Critical role for transcriptional repressor Snail2 in transformation by oncogenic RAS in colorectal carcinoma cells. Oncogene. 2010;29(33):4658–4670.
 
34
Cho Y, Gorina S, Jeffrey PD, Pavletich NP. Crystal structure of a p53 tumor suppressor-DNA complex: understanding tumorigenic mutations. Science. 1994;265:346–355.
 
35
Adhikary A, Chakraborty S, Mazumdar M, Ghosh S, Mukherjee S, Manna A, et al. Inhibition of Epithelial to Mesenchymal Transition by E-cadherin Up-regulation via Repression of Slug Transcription and Inhibition of E-cadherin Degradation Dual Roleof Scaffold/Matrix Attachment Region-Binding Protein 1 (SMAR1) in Breast Cancer Cells. J Biol Chem. 2014;289(37):25431–25444.
 
36
Bolós V, Peinado H, Pérez-Moreno MA, Fraga MF, Esteller M, Cano A. The transcription factor Slug represses E-cadherin expression and induces epithelial to mesenchymal transitions: a comparison with Snail and E47 repressors. J Cell Sci. 2003;116:499-511.
 
37
Roberts PJ, Der CJ. Targeting the Raf-MEK-ERK mitogen-activated protein kinase cascade for the treatment of cancer. Oncogene. 2007;26(22):3291–3310.
 
38
Aplin AE, Stewart SA, Assoian RK, Juliano RL. Integrin-Mediated Adhesion Regulates ERK Nuclear Translocation and Phosphorylation of Elk-1. J Cell Biol. 2001;153(2):273–281.
 
39
Shin SY, Kim CG, Lim Y, Lee YH. The Ets Family Transcription Factor Elk-1 Regulates Induction of the Cell cycle Regulatory Gene p21Waf1/Cip1 and the Bax Gene in Sodium Arsenite-Exposed Human Keratinocyte HaCaT cells. J Biol Chem. 2011;286(30):26860–26872.
 
40
Yang SH, Yates PR, Whitmarsh AJ, Davis RJ, Sharrocks AD. The Elk-1 Ets-domain transcription factor contains a mitogen-activated protein kinase targeting motif. Mol Cell Biol. 1998;18(2):710–720.
 
41
Chang F, Steelman LS, Lee JT, Shelton JG, Navolanic PM, Blalock WL, et al. Signal transduction mediated by the Ras/Raf/MEK/ERK pathway from cytokine receptors to transcription factors: potential targeting for therapeutic intervention. Leukemia. 2003;17(7):1263–1293.
 
42
Mohanty S, Saha S, Hossain DMS, Adhikary A, Mukherjee S, Manna A, et al. ROS-PIASγccross talk channelizes ATM signaling from resistance to apoptosis during chemosensitization of resistant tumors. Cell Death Dis. 2014;5:e1021. doi:10.​1038/​cddis.​2013.​534.
 
43
Jo H, Zhang R, Zhang H, McKinsey TA, Shao J, Beauchamp RD, et al. NF-kB is required for H-ras oncogene induced abnormal cell proliferation and tumorigenesis. Oncogene. 2000;19(7):841–849.
 
44
Wu DW, Lee MC, Hsu NY, Wu TC, Wu JY, Wanget YC, et al. FHIT loss confers cisplatin resistance in lung cancer via the AKT/NF-κB/Slug-mediated PUMA reduction. Oncogene. 2015;34(19):2505-15.
 
45
Kopp E, Ghosh S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 1994;265(5174):956–959.
 
46
Yamamoto Y, Gaynor RB. Therapeutic potential of inhibition of the NF-κB pathway in the treatment of inflammation and cancer. J Clin Invest. 2001;107(2):135–142.
 
47
Thun MJ, Jacobs EJ, Patrono C. The role of aspirin in cancer prevention. Nat Rev Clin Oncol. 2012;9(5):259–267.
 
48
Norrish AE, Jackson RT, McRae CU. Non-steroidal anti-inflammatory drugs and prostate cancer progression. Int J Cancer. 1998;77(4):511–515.
 
49
Gilmore TD, Herscovitch M. Inhibitors of NFκB signaling: 785 and counting. Oncogene. 2006;25(51):6887–6899.
 
50
Rothwell PM, Wilson M, Price JF, Belch JF, Meade TW, MehtaZ. Effect of daily aspirin on risk of cancer metastasis: a study of incident cancers during randomised controlled trials. Lancet. 2012;379(9826):1591–1601.
 
51
Algra AM, Rothwell PM. Effects of regular aspirin on long-term cancer incidence and metastasis: a systematic comparison of evidence from observational studies versus randomised trials. Lancet Oncol. 2012;13(5):518–527.
 
52
Wynne S, Djakiew D. NSAID Inhibition of Prostate Cancer Cell Migration Is Mediated by Nag-1 Induction via the p38 MAPK-p75(NTR) Pathway. Mol Cancer Res. 2010;8(12):1656–1664.
 
53
Schrör, K. Clinical Applications of Aspirin, In: Acetylsalicylic Acid, Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, Germany. 2008.
 
54
Brady RR, Loveridge CJ, Dunlop MG, Stark LA. c-Src dependency of NSAID-induced effects on NF-kB-mediated apoptosis in colorectal cancer cells. Carcinogenesis. 2011;32(7):1069–1077.
 
55
Kalluri R, Weinberg RA. The basics of epithelial-mesenchymal transition. J Clin Invest. 2009;119(6):1420–1428.
 
56
Tsai JH, Yang J. Epithelial–mesenchymal plasticity in carcinoma metastasis. Genes Dev. 2013;27(20):2192–2206.
 
57
Lemieux E, Cagnol S, Beaudry K, Carrier J, Rivard N.. Oncogenic KRAS signalling promotes the Wnt/β-catenin pathway through LRP6 in colorectal cancer. Oncogene. 2015;34(38):4914-27.
 
58
Shin S, Blenis J. ERK2/Fra1/ZEB pathway induces epithelial-tomesenchymal transition. Cell Cycle. 2010;9(13):2483–2484.
 
59
Li QJ, Yang SH, Maeda Y, Sladek FM, Sharrocks AD, Martins-Green M. MAP kinase phosphorylation-dependent activation of Elk–1 leads to activation of the co-activator p300. EMBO J. 2003;22(2):281–291.
 
60
Li QJ, Yang SH, Maeda Y, Sladek FM, Sharrocks AD, Martins-Green M. MAP kinase phosphorylation-dependent activation of Elk-1 leads to activation of the co-activator p300. EMBO J. 2003;22(2):281–291.
 
61
Li QJ, Yang SH, Maeda Y, Sladek FM, Sharrocks AD, Martins-Green M. MAP kinase phosphorylation-dependent activation of Elk-1 leads to activation of the co-activator p300. EMBO J. 2003;22(2):281–291.
 
62
Bassères DS, Ebbs A, E Levantini, AS Baldwin. Requirement of the NF-κB Subunit p65/RelA for K-Ras–Induced Lung Tumorigenesis. Cancer Res. 2010; 70(9):3537–3546. doi: 10.​1158/​0008–5472.​CAN-09–4290.
 
63
Bassères DS, Ebbs A, E Levantini, AS Baldwin. Requirement of the NF-κB Subunit p65/RelA for K-Ras–Induced Lung Tumorigenesis. Cancer Res. 2010; 70(9):3537–3546. doi: 10.​1158/​0008–5472.​CAN-09–4290.
 
64
Arsura M, Mercurio F, Oliver AL, Thorgeirsson SS, Sonenshein GE. Role of the IκB Kinase Complex in Oncogenic Ras- and Raf-Mediated Transformation of Rat Liver Epithelial Cells. Mol Cell Biol. 2000;20(15):5381–5391.
 
65
Mohanty S, Saha S, Hossain DMS, Adhikary A, Mukherjee S, Manna A, et al. ROS-PIASγccross talk channelizes ATM signaling from resistance to apoptosis during chemosensitization of resistant tumors. Cell Death Dis. 2014;5:e1021. doi:10.​1038/​cddis.​2013.​534.
 
66
Wang Y, Yue B, Yu X, Wang Z, Wang M. SLUG is activated by nuclear factor kappa B and confers human alveolar epithelial A549 cells resistance to tumor necrosis factor-alpha induced apoptosis. World J Surg Oncol. 2013 Jan 22;11:12. doi: 10.​1186/​1477–7819–11-12.
 
67
Brandl M, Seidler B, Haller F, Adamski J, Schmid RM, Saur D, et al. IKKαcontrols canonical TGFβ–SMAD signaling to regulate genes expressing SNAIL and SLUG during EMT in Panc1 cells. J Cell Sci. 2010;123(Pt 24):4231–4239.
 
68
Yotsui T, Yasuda O, Kawamoto H, Higuchi M, Chihara Y, Umemoto E, et al. Aspirin prevents adhesion of T lymphoblasts to vascular smooth muscle cells. FEBS Lett. 2007;581(3):427–432.
 
69
Brady RR, Loveridge CJ, Dunlop MG, Stark LA. c-Src dependency of NSAID-induced effects on NF-kB-mediated apoptosis in colorectal cancer cells. Carcinogenesis. 2011;32(7):1069–1077.
 
70
Helbig G, Christopherson KW2nd, Bhat-Nakshatri P, Kumar S, Kishimoto H, Miller KD, et al. NFkB Promotes Breast Cancer Cell Migration and Metastasis by Inducing the Expression of the Chemokine Receptor CXCR4. J Biol Chem. 2003;278(24):21631–21638.
 
71
Sobolewski C, Cerella C, Dicato M, Ghibelli L, Diederich M. The Role of Cyclooxygenase-2 in Cell Proliferation and Cell Death in Human Malignancies. Int J Cell Biol. 2010;2010:215158.
 
72
Chakraborty S, Mazumdar M, Mukherjee S, Bhattacharjee P, Adhikary A, Manna A, et al. Restoration of p53/miR-34a regulatory axis decreases survival advantage and ensures Bax-dependent apoptosis of non-small cell lung carcinoma cells. FEBS Lett. 2014;588(4):549–559.
 
73
Adhikary A, Chakraborty S, Mazumdar M, Ghosh S, Mukherjee S, Manna A, et al. Inhibition of Epithelial to Mesenchymal Transition by E-cadherin Up-regulation via Repression of Slug Transcription and Inhibition of E-cadherin Degradation Dual Role of Scaffold/Matrix Attachment Region-Binding Protein1 (SMAR1) in Breast Cancer Cells. J Biol Chem. 2014;289(37):25431–25444.
 
74
Saha B, Adhikary A, Ray P, Saha S, Chakraborty S, Mohanty S, et al. Restoration of tumor suppressor p53 by differentially regulating pro- and anti-p53 networks in HPV-18-infected cervical cancer cells. Oncogene. 2012;31(2):173–186.
 
75
Mukherjee S, Mazumdar M, Chakraborty S, Manna A, Saha S, Khan P, et al. Curcumin inhibits breast cancer stem cell migration by amplifying the E-cadherin/β-catenin negative feedback loop. Stem Cell Res Ther. 2014;5(5):116.
 
76
Lahiry L, Saha B, Chakraborty J, Adhikary A, Mohanty S, Hossain DMS, et al. Theaflavins target Fas/caspase-8 and Akt/pBad pathways to induce apoptosis in p53-mutated human breast cancer cells. Carcinogenesis. 2010;31(2):259–268.
 
77
Hossain DMS, Panda AK, Manna A, Mohanty S, Bhattacharjee P, Bhattacharyya S, et al. FoxP3 Acts as a Cotranscription Factor with STAT3 in Tumor-Induced Regulatory T Cells. Immunity. 2013;39(6):1057–1069.
 
78
Mazumdar M, Adhikary A, Chakraborty S, Mukherjee S, Manna A, Saha S, et al. Targeting RET to induce medullary thyroid cancer cell apoptosis: an antagonistic interplay between PI3K/Akt and p38MAPK/caspase-8 pathways. Apoptosis. 2013; 18(5):589–604.
 
79
Saha S, MukherjeeS, MazumdarM, MannaA, KhanP, AdhikaryA, et al. Mithramycin A sensitizes therapy-resistant breast cancer stem cells toward genotoxic drug doxorubicin. Transl Res. 2015;165(5):558–577.
 
80
Chakraborty J, Banerjee S, Ray P, DMS Hossain, S Bhattacharyya, Adhikary A, et al. Gain of Cellular Adaptation Due to Prolonged p53 Impairment Leads to Functional Switchover from p53 to p73 during DNA Damage in Acute Myeloid Leukemia Cells. J Biol Chem. 2010;285(43):33104–33112.
 
81
Chakraborty S, Das K, Saha S, Mazumdar M, Manna A, Chakraborty S, et al. Nuclear Matrix Protein SMAR1 Represses c-Fos-mediated HPV18 E6 Transcription through Alteration of Chromatin Histone Deacetylation. J Biol Chem. 2014;289(42):29074–29085.
 
Literatur
1.
Zurück zum Zitat Thiery JP. Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer. 2002;2(6):442–54.CrossRefPubMed Thiery JP. Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer. 2002;2(6):442–54.CrossRefPubMed
3.
Zurück zum Zitat Singhai R, Patil VW, Jaiswal SR, Patil SD, Tayade MB, Patil AV. E-Cadherin as a diagnostic biomarker in breast cancer. N Am J Med Sci. 2011;3(5):227–33.CrossRefPubMedPubMedCentral Singhai R, Patil VW, Jaiswal SR, Patil SD, Tayade MB, Patil AV. E-Cadherin as a diagnostic biomarker in breast cancer. N Am J Med Sci. 2011;3(5):227–33.CrossRefPubMedPubMedCentral
4.
Zurück zum Zitat Mareel M, Leroy A. Clinical, cellular and molecular aspects of cancer invasion. Physiol Rev. 2003;83(2):337–76.CrossRefPubMed Mareel M, Leroy A. Clinical, cellular and molecular aspects of cancer invasion. Physiol Rev. 2003;83(2):337–76.CrossRefPubMed
5.
Zurück zum Zitat Bremnes RM, Veve R, Gabrielson E, Hirsch FR, Baron A, Bemis L, et al. High-throughput microarray analysis used to evaluate biology and prognostic significance of the E-cadherin pathway in small cell lung cancer. J Clin Oncol. 2002;20(10):2417–28.CrossRefPubMed Bremnes RM, Veve R, Gabrielson E, Hirsch FR, Baron A, Bemis L, et al. High-throughput microarray analysis used to evaluate biology and prognostic significance of the E-cadherin pathway in small cell lung cancer. J Clin Oncol. 2002;20(10):2417–28.CrossRefPubMed
6.
Zurück zum Zitat Frixen UH, Behrens J, Sachs M, Eberle G, Voss B, Warda A, et al. E-cadherin-mediated cell-cell adhesion prevents invasiveness of human carcinoma cells. J Cell Biol. 1991;113(1):173–85.CrossRefPubMed Frixen UH, Behrens J, Sachs M, Eberle G, Voss B, Warda A, et al. E-cadherin-mediated cell-cell adhesion prevents invasiveness of human carcinoma cells. J Cell Biol. 1991;113(1):173–85.CrossRefPubMed
7.
Zurück zum Zitat Hajra KM, Chen DY, Fearon ER. The SLUG zinc-finger protein represses E-cadherin in breast cancer. Cancer Res. 2002;62(6):1613–8.PubMed Hajra KM, Chen DY, Fearon ER. The SLUG zinc-finger protein represses E-cadherin in breast cancer. Cancer Res. 2002;62(6):1613–8.PubMed
8.
Zurück zum Zitat Nieto MA. The snail superfamily of zinc-finger transcription factors. Nat Rev Mol Cell Biol. 2002;3(3):155–66.CrossRefPubMed Nieto MA. The snail superfamily of zinc-finger transcription factors. Nat Rev Mol Cell Biol. 2002;3(3):155–66.CrossRefPubMed
9.
Zurück zum Zitat Bolós V, Peinado H, Pérez-Moreno MA, Fraga MF, Esteller M, Cano A. The transcription factor Slug represses E-cadherin expression and induces epithelial to mesenchymal transitions: a comparison with Snail and E47 repressors. J Cell Sci. 2003;116(Pt 3):499–511.CrossRefPubMed Bolós V, Peinado H, Pérez-Moreno MA, Fraga MF, Esteller M, Cano A. The transcription factor Slug represses E-cadherin expression and induces epithelial to mesenchymal transitions: a comparison with Snail and E47 repressors. J Cell Sci. 2003;116(Pt 3):499–511.CrossRefPubMed
10.
Zurück zum Zitat Han CB, Li F, Ma JT, Zou HW. Concordant KRAS mutations in primary and metastatic colorectal cancer tissue specimens: a meta-analysis and systematic review. Cancer Invest. 2012;30(10):741–7.CrossRefPubMed Han CB, Li F, Ma JT, Zou HW. Concordant KRAS mutations in primary and metastatic colorectal cancer tissue specimens: a meta-analysis and systematic review. Cancer Invest. 2012;30(10):741–7.CrossRefPubMed
11.
Zurück zum Zitat Watanabe T, Kobunai T, Yamamoto Y, Matsuda K, Ishihara S, Nozawa K, et al. Heterogeneity of KRAS status may explain the subset of discordant KRAS status between primary and metastatic colorectal cancer. Dis Colon Rectum. 2011;54(9):1170–8.CrossRefPubMed Watanabe T, Kobunai T, Yamamoto Y, Matsuda K, Ishihara S, Nozawa K, et al. Heterogeneity of KRAS status may explain the subset of discordant KRAS status between primary and metastatic colorectal cancer. Dis Colon Rectum. 2011;54(9):1170–8.CrossRefPubMed
12.
Zurück zum Zitat Wang XQ, Li H, Van Putten V, Winn RA, Heasley LE, Nemenoff RA. Oncogenic K-Ras regulates proliferation and cell junctions in lung epithelial cells through induction of cyclooxygenase-2 and activation of metalloproteinase-9. Mol Biol Cell. 2009;20(3):791–800.CrossRefPubMedPubMedCentral Wang XQ, Li H, Van Putten V, Winn RA, Heasley LE, Nemenoff RA. Oncogenic K-Ras regulates proliferation and cell junctions in lung epithelial cells through induction of cyclooxygenase-2 and activation of metalloproteinase-9. Mol Biol Cell. 2009;20(3):791–800.CrossRefPubMedPubMedCentral
13.
Zurück zum Zitat Peinado H, Olmeda D, Cano A. Snail, Zeb and bHLH factors in tumour progression: an alliance against the epithelial phenotype? Nat Rev Cancer. 2007;7(6):415–28.CrossRefPubMed Peinado H, Olmeda D, Cano A. Snail, Zeb and bHLH factors in tumour progression: an alliance against the epithelial phenotype? Nat Rev Cancer. 2007;7(6):415–28.CrossRefPubMed
14.
Zurück zum Zitat Dohadwala M, Yang SC, Luo J, Sharma S, Batra RK, Huang M, et al. Cyclooxygenase-2–dependent regulation of E-cadherin: prostaglandin E2 induces transcriptional repressors ZEB1and snail in Non–small cell lung cancer. Cancer Res. 2006;66(10):5338–45.CrossRefPubMed Dohadwala M, Yang SC, Luo J, Sharma S, Batra RK, Huang M, et al. Cyclooxygenase-2–dependent regulation of E-cadherin: prostaglandin E2 induces transcriptional repressors ZEB1and snail in Non–small cell lung cancer. Cancer Res. 2006;66(10):5338–45.CrossRefPubMed
15.
Zurück zum Zitat Rebollo AACM, Martínez AC. Ras proteins: recent advances and New functions. Blood. 1999;94(9):2971–80.PubMed Rebollo AACM, Martínez AC. Ras proteins: recent advances and New functions. Blood. 1999;94(9):2971–80.PubMed
16.
Zurück zum Zitat Hanson JL, Anest V, Madrid JR, Baldwin AS. Oncoprotein suppression of tumor necrosis factor-induced NFκB activation is independent of Raf-controlled pathways. J Biol Chem. 2003;278(37):34910–7.CrossRefPubMed Hanson JL, Anest V, Madrid JR, Baldwin AS. Oncoprotein suppression of tumor necrosis factor-induced NFκB activation is independent of Raf-controlled pathways. J Biol Chem. 2003;278(37):34910–7.CrossRefPubMed
17.
Zurück zum Zitat Liss AS, Bose HR. Characterization of ATF2 in Rel/NFκBoncogenesis reveals its role in the regulation of Ras signaling. Small GTPases. 2011;2(2):89–94.CrossRefPubMedPubMedCentral Liss AS, Bose HR. Characterization of ATF2 in Rel/NFκBoncogenesis reveals its role in the regulation of Ras signaling. Small GTPases. 2011;2(2):89–94.CrossRefPubMedPubMedCentral
18.
Zurück zum Zitat Finco TS, Westwick JK, Norris JL, Beg AA, Der CJ, Baldwin Jr AS. Oncogenic Ha-Ras-induced signaling activates NF-kB transcriptional activity, which is required for cellular transformation. J Biol Chem. 1997;272(39):24113–6.CrossRefPubMed Finco TS, Westwick JK, Norris JL, Beg AA, Der CJ, Baldwin Jr AS. Oncogenic Ha-Ras-induced signaling activates NF-kB transcriptional activity, which is required for cellular transformation. J Biol Chem. 1997;272(39):24113–6.CrossRefPubMed
19.
Zurück zum Zitat Bassères DS, Ebbs A, Levantini E, Baldwin AS. Requirement of the NF-κB Subunit p65/RelA for K-Ras–Induced Lung Tumorigenesis. Cancer Res. 2010;70(9):3537–46.CrossRefPubMedPubMedCentral Bassères DS, Ebbs A, Levantini E, Baldwin AS. Requirement of the NF-κB Subunit p65/RelA for K-Ras–Induced Lung Tumorigenesis. Cancer Res. 2010;70(9):3537–46.CrossRefPubMedPubMedCentral
20.
Zurück zum Zitat Arsura M, Mercurio F, Oliver AL, Thorgeirsson SS, Sonenshein GE. Role of the IκB kinase complex in oncogenic Ras- and Raf-mediated transformation of Rat liver epithelial cells. Mol Cell Biol. 2000;20(15):5381–91.CrossRefPubMedPubMedCentral Arsura M, Mercurio F, Oliver AL, Thorgeirsson SS, Sonenshein GE. Role of the IκB kinase complex in oncogenic Ras- and Raf-mediated transformation of Rat liver epithelial cells. Mol Cell Biol. 2000;20(15):5381–91.CrossRefPubMedPubMedCentral
21.
Zurück zum Zitat Liu Y, Mayo MW, Nagji AS, Smith PW, Ramsey CS, Li D, et al. Phosphorylation of RelA/p65 promotes DNMT-1 recruitment to chromatin and represses transcription of the tumor metastasis suppressor gene BRMS1. Oncogene. 2012;31(9):1143–54.CrossRefPubMed Liu Y, Mayo MW, Nagji AS, Smith PW, Ramsey CS, Li D, et al. Phosphorylation of RelA/p65 promotes DNMT-1 recruitment to chromatin and represses transcription of the tumor metastasis suppressor gene BRMS1. Oncogene. 2012;31(9):1143–54.CrossRefPubMed
23.
Zurück zum Zitat Xiao J, Duan X, Yin Q, Miao Z, Yu H, Chen C, et al. The inhibition of metastasis and growth of breast cancer by blocking the NFκB signaling pathway using bioreducible PEI-based/p65 shRNA complex nanoparticles. Biomaterials. 2013;34(21):5381–90.CrossRefPubMed Xiao J, Duan X, Yin Q, Miao Z, Yu H, Chen C, et al. The inhibition of metastasis and growth of breast cancer by blocking the NFκB signaling pathway using bioreducible PEI-based/p65 shRNA complex nanoparticles. Biomaterials. 2013;34(21):5381–90.CrossRefPubMed
24.
Zurück zum Zitat Huber MA, Azoitei N, Baumann B, Grünert S, Sommer A, Pehamberger H, et al. NF-κB is essential for epithelialmesenchymal transition and metastasis in a model of breast cancer progression. J Clin Invest. 2004;114(4):569–81.CrossRefPubMedPubMedCentral Huber MA, Azoitei N, Baumann B, Grünert S, Sommer A, Pehamberger H, et al. NF-κB is essential for epithelialmesenchymal transition and metastasis in a model of breast cancer progression. J Clin Invest. 2004;114(4):569–81.CrossRefPubMedPubMedCentral
25.
Zurück zum Zitat Fraser DM, Sullivan FM, Thompson AM, McCowan C. Aspirin use and survival after the diagnosis of breast cancer: a population-based cohort study. Br J Cancer. 2014;111(3):623–7.CrossRefPubMedPubMedCentral Fraser DM, Sullivan FM, Thompson AM, McCowan C. Aspirin use and survival after the diagnosis of breast cancer: a population-based cohort study. Br J Cancer. 2014;111(3):623–7.CrossRefPubMedPubMedCentral
26.
27.
Zurück zum Zitat Dyke ALV, Cote ML, Prysak G, Claeys GB, Wenzlaff AS, Schwartz AG. Regular adult aspirin Use decreases the risk of Non-small cell lung cancer among women. Cancer Epidemiol Biomarkers Prev. 2008;17(1):148–57.CrossRefPubMedPubMedCentral Dyke ALV, Cote ML, Prysak G, Claeys GB, Wenzlaff AS, Schwartz AG. Regular adult aspirin Use decreases the risk of Non-small cell lung cancer among women. Cancer Epidemiol Biomarkers Prev. 2008;17(1):148–57.CrossRefPubMedPubMedCentral
28.
29.
Zurück zum Zitat Wang HL, Lopategui J, Amin MB, Patterson SD. KRAS mutation testing in human cancers: the Pathologist’s role in the Era of personalized medicine. Adv Anat Pathol. 2010;17(1):23–32.PubMed Wang HL, Lopategui J, Amin MB, Patterson SD. KRAS mutation testing in human cancers: the Pathologist’s role in the Era of personalized medicine. Adv Anat Pathol. 2010;17(1):23–32.PubMed
30.
Zurück zum Zitat Wang Y, Ngo VN, Marani M, Yang Y, Wright G, Staudt LM, et al. Critical role for transcriptional repressor Snail2 in transformation by oncogenic RAS in colorectal carcinoma cells. Oncogene. 2010;29(33):4658–70.CrossRefPubMed Wang Y, Ngo VN, Marani M, Yang Y, Wright G, Staudt LM, et al. Critical role for transcriptional repressor Snail2 in transformation by oncogenic RAS in colorectal carcinoma cells. Oncogene. 2010;29(33):4658–70.CrossRefPubMed
31.
Zurück zum Zitat Cho Y, Gorina S, Jeffrey PD, Pavletich NP. Crystal structure of a p53 tumor suppressor-DNA complex: understanding tumorigenic mutations. Science. 1994;265:346–55.CrossRefPubMed Cho Y, Gorina S, Jeffrey PD, Pavletich NP. Crystal structure of a p53 tumor suppressor-DNA complex: understanding tumorigenic mutations. Science. 1994;265:346–55.CrossRefPubMed
32.
Zurück zum Zitat Bolós V, Peinado H, Pérez-Moreno MA, Fraga MF, Esteller M, Cano A. The transcription factor Slug represses E-cadherin expression and induces epithelial to mesenchymal transitions: a comparison with Snail and E47 repressors. J Cell Sci. 2003;116:499–511.CrossRefPubMed Bolós V, Peinado H, Pérez-Moreno MA, Fraga MF, Esteller M, Cano A. The transcription factor Slug represses E-cadherin expression and induces epithelial to mesenchymal transitions: a comparison with Snail and E47 repressors. J Cell Sci. 2003;116:499–511.CrossRefPubMed
33.
Zurück zum Zitat Roberts PJ, Der CJ. Targeting the Raf-MEK-ERK mitogen-activated protein kinase cascade for the treatment of cancer. Oncogene. 2007;26(22):3291–310.CrossRefPubMed Roberts PJ, Der CJ. Targeting the Raf-MEK-ERK mitogen-activated protein kinase cascade for the treatment of cancer. Oncogene. 2007;26(22):3291–310.CrossRefPubMed
34.
Zurück zum Zitat Aplin AE, Stewart SA, Assoian RK, Juliano RL. Integrin-mediated adhesion regulates ERK nuclear translocation and phosphorylation of Elk-1. J Cell Biol. 2001;153(2):273–81.CrossRefPubMedPubMedCentral Aplin AE, Stewart SA, Assoian RK, Juliano RL. Integrin-mediated adhesion regulates ERK nuclear translocation and phosphorylation of Elk-1. J Cell Biol. 2001;153(2):273–81.CrossRefPubMedPubMedCentral
35.
Zurück zum Zitat Shin SY, Kim CG, Lim Y, Lee YH. The Ets family transcription factor Elk-1 regulates induction of the cell cycle regulatory gene p21Waf1/Cip1 and the Bax gene in sodium arsenite-exposed human keratinocyte HaCaT cells. J Biol Chem. 2011;286(30):26860–72.CrossRefPubMedPubMedCentral Shin SY, Kim CG, Lim Y, Lee YH. The Ets family transcription factor Elk-1 regulates induction of the cell cycle regulatory gene p21Waf1/Cip1 and the Bax gene in sodium arsenite-exposed human keratinocyte HaCaT cells. J Biol Chem. 2011;286(30):26860–72.CrossRefPubMedPubMedCentral
36.
Zurück zum Zitat Yang SH, Yates PR, Whitmarsh AJ, Davis RJ, Sharrocks AD. The Elk-1 Ets-domain transcription factor contains a mitogen-activated protein kinase targeting motif. Mol Cell Biol. 1998;18(2):710–20.CrossRefPubMedPubMedCentral Yang SH, Yates PR, Whitmarsh AJ, Davis RJ, Sharrocks AD. The Elk-1 Ets-domain transcription factor contains a mitogen-activated protein kinase targeting motif. Mol Cell Biol. 1998;18(2):710–20.CrossRefPubMedPubMedCentral
37.
Zurück zum Zitat Chang F, Steelman LS, Lee JT, Shelton JG, Navolanic PM, Blalock WL, et al. Signal transduction mediated by the Ras/Raf/MEK/ERK pathway from cytokine receptors to transcription factors: potential targeting for therapeutic intervention. Leukemia. 2003;17(7):1263–93.CrossRefPubMed Chang F, Steelman LS, Lee JT, Shelton JG, Navolanic PM, Blalock WL, et al. Signal transduction mediated by the Ras/Raf/MEK/ERK pathway from cytokine receptors to transcription factors: potential targeting for therapeutic intervention. Leukemia. 2003;17(7):1263–93.CrossRefPubMed
39.
Zurück zum Zitat Jo H, Zhang R, Zhang H, McKinsey TA, Shao J, Beauchamp RD, et al. NF-kB is required for H-ras oncogene induced abnormal cell proliferation and tumorigenesis. Oncogene. 2000;19(7):841–9.CrossRefPubMed Jo H, Zhang R, Zhang H, McKinsey TA, Shao J, Beauchamp RD, et al. NF-kB is required for H-ras oncogene induced abnormal cell proliferation and tumorigenesis. Oncogene. 2000;19(7):841–9.CrossRefPubMed
40.
Zurück zum Zitat Wu DW, Lee MC, Hsu NY, Wu TC, Wu JY, Wanget YC, et al. FHIT loss confers cisplatin resistance in lung cancer via the AKT/NF-κB/Slug-mediated PUMA reduction. Oncogene. 2015;34(19):2505–15.CrossRefPubMed Wu DW, Lee MC, Hsu NY, Wu TC, Wu JY, Wanget YC, et al. FHIT loss confers cisplatin resistance in lung cancer via the AKT/NF-κB/Slug-mediated PUMA reduction. Oncogene. 2015;34(19):2505–15.CrossRefPubMed
41.
Zurück zum Zitat Kopp E, Ghosh S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 1994;265(5174):956–9.CrossRefPubMed Kopp E, Ghosh S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 1994;265(5174):956–9.CrossRefPubMed
42.
Zurück zum Zitat Yamamoto Y, Gaynor RB. Therapeutic potential of inhibition of the NF-κB pathway in the treatment of inflammation and cancer. J Clin Invest. 2001;107(2):135–42.CrossRefPubMedPubMedCentral Yamamoto Y, Gaynor RB. Therapeutic potential of inhibition of the NF-κB pathway in the treatment of inflammation and cancer. J Clin Invest. 2001;107(2):135–42.CrossRefPubMedPubMedCentral
43.
Zurück zum Zitat Thun MJ, Jacobs EJ, Patrono C. The role of aspirin in cancer prevention. Nat Rev Clin Oncol. 2012;9(5):259–67.CrossRefPubMed Thun MJ, Jacobs EJ, Patrono C. The role of aspirin in cancer prevention. Nat Rev Clin Oncol. 2012;9(5):259–67.CrossRefPubMed
44.
Zurück zum Zitat Norrish AE, Jackson RT, McRae CU. Non-steroidal anti-inflammatory drugs and prostate cancer progression. Int J Cancer. 1998;77(4):511–5.CrossRefPubMed Norrish AE, Jackson RT, McRae CU. Non-steroidal anti-inflammatory drugs and prostate cancer progression. Int J Cancer. 1998;77(4):511–5.CrossRefPubMed
45.
Zurück zum Zitat Gilmore TD, Herscovitch M. Inhibitors of NFκB signaling: 785 and counting. Oncogene. 2006;25(51):6887–99.CrossRefPubMed Gilmore TD, Herscovitch M. Inhibitors of NFκB signaling: 785 and counting. Oncogene. 2006;25(51):6887–99.CrossRefPubMed
46.
Zurück zum Zitat Rothwell PM, Wilson M, Price JF, Belch JF, Meade TW, Mehta Z. Effect of daily aspirin on risk of cancer metastasis: a study of incident cancers during randomised controlled trials. Lancet. 2012;379(9826):1591–601.CrossRefPubMed Rothwell PM, Wilson M, Price JF, Belch JF, Meade TW, Mehta Z. Effect of daily aspirin on risk of cancer metastasis: a study of incident cancers during randomised controlled trials. Lancet. 2012;379(9826):1591–601.CrossRefPubMed
47.
Zurück zum Zitat Algra AM, Rothwell PM. Effects of regular aspirin on long-term cancer incidence and metastasis: a systematic comparison of evidence from observational studies versus randomised trials. Lancet Oncol. 2012;13(5):518–27.CrossRefPubMed Algra AM, Rothwell PM. Effects of regular aspirin on long-term cancer incidence and metastasis: a systematic comparison of evidence from observational studies versus randomised trials. Lancet Oncol. 2012;13(5):518–27.CrossRefPubMed
48.
Zurück zum Zitat Wynne S, Djakiew D. NSAID inhibition of prostate cancer cell migration is mediated by Nag-1 induction via the p38 MAPK-p75(NTR) pathway. Mol Cancer Res. 2010;8(12):1656–64.CrossRefPubMedPubMedCentral Wynne S, Djakiew D. NSAID inhibition of prostate cancer cell migration is mediated by Nag-1 induction via the p38 MAPK-p75(NTR) pathway. Mol Cancer Res. 2010;8(12):1656–64.CrossRefPubMedPubMedCentral
49.
Zurück zum Zitat Schrör K. Clinical Applications of Aspirin. In: Acetylsalicylic Acid. Weinheim, Germany: Wiley-VCH Verlag GmbH & Co. KGaA; 2008.CrossRef Schrör K. Clinical Applications of Aspirin. In: Acetylsalicylic Acid. Weinheim, Germany: Wiley-VCH Verlag GmbH & Co. KGaA; 2008.CrossRef
50.
Zurück zum Zitat Brady RR, Loveridge CJ, Dunlop MG, Stark LA. c-Src dependency of NSAID-induced effects on NF-kB-mediated apoptosis in colorectal cancer cells. Carcinogenesis. 2011;32(7):1069–77.CrossRefPubMed Brady RR, Loveridge CJ, Dunlop MG, Stark LA. c-Src dependency of NSAID-induced effects on NF-kB-mediated apoptosis in colorectal cancer cells. Carcinogenesis. 2011;32(7):1069–77.CrossRefPubMed
53.
Zurück zum Zitat Lemieux E, Cagnol S, Beaudry K, Carrier J, Rivard N. Oncogenic KRAS signalling promotes the Wnt/β-catenin pathway through LRP6 in colorectal cancer. Oncogene. 2015;34(38):4914–27.CrossRefPubMed Lemieux E, Cagnol S, Beaudry K, Carrier J, Rivard N. Oncogenic KRAS signalling promotes the Wnt/β-catenin pathway through LRP6 in colorectal cancer. Oncogene. 2015;34(38):4914–27.CrossRefPubMed
54.
Zurück zum Zitat Shin S, Blenis J. ERK2/Fra1/ZEB pathway induces epithelial-tomesenchymal transition. Cell Cycle. 2010;9(13):2483–4.CrossRefPubMed Shin S, Blenis J. ERK2/Fra1/ZEB pathway induces epithelial-tomesenchymal transition. Cell Cycle. 2010;9(13):2483–4.CrossRefPubMed
55.
Zurück zum Zitat Li QJ, Yang SH, Maeda Y, Sladek FM, Sharrocks AD, Martins-Green M. MAP kinase phosphorylation-dependent activation of Elk-1 leads to activation of the co-activator p300. EMBO J. 2003;22(2):281–91.CrossRefPubMedPubMedCentral Li QJ, Yang SH, Maeda Y, Sladek FM, Sharrocks AD, Martins-Green M. MAP kinase phosphorylation-dependent activation of Elk-1 leads to activation of the co-activator p300. EMBO J. 2003;22(2):281–91.CrossRefPubMedPubMedCentral
57.
Zurück zum Zitat Brandl M, Seidler B, Haller F, Adamski J, Schmid RM, Saur D, et al. IKKαcontrols canonical TGFβ–SMAD signaling to regulate genes expressing SNAIL and SLUG during EMT in Panc1 cells. J Cell Sci. 2010;123(Pt 24):4231–9.CrossRefPubMed Brandl M, Seidler B, Haller F, Adamski J, Schmid RM, Saur D, et al. IKKαcontrols canonical TGFβ–SMAD signaling to regulate genes expressing SNAIL and SLUG during EMT in Panc1 cells. J Cell Sci. 2010;123(Pt 24):4231–9.CrossRefPubMed
58.
Zurück zum Zitat Yotsui T, Yasuda O, Kawamoto H, Higuchi M, Chihara Y, Umemoto E, et al. Aspirin prevents adhesion of T lymphoblasts to vascular smooth muscle cells. FEBS Lett. 2007;581(3):427–32.CrossRefPubMed Yotsui T, Yasuda O, Kawamoto H, Higuchi M, Chihara Y, Umemoto E, et al. Aspirin prevents adhesion of T lymphoblasts to vascular smooth muscle cells. FEBS Lett. 2007;581(3):427–32.CrossRefPubMed
59.
Zurück zum Zitat Helbig G. Christopherson KW 2nd, Bhat-Nakshatri P, Kumar S, Kishimoto H, Miller KD, et al. NFkB promotes breast cancer cell migration and metastasis by inducing the expression of the chemokine receptor CXCR4. J Biol Chem. 2003;278(24):21631–8.CrossRefPubMed Helbig G. Christopherson KW 2nd, Bhat-Nakshatri P, Kumar S, Kishimoto H, Miller KD, et al. NFkB promotes breast cancer cell migration and metastasis by inducing the expression of the chemokine receptor CXCR4. J Biol Chem. 2003;278(24):21631–8.CrossRefPubMed
60.
Zurück zum Zitat Sobolewski C, Cerella C, Dicato M, Ghibelli L, Diederich M. The role of cyclooxygenase-2 in cell proliferation and cell death in human malignancies. Int J Cell Biol. 2010;2010:215158.CrossRefPubMedPubMedCentral Sobolewski C, Cerella C, Dicato M, Ghibelli L, Diederich M. The role of cyclooxygenase-2 in cell proliferation and cell death in human malignancies. Int J Cell Biol. 2010;2010:215158.CrossRefPubMedPubMedCentral
61.
Zurück zum Zitat Chakraborty S, Mazumdar M, Mukherjee S, Bhattacharjee P, Adhikary A, Manna A, et al. Restoration of p53/miR-34a regulatory axis decreases survival advantage and ensures Bax-dependent apoptosis of non-small cell lung carcinoma cells. FEBS Lett. 2014;588(4):549–59.CrossRefPubMed Chakraborty S, Mazumdar M, Mukherjee S, Bhattacharjee P, Adhikary A, Manna A, et al. Restoration of p53/miR-34a regulatory axis decreases survival advantage and ensures Bax-dependent apoptosis of non-small cell lung carcinoma cells. FEBS Lett. 2014;588(4):549–59.CrossRefPubMed
62.
Zurück zum Zitat Adhikary A, Chakraborty S, Mazumdar M, Ghosh S, Mukherjee S, Manna A, et al. Inhibition of epithelial to mesenchymal transition by E-cadherin Up-regulation via repression of slug transcription and inhibition of E-cadherin degradation dual role of Scaffold/Matrix Attachment Region-binding Protein1 (SMAR1) in breast cancer cells. J Biol Chem. 2014;289(37):25431–44.CrossRefPubMedPubMedCentral Adhikary A, Chakraborty S, Mazumdar M, Ghosh S, Mukherjee S, Manna A, et al. Inhibition of epithelial to mesenchymal transition by E-cadherin Up-regulation via repression of slug transcription and inhibition of E-cadherin degradation dual role of Scaffold/Matrix Attachment Region-binding Protein1 (SMAR1) in breast cancer cells. J Biol Chem. 2014;289(37):25431–44.CrossRefPubMedPubMedCentral
63.
Zurück zum Zitat Saha B, Adhikary A, Ray P, Saha S, Chakraborty S, Mohanty S, et al. Restoration of tumor suppressor p53 by differentially regulating pro- and anti-p53 networks in HPV-18-infected cervical cancer cells. Oncogene. 2012;31(2):173–86.CrossRefPubMed Saha B, Adhikary A, Ray P, Saha S, Chakraborty S, Mohanty S, et al. Restoration of tumor suppressor p53 by differentially regulating pro- and anti-p53 networks in HPV-18-infected cervical cancer cells. Oncogene. 2012;31(2):173–86.CrossRefPubMed
64.
Zurück zum Zitat Mukherjee S, Mazumdar M, Chakraborty S, Manna A, Saha S, Khan P, et al. Curcumin inhibits breast cancer stem cell migration by amplifying the E-cadherin/β-catenin negative feedback loop. Stem Cell Res Ther. 2014;5(5):116.CrossRefPubMedPubMedCentral Mukherjee S, Mazumdar M, Chakraborty S, Manna A, Saha S, Khan P, et al. Curcumin inhibits breast cancer stem cell migration by amplifying the E-cadherin/β-catenin negative feedback loop. Stem Cell Res Ther. 2014;5(5):116.CrossRefPubMedPubMedCentral
65.
Zurück zum Zitat Lahiry L, Saha B, Chakraborty J, Adhikary A, Mohanty S, Hossain DMS, et al. Theaflavins target Fas/caspase-8 and Akt/pBad pathways to induce apoptosis in p53-mutated human breast cancer cells. Carcinogenesis. 2010;31(2):259–68.CrossRefPubMed Lahiry L, Saha B, Chakraborty J, Adhikary A, Mohanty S, Hossain DMS, et al. Theaflavins target Fas/caspase-8 and Akt/pBad pathways to induce apoptosis in p53-mutated human breast cancer cells. Carcinogenesis. 2010;31(2):259–68.CrossRefPubMed
66.
Zurück zum Zitat Hossain DMS, Panda AK, Manna A, Mohanty S, Bhattacharjee P, Bhattacharyya S, et al. FoxP3 acts as a cotranscription factor with STAT3 in tumor-induced regulatory T cells. Immunity. 2013;39(6):1057–69.CrossRefPubMed Hossain DMS, Panda AK, Manna A, Mohanty S, Bhattacharjee P, Bhattacharyya S, et al. FoxP3 acts as a cotranscription factor with STAT3 in tumor-induced regulatory T cells. Immunity. 2013;39(6):1057–69.CrossRefPubMed
67.
Zurück zum Zitat Mazumdar M, Adhikary A, Chakraborty S, Mukherjee S, Manna A, Saha S, et al. Targeting RET to induce medullary thyroid cancer cell apoptosis: an antagonistic interplay between PI3K/Akt and p38MAPK/caspase-8 pathways. Apoptosis. 2013;18(5):589–604.CrossRefPubMed Mazumdar M, Adhikary A, Chakraborty S, Mukherjee S, Manna A, Saha S, et al. Targeting RET to induce medullary thyroid cancer cell apoptosis: an antagonistic interplay between PI3K/Akt and p38MAPK/caspase-8 pathways. Apoptosis. 2013;18(5):589–604.CrossRefPubMed
68.
Zurück zum Zitat Saha S, Mukherjee S, Mazumdar M, Manna A, Khan P, Adhikary A, et al. Mithramycin A sensitizes therapy-resistant breast cancer stem cells toward genotoxic drug doxorubicin. Transl Res. 2015;165(5):558–77.CrossRefPubMed Saha S, Mukherjee S, Mazumdar M, Manna A, Khan P, Adhikary A, et al. Mithramycin A sensitizes therapy-resistant breast cancer stem cells toward genotoxic drug doxorubicin. Transl Res. 2015;165(5):558–77.CrossRefPubMed
69.
Zurück zum Zitat Chakraborty J, Banerjee S, Ray P. DMS Hossain, S Bhattacharyya, A Adhikary et al. Gain of Cellular Adaptation Due to Prolonged p53 Impairment Leads to Functional Switchover from p53 to p73 during DNA Damage in Acute Myeloid Leukemia Cells. J Biol Chem. 2010;285(43):33104–12.CrossRefPubMedPubMedCentral Chakraborty J, Banerjee S, Ray P. DMS Hossain, S Bhattacharyya, A Adhikary et al. Gain of Cellular Adaptation Due to Prolonged p53 Impairment Leads to Functional Switchover from p53 to p73 during DNA Damage in Acute Myeloid Leukemia Cells. J Biol Chem. 2010;285(43):33104–12.CrossRefPubMedPubMedCentral
70.
Zurück zum Zitat Chakraborty S, Das K, Saha S, Mazumdar M, Manna A, Chakraborty S, et al. Nuclear matrix protein SMAR1 represses c-Fos-mediated HPV18 E6 transcription through alteration of chromatin histone deacetylation. J Biol Chem. 2014;289(42):29074–85.CrossRefPubMedPubMedCentral Chakraborty S, Das K, Saha S, Mazumdar M, Manna A, Chakraborty S, et al. Nuclear matrix protein SMAR1 represses c-Fos-mediated HPV18 E6 transcription through alteration of chromatin histone deacetylation. J Biol Chem. 2014;289(42):29074–85.CrossRefPubMedPubMedCentral
Metadaten
Titel
Aspirin inhibits epithelial-to-mesenchymal transition and migration of oncogenic K-ras-expressing non-small cell lung carcinoma cells by down-regulating E-cadherin repressor Slug
verfasst von
Poulami Khan
Argha Manna
Shilpi Saha
Suchismita Mohanty
Shravanti Mukherjee
Minakshi Mazumdar
Deblina Guha
Tanya Das
Publikationsdatum
01.12.2016
Verlag
BioMed Central
Erschienen in
BMC Cancer / Ausgabe 1/2016
Elektronische ISSN: 1471-2407
DOI
https://doi.org/10.1186/s12885-016-2078-7

Weitere Artikel der Ausgabe 1/2016

BMC Cancer 1/2016 Zur Ausgabe

Darf man die Behandlung eines Neonazis ablehnen?

08.05.2024 Gesellschaft Nachrichten

In einer Leseranfrage in der Zeitschrift Journal of the American Academy of Dermatology möchte ein anonymer Dermatologe bzw. eine anonyme Dermatologin wissen, ob er oder sie einen Patienten behandeln muss, der eine rassistische Tätowierung trägt.

Erhöhte Mortalität bei postpartalem Brustkrebs

07.05.2024 Mammakarzinom Nachrichten

Auch für Trägerinnen von BRCA-Varianten gilt: Erkranken sie fünf bis zehn Jahre nach der letzten Schwangerschaft an Brustkrebs, ist das Sterberisiko besonders hoch.

Hypertherme Chemotherapie bietet Chance auf Blasenerhalt

07.05.2024 Harnblasenkarzinom Nachrichten

Eine hypertherme intravesikale Chemotherapie mit Mitomycin kann für Patienten mit hochriskantem nicht muskelinvasivem Blasenkrebs eine Alternative zur radikalen Zystektomie darstellen. Kölner Urologen berichten über ihre Erfahrungen.

Ein Drittel der jungen Ärztinnen und Ärzte erwägt abzuwandern

07.05.2024 Klinik aktuell Nachrichten

Extreme Arbeitsverdichtung und kaum Supervision: Dr. Andrea Martini, Sprecherin des Bündnisses Junge Ärztinnen und Ärzte (BJÄ) über den Frust des ärztlichen Nachwuchses und die Vorteile des Rucksack-Modells.

Update Onkologie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.