Background
Lung cancer is the leading cause of cancer death and the second most common cancer in both men and women [
1]. Among them, the incidence of lung adenocarcinoma (LA), the most common histological type of lung cancer, is increasing year by year [
2‐
4]. Despite immense progress in therapeutic strategies, including surgery, molecular targeted agents, and immune checkpoint inhibitors, the 5-year survival rate among patients with non-small cell lung cancer (NSCLC) is less than 20% [
5‐
7]. The high mortality for NSCLC patients may be driven by two factors: one is that about 66% of NSCLC patients are diagnosed at a relatively advanced stage. The other one is that even in the early-stage portion, the mortality rate is still very high because of the high recurrence rate after surgery [
8,
9]. Therefore, there is an urgent need to identify and develop novel molecular markers to improve the prognosis of LA.
Calcium-activated nucleotidase 1 (CANT1), also known as DBQD, SCAN-1, SCAN1, SHAPY, functions as a calcium-dependent nucleotidase with a preference for uridine diphosphate (UDP). The protein encoded by CANT1 belongs to the apyrase family. CANT1 is generally expressed in human tissues [
10]. Alternative splicing transcript variants have been noted for this gene. The alternative splicing transcript variants often appear in cancer and have been regarded as an important sign of tumor progression and cancer treatment [
11]. Cancer cells often show abnormal alternative splicing profiles to produce isoforms, stimulating cell proliferation and migration or increasing apoptosis resistance [
12]. CANT1 is a new oncogenic mRNA in some cancer types, like human clear cell renal cell carcinoma (ccRCC) and prostate cancer. These studies showed that CANT1 was associated with cancer cell proliferation, migration, and invasion. Besides, the high expression of CANT1 was positively correlated with TNM stage and histological grade in ccRCC [
13,
14]. In addition, some studies have indicated that mutations in CANT1 are associated with abnormal growth and development [
15,
16]. Previous research has shown that factors related to normal growth often play a momentous role in tumor growth [
17]. These results suggest the potential role of CANT1 as a prognostic biomarker in cancer. Although CANT1 plays a crucial role in some types of tumors, it is unclear whether it is a prognostic factor of LA. Besides, there is little literature about the relationship between CANT1 and LA reported so far. It is the rare study to demonstrate the functional mechanism of CANT1 in LA.
CANT1 is a phosphatase whose preferred substrate is UDP and followed by GDP, UTP, GTP, ADP, and ATP [
10]. Gerhardt et al. indicated a G1 phase cell-cycle arrest on CANT1 knockdown in LNCaP and PC-3 cells [
13]. Another result showed that knockdown of CANT1 induced an S-phase cell-cycle arrest, resulting in a decrease in the number of cells entering the G2/M-phase [
14]. It also demonstrated that CANT1 knockdown could promote apoptosis. Several genes involved in the apoptotic pathways were altered after CANT1 was knocked out in 769-P cells. Such as the pro-apoptotic factors of BAD and cleaved caspase-3 were upregulated, while the anti-apoptotic factor of BCL2 was downregulated. Serine, glycine, threonine metabolism, purine metabolism, and glycosphingolipid biosynthesis in the genes’ pathway are significantly altered [
14]. Besides, CANT1 might contribute to tumorigenesis via activating both MAPK and NF-kB signaling pathways [
18]. However, little literature has explored the association between CANT1 and LA. Therefore, our study aimed to elucidate the expression of CANT1 and its potential value of therapy and prognosis in LA tissues.
In the present study, we comprehensively investigated the prognostic role of CANT1 in LA patients through bioinformatics analysis and in vitro experiments. This research aimed to identify CANT1 gene with potential prognostic relevance in patients with LA. Up to now, there is no evidence that CANT1 relates to the occurrence and development of LA. Therefore, our study aimed to elucidate the expression of CANT1 and its potential value of therapy and prognosis in LA tissues. Besides, there is little literature about the relationship between CANT1 and LA reported so far. It is the rare study to demonstrate the functional mechanism of CANT1 in LA. In the study, we explored the effect of CANT1 expression and methylation on prognosis to determine whether CANT1 can be a potential prognostic biomarker for patients with LA. Finally, we also verified the biological function and behavior of CANT1 in LACs through in vitro experiments. This further strengthens our understanding of the biological mechanism of CANT1.
Methods
The lung adenocarcinoma tissues and adjacent tissues included in our study were from the TCGA database, where a total of 502 LA patients from 1991 to 2013. Gene expression data and the corresponding clinical information of the TCGA-LA were obtained from the TCGA (
https://portal.gdc.cancer.gov/). The GEO databases of GPL570 and GPL6884 platforms were performed for the validation (
www.ncbi.nlm.nih.gov/geo). Expression profiles (HTSeq-Counts) were compared between high and low CANT1 expression groups to identify differentially expressed genes (DEGs) using the DESeq2 R package. The data used in this study were in accordance with the guidelines provided by TCGA and GEO. The ethics approval and informed consent were not required.
Over-expression of CANT1 in LA patients
We explored the expression differences of CANT1 in LA patients between tumor tissue and normal tissue. Besides, the immunohistochemistry staining of CANT1 expression was obtained by the Human Protein Atlas (HPA) (
https://www.proteinatlas.org) [
19,
20]. On the HPA website, antibodies HPA019627, HPA022818, and HPA019639 were used for immunohistochemistry staining of CANT1.
Role of CANT1 in LA patient’s survival
A total of 502 LA patients were included in our study. The survival curve was performed by survival R package and survminer R package. Furthermore, we validated the prognostic values of the risk model in two independent datasets from GSE31219 (n = 83) and GSE41271 (n = 181).
Construction and evaluation of the nomogram model
A nomogram was built based on the multivariate analysis’s result to predict the survival probability for 1-year, 3-years, and 5-years of LA patients. The rms R package was performed to produce a nomogram. The concordance index (C-index) and calibration curve were performed by the Hmisc R package. In this study, C-index was carried out to determine the nomogram’s discrimination with 1000 bootstrap replicated.
Functional enrichment analysis
GEPIA is a database based on the UCSC Xena project [
21]. In the study, GEPIA 2.0 (
http://gepia2.cancer-pku.cn/) was performed to find the gene with the most similar expression of CANT1 in LA. Finally, 50 most correlated co-expression genes were founded. Then the functional analysis of CANT1 and its co-expression genes in TCGA-LA were predicted by Metascape (
http://metascape.org) [
22].
Gene set enrichment analysis
Gene set enrichment analysis (GSEA) is a calculation method that determines whether a set of prior defined genes show statistically significant and consistent differences between two biological states [
23,
24]. In this study, GSEA was performed using the Molecular Signatures Database (MSigDB) Collection (c2.all.v7.0.entrez.gmt) of clusterProfiler R package to illuminate the statistically significant pathway difference between high and low CANT1 expression groups of LA. The expression level of CANT1 was used as a phenotype label. The pathway terms with adjusted
P-value < 0.05 and false discovery rate (FDR)
q-value < 0.25 were considered significantly enriched.
Correlation between CANT1 expression and DNA methylation
The previous GSEA analysis suggested that CANT1 was related to DNA methylation. Therefore, we then analyzed the relationship between the expression of CANT1 and DNA methylation. Spearman correlation coefficient was performed to reveal the correlation between the expression of CANT1 and methylation level in TCGA-LA. The gene methylation data of the TCGA-LA project was obtained from the UCSC Xena browser (version:07-20-2019,
https://xenabrowser.net/datapages/). The relationship between the methylation level and overall survival (OS) of CANT1 was retrieved from MethSurv (
https://biit.cs.ut.ee/methsurv/). It is a web tool to provide univariable and multivariable survival analysis based on DNA methylation biomarkers by using TCGA data [
25].
Cell lines and cell culture
Human lung adenocarcinoma cell lines A549 and H1299 were obtained from the Genechem company (Shanghai, China). A549 cells were cultured in Ham’s F-12 K medium (PYG0036, Boster, USA) supplemented with 10% fetal bovine serum (FBS, P30-3302, PAN biotech, Germany) and 1% penicillin/streptomycin (100x, Gibco, USA), H1299 Cells were cultured in RPMI-1640 (PYG0006, Boster, USA) supplemented with 10% FBS and 1% penicillin/streptomycin. All cell lines were maintained in a humidified incubator with 5% CO2 at 37 °C. The medium was changed every 3 days, and a subcultivation ratio of 1:3 was performed.
Small interfering RNAs transfection
Small interfering RNAs (siRNAs) were used to selectively knockdown the expression of CANT1 by the Lipofectamine 3000 transfection reagent (L3000-015, Invitrogen, USA), according to the manufacturer’s instructions. The sequence of three groups of siRNAs targeting CANT1 (siRNA-987, siRNA-1173, and siRNA-273) and two negative control groups (si-NC and NC) were obtained from the zolgene (Fuzhou, China) shown in Table
1. For transfection, A549 and H1299 cells in the logarithmic growth phase were inoculated into a six-well plate. Knockdown efficiency was verified on the RNA level using quantitative real-time polymerase chain reaction (qRT-PCR).
Table 1
The sequence of three groups of siRNAs targeting CANT1 (siRNA-987, siRNA-1173, and siRNA-273) and negative control group (si-NC)
CANT1(human)siRNA-987 | GGGUGAAGGUGGUGGGCUATT | 21 | 57.1 |
CANT1(human)siRNA-987 | UAGCCCACCACCUUCACCCTT | 21 | 57.1 |
CANT1(human)siRNA-1173 | AGAAGGACGACGAGCGCAATT | 21 | 52.4 |
CANT1(human)siRNA-1173 | UUGCGCUCGUCGUCCUUCUTT | 21 | 52.4 |
CANT1(human)siRNA-273 | CGGAAUGGAAUGAGUCUAUTT | 21 | 38.1 |
CANT1(human)siRNA-273 | AUAGACUCAUUCCAUUCCGTT | 21 | 38.1 |
Negative control | UUCUCCGAACGUGUCACGUTT | 21 | 47.6 |
Negative control | ACGUGACACGUUCGGAGAATT | 21 | 47.6 |
Quantitative real-time polymerase chain reaction
Total RNA was isolated using the TRIzol™ Reagent (15,596,026, Invitrogen, USA). Then the GoScript™ Reverse Transcription System (A5001, Promega, USA) was employed to reversely transcribe RNA into cDNA. qRT-PCR was conducted using UltraSYBR Mixture (CW0957, Cwbio, China) to measure the expression of CANT1. β-actin was used as the internal reference. The calculation of inhibitory efficacy of the CANT1 mRNA was calculated using the 2
-ΔΔCt method. The sequences of primers used in qRT-PCR were shown in Table
2.
Table 2
The sequences of primers used in qRT-PCR
β-actin(Homo) | TGACGTGGACATCCGCAAAG | 20 |
β-actin(Homo) | CTGGAAGGTGGACAGCGAGG | 20 |
CANT1-F(Homo) | GCTTCTCGTCCTTCAAGTTCATC | 23 |
CANT1-R(Homo) | ACGCTTCCGATCTTGGTCTC | 20 |
Cell counting kit-8 (CCK-8) assay
After transfection, we used the CCK-8 reagent (40203ES60, Yeasen, Shanghai, China) to measure cell viability. The si-CANT1 group, si-NC group, and NC group of A549 and H1299 cells were subcultured in a 96-well plate and then incubated for 0, 24, 48, and 72 h. Before detection, 10 μl (10%) CCK8 reagent was added daily to each hole in the 96-well plates and incubated at 37 °C for 1 h. Then, a microplate reader (Nano-100, Allsheng, Hangzhou, China) was used to measure the absorbance at 450 nm.
Cell invasion assay
The invasive ability of the A549 and H1299 cells was assessed with Transwell chambers and Matrigel. The Transwell chambers were coated with 50 μl diluted Matrigel (1:8) at 37 °C for 4 h. Subsequently, 1 × 105/mL cells resuspended in serum-free medium were added into the Transwell chamber, which was placed in cell culture medium supplemented with 10% FBS and was cultured for 48 h. Then the residual cells in the upper chamber were wiped with cotton swabs. Cells migrated through the membrane were fixed with 4% paraformaldehyde (P1110, Solarbio, Beijing, China), washed with PBS, mixed with 0.4% crystal violet solution (C0121, Beyotime, Shanghai, China), and counting in 3 randomly picked view under a microscope at 100× magnification (MF53, Mshot, Guangzhou, China).
Flow cytometry
For cell cycle detection, 1 × 106/ml cells were counted and washed with phosphate buffer saline (PBS, ABA212278, Hyclone, USA), followed by the addition of 70% cold ethanol at 4 °C overnight. After washing with cold PBS, the fixed-cell pellets were collected by centrifugation and resuspended in ribonuclease (RNase) A/Propidium Iodide (PI) staining buffer. The cell-cycle distribution was analyzed by flow cytometer (FACSVerse, BD, USA).
Statistical analysis
All statistical analysis was performed using SPSS (version 26.0) and R (version 4.0.2). Wilcoxon rank-sum test and Wilcoxon signed-rank test were used to compare the expression of CANT1 between LA and normal groups. X-tile software (version 3.6.1,
https://medicine.yale.edu/lab/rimm/research/software/) was performed to seek the optimal cutoff value of CANT1 expression. The relationship between the TN stage and the expression of CANT1 was analyzed with Wilcoxon single-rank test. Clinical parameters (age, gender, number pack years smoked, epithelial growth factor receptor (EGFR) mutation status, kirsten rat sarcoma viral oncogene (KRAS) mutation status, anaplastic lymphoma kinase (ALK) mutation status, T stage, N stage, M stage, pathological stage, and gene expression) associated with OS in LA patients were evaluated with Cox analyses. In univariate analysis, all factors with
P < 0.20 were involved in multivariate analysis to identify independent prognostic factors. Owing to missing data exceeding 20%, the ALK mutation status and M stage were not included in multivariate analysis. Comparisons between two groups were analyzed by t-test. All experiments were performed with at least three independent replications. All tests were two-sided, and a
P-value < 0.05 was considered statistically significant.
Discussion
Lung adenocarcinoma (LA) accounts for almost half of lung cancers and patients with advanced LA have a very low survival rate [
26]. Despite advances and efforts in understanding LA biology in recent years, the functional mechanisms of LA carcinogenesis remain elusive. This research aimed to identify gene with potential prognostic relevance. Up to now, there is no evidence that CANT1 relates to the occurrence and development of LA. Nevertheless, the role of CANT1 has been confirmed in other cancers, including clear cell renal cell carcinoma (ccRCC) [
14] and prostate cancer [
13]. To the best of our knowledge, it is the rare study to demonstrate the functional impact of CANT1 in LA.
Several studies have reported the prognostic significance of CANT1 for some cancers. High CANT1 expression was related to having a poor overall survival (OS) rate (
P < 0.05) in ccRCC [
14].The prognostic analysis was also carried out in our study. High expression of CANT1 was correlated with poor prognosis of LA in T2 to T4, N1 to N3, and stage II to IV. As shown above, our study suggested that CANT1 is a prognostic biomarker in LA. High expression of CANT1 indicated a worse survival rate.
In this study, GO enrichment analysis including Ras protein signal transduction, Ras GTPase binding, mitotic nuclear division, apoptotic signaling pathway, and cytoskeleton-dependent cytokinesis. These results suggested that CANT1 is related to cell division and growth, further supporting its relationship with tumorigenesis. Other enrichment results are related to intercellular recognition, interaction, and metabolism, which need to be confirmed by further study. GSEA analysis including DNA methylation, DNA damage telomere stress-induced senescence, and depurination. Evan et al. indicated that excessive accumulation of cells in cancer cells results from excessive cell proliferation and inadequate apoptosis. The inactivation of pro-apoptotic genes and the increased expression or activity of anti-apoptotic proteins lead to apoptosis deficiency [
27]. Depurination is a process in which purines are lost in nucleic acids due to energy absorption. It participated in maintaining cell metabolism, which may affect cell growth. DNA depurination was related to the occurrence and development of cancer [
28]. The previous study had also shown that CANT1 was involved in the therapy of purine and pyrimidine antimetabolites in cancer [
29].
Several studies have demonstrated that the initiation and progression of tumors can be facilitated by epigenetic and genomic alterations [
30], such as DNA methylation [
31]. Despite many mechanisms contributing to elevated gene expression, DNA methylation is one of the most common mechanisms. Sato et al. indicated that high gene expression induced by hypomethylation was associated with poor prognosis in NSCLC [
32,
33]. Through our analysis, we found that hypomethylation is correlated with the high expression level of CANT1. Our studies also showed that the hypomethylation level was associated with poor prognosis in LA patients. Therefore, CANT1 expression may be epigenetically regulated by DNA hypomethylation and has prognostic significance for LA. This result suggested that the hypomethylation of CANT1 may be associated with the high expression of CANT1.
To further confirm the biological mechanism of CANT1, we carried out a series of in vitro experiments in A549 and H1299 cells. Our experimental results indicated that knockdown of CANT1 resulted in decreased cell proliferation, invasion, and G1 phase cell-cycle arrest in LACs, which is consistent with our bioinformatics prediction. Based on the above results, CANT1 may take an active part in cell growth and division in LA and leading to the occurrence and development of LA.
Although the present study enhanced our understanding of the relationship between CANT1 and LA, our study had some limitations. First, our research was validated by in vitro experiments, we did not perform relevant experiments in vivo. Additionally, our investigations into the role of CANT1 in the tumor were based on the TCGA and GEO databases, which lacks verification from our clinical samples. Finally, we also cannot clearly investigate the direct mechanisms of CANT1 involved in the occurrence and development of LA. Our research has indicated the role of CANT1 in the metastasis of LA cells. Herein the results have shown that the CANT1 plays an important role in the invasion and migration of LA cells. It showed that the overexpression of CANT1 caused significant increase in the invasion and migration of LA cells, indicative of the role of CANT1 in LA cell metastasis. Although both CANT1 siRNA have interference effects, we have verified the most effective one. Nonetheless, it is fairly important to use one more CANT1 siRNA for the important experiments. At present, our research is mainly based on bioinformatics analysis and preliminary cell experiments to explore the role of CANT1 in LA, so in our future plan, we will further explore CANT1-mediated downstream pathways or molecules, so as to clarify the specific mechanism of CANT1 affecting the malignant phenotype of LA. It might be interesting to study whether the CANT1 gene may affect the biological function and mechanism of LA. Anyhow, a large number of samples and comprehensive studies are still required to strengthen the hypothesis that CANT1 is a prognostic biomarker.
Acknowledgments
We sincerely thank the public databases, including TCGA, GEO, GEPIA, Metascape, HPA, and MethSurv for providing open access.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.