Skip to main content
Erschienen in: BMC Pulmonary Medicine 1/2020

Open Access 01.12.2020 | Research article

miRNA-425-5p enhances lung cancer growth via the PTEN/PI3K/AKT signaling axis

verfasst von: Jin-shan Zhou, Ze-shan Yang, Si-yang Cheng, Jiang-hao Yu, Chao-Jun Huang, Qiang Feng

Erschienen in: BMC Pulmonary Medicine | Ausgabe 1/2020

Abstract

Background

miRNAs regulate a multitude of cellular processes and their aberrant regulation is linked to human cancer. However, the role of miR-425-5p in lung cancer (LCa) is still largely unclear. Here, we explored the role of miR-425-5p during LCa tumorigenesis.

Methods

Cell proliferation was evaluated by cell counting Kit-8 and colony formation assay. Western blot and real-time PCR were accordingly used to detect the relevant proteins, miRNA and gene expression. Luciferase reporter assays were used to illustrate the interaction between miR-425-5p and PTEN.

Results

We demonstrate that miR-425-5p is overexpressed in LCa tissue and enhances the proliferative and colony formation capacity of the LCa cell lines A549 and NCI-H1299. Through predictive binding assays, PTEN was identified as a direct gene target and its exogenous expression inhibited the pro-cancer effects of miR-425-5p. Through its ability to down-regulate PTEN, miR-425-5p activated the PI3K/AKT axis.

Conclusion

We conclude that miR-425-5p promotes LCa tumorigenesis through PTEN/PI3K/AKT signaling.
Begleitmaterial
Additional file 1: Supplement Figure S1. Uncropped images of blots and gels related to Fig. 3. Supplement Figure S2. Uncropped images of blots and gels related to Fig. 4. Supplement Figure S3. Uncropped images of blots and gels related to Fig. 5. Table S1. The raw data of all colony formation experiments.
Hinweise

Supplementary information

Supplementary information accompanies this paper at https://​doi.​org/​10.​1186/​s12890-020-01261-0.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
Lca
Lung cancer
PTEN
Gene of phosphate and tension homology deleted on chromsome ten
PI3K
Phosphatidylinositol 3-kinase
NSCLC
Non-small cell lung cancer
GCa
Gastric cancer
CRC
Colorectal cancer
HCC
Hepatocellular carcinoma
EMT
Epithelial-Mesenchymal Transition

Background

Lung cancer (LCa) is a leading cause of cancer related mortality across the globe. LCa is prevalent in males [1] and asymptomatic during early disease stages. As many as 2 in every 3 cases are at an advanced stage (III or IV) when diagnosed and the 5-year survival rates remain low, particularly for those with metastatic LCa [2]. Improved LCa therapeutics is thus urgently required.
MicroRNAs (miRNAs) regulate many cell processes including differentiation, metabolism and tumorigenesis [36]. Emerging evidence suggests that miRNAs are key players during LCa tumorigenesis [710]. The aberrant expression of miR-425-5p is linked to hepatocellular carcinoma (HCC), gastric cancer (GCa) and colorectal cancer (CRC) [1113]. Here, we report the upregulation of miR-425-5p in LCa and highlight its contribution to LCa development. We further identify PTEN as a novel miR-425-5p target that is inhibited in LCa to promote PTEN/PI3K/AKT signaling.

Methods

Patient specimens

LCa samples (n = 25) and adjacent healthy tissue (at least 2 cm from the resection margin) were collected from the Fourth Affiliated Hospital, Zhejiang University School of Medicine. The study was fully supported by the Institutional Review Board of the Fourth Affiliated Hospital, Zhejiang University School of Medicine (No.2015-0-09). All participants provided consent for sample analysis and anything about their identities will not be included in the data.

LCa cell lines, cell culture and cell transfection

Human lung cancer cell lines A549, NCI-H1299, NCI-H460, HCC827 and Normal Human Lung Epithelial cell line (BEAS-2B) were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). A549 & HCC827 cells were cultured in DMEM plus 10% FBS and pen/strep. NCI-H1299 & NCI-H460 cells were grown in RPMI-1640 plus 10% FBS at 37 °C in 5% CO2. BEAS-2Bs were cultured in Clonetics™ media.
The miR-425-5p mimics and negative control miRNA (NC) were chemically synthesized by Shanghai GenePharma Co., Ltd. (Songjiang, Shanghai, China). Lipofectamine 2000 (Invitrogen, Eugene, OR, USA) was used for transfection according to the manufacturer’s protocol. PI3K activity was assayed as previously described [6]. PI3K inhibitor LY294002 was obtained from Abcam. To analyze the effects of miR-425-5p on PI3K/AKT, indicated Lca cells were cultured in the presence or absence of the drugs for 24 h at 37 °C, the working concentrations of LY294002 were 30 μM. For experiments with LY294002 treatments, indicated Lca cells were pre-treated with LY294002 for 1 h prior to exposure to proteasome inhibitors.

Cell growth assays

LCa viability was assessed using Cell Counting Kit-8 from Shanghai Haling Biotechnology, Co., Ltd. (Shanghai, China) as per the manufacturer’s protocols. Briefly, after incubating the transfected cells for one full day, they were collected after trypsinization and seeded (~ 5000 cells/well) into 96-well plates. Ten microliters of CCK-8 solution were added per well and kept for 2 h at 37 °C. The absorbance of the mixture was estimated in a microplate reader from Bio-Rad Laboratories, Inc. (Hercules, USA) at 450 nm.

Colony formation assay

The colony formation assays were performed as previous [6]. Each group of treated cells (1 × 103 per well) was seeded into 10 cm culture dish, and cultured for 2 weeks. Finally, colonies were stained using 1% crystal violet and the number of cell colonies was counted.

qRT-PCR analysis

Total RNA was isolated by TRIzol® reagent from Invitrogen (Thermo Fisher Scientific, Inc.), and a NanoDrop (NanoDrop Technologies; Thermo Fisher Scientific, Inc.) was used to estimate its quality and concentration. The expression of miR-425-5p was done by reverse transcription using the Mir-X™ miRNA First-Strand Synthesis Kit from TaKaRa Biotechnology, Co., Ltd. (Dalian, China), and quantitative evaluation of the synthesized cDNA was done by quantitative PCR (RT-qPCR) using the Mir-X™ miRNA qRT-PCR TB Green® Kit from TaKaRa Biotechnology. As an endogenous control, the small nuclear RNA U6 normalized the expression of miR-425-5p. The 2−ΔΔCq system was used to evaluate all genes expressions and the primer sequences were shown as follows: miR-425-5p (forward: 5′- GGGGAGTTAGGATTAGGTC-3′, reverse: 5′- TGCGTGTCGTGGAGTC-3′), U6 (forward: 5′-CTCGCT TCGGCAGCACA-3′, reverse: 5′-AAC GCT TCA CGA ATT TGC GT-3′), PTEN (forward: 5′- TGGATTCGACTTAGACTTGACC − 3′, reverse: 5′- AGGATATTGTGCAACTCTGCAA -3′), GAPDH (forward: 5′-CATCACCATCTTCCAGGAGCG-3′, reverse: 5’TGACCTTGCCCACAGCCTT-3′).

Dual luciferase assays

The design and synthesis of PTEN fragments containing binding sites for WT (wild-type) and MUT (mutant) on miR-425-5p was done by Shanghai GenePharma. These were cloned into the Target Expression Vector pmirGLO Dual-luciferase from Promega Corporation (WI, USA) to get the reporter plasmids WT-PTEN and MUT-PTEN. One night prior to transfection, seeding of cells (60–70% confluence) was done in plates with 24-wells. Transfection of these cells was done with reporter plasmids harboring WT or MUT in the presence of miR-NC or miR-425-5p mimic. Post 48 h of transfection, luciferase activity of the cells was estimated as per instructions using the Dual-Luciferase Reporter Assay System from Promega Corporation (Promega, Fitchburg, WI, USA). The data normalization was done by the activity of Renilla luciferase.

WB

Cell lysates (RIPA lysates) were resolved on SDS page and transferred to PVDF membranes. Membranes were blocked for 1 h in 5% milk plus TBST, incubated with primary antibodies against PTEN (dilution, 1:5000; cat. no. ab170941; Abcam), PI3K (dilution, 1:8000; cat. no. ab32089; Abcam), p-AKT (dilution, 1:8000; cat. no. ab81283; Abcam), AKT (dilution, 1:8000; cat. no. ab32505; Abcam), p-AKT (dilution, 1:8000; cat. no. ab81283; Abcam), ACTIN (dilution, 1:8000; cat. no. ab8226; Abcam) at 4 °C overnights, and labeled with HRP-conjugated secondary’s for 2 h at room temperature. Bands were visualized using chemiluminescent HRP Substrate and analyzed using Image Lab TM Software.

Statistical analyses

Data analysis was performed using SPSS 19.0. Treatment groups were compared using a one-way ANOVA. P-values < 0.05 were taken as significant. Experiments were performed on at least three occasions. Data represent the mean ± SD.

Results

miR-425-5p is upregulated in LCa

We compared miR-425-5p levels in 25 paired LCa and normal lung tissue samples by qRT-PCR analysis. miR-425-5p was upregulated in LCa specimens (Fig. 1a) and expressed to high levels in A549, NCI-H1299, NCI-H460, and HCC827 cells compared to normal human lung epithelial cell line (BEAS-2B) (Fig. 1b) consistent with previous findings in other cancer types. Previous results indicated that miR-425-5p is up-regulated in LCa.

miR-425-5p enhances proliferation and inhibits apoptosis in LCa cells

To dissect the role of miR-425-5p in LCa, its expression was manipulated using miR-425-5p mimics. Figure 2a-c shows that miR-425-5p upregulation enhanced cell survival, meanwhile enhanced cell colony formation ability (Fig. 2d and e). Taken together, above results indicated miR-425-5p is thus an oncogene in LCa cells.

miR-425-5p targets PTEN

From TargetScan 7, PTEN was identified as a predicted miR-425-5p target (Fig. 3a). In PTEN 3′-UTR reporter assays, miR-425-5p suppressed WT PTEN expression (Fig. 3b-c) but had little effect on mutated PTEN 3′-UTR fragments (Fig. 3b-c). The levels of PTEN were lower in cells transfected with miR-425-5p mimics (Fig. 3d-e). MiR-425-5p also negatively related PTEN mRNA levels in LCa tissue (P = 0.035, R2 = 0.178, Fig. 3f). These data implicate PTEN as a cellular target of miR-425-5p.

miR-425-5p promotes LCa via PTEN

To define whether miR-425-5p regulate PTEN in Lca, we firstly overexpression PTEN in LCa (Fig. 4a). WB analysis demonstrated that miR-425-5p reduces PTEN levels which could be recovered by exogenous expression (Fig. 4b). Cell viability assays showed that miR-425-5p enhances LCa proliferation which could be reversed by PTEN transfection (Fig. 4c-d), suggesting miR-425-5p mediates its activities via PTEN. This indicates that miR-425-5p targets PTEN to mediate its pro-tumor effects.

miR-425-5p activates PTEN/PI3K/AKT signaling

It has been reported PTEN/PI3K/AKT signaling was closely related to cell proliferation and apoptosis [1418]. Next, we explored the effect of miRNA-425-5p on PTEN/PI3K/AKT signaling. As shown in Fig. 5a, in comparison to NC groups, PTEN was down regulated in response to miR-425-5p mimics, whilst PI3K and p-AKT levels increased. In addition, NSCLC cells were treated with the PI3K/Akt inhibitor LY294002 or LY294002 + miR-425-5p mimics mimic (Fig. 5b), Kinase activity assays further showed that PI3K activity in NSCLC transfected with LY294002 was significantly lower than that transfected with mimic control (P < 0.01), and PI3K activity in NSCLC cells transfected with both LY294002 and miR-425-5p mimic was significantly higher than that transfected with LY294002 (P < 0.01). Take together; this implicates PTEN/PI3K/AKT signaling in the pro-tumorigenic effects of miR-425-5p.

Discussion

The poor prognosis of LCa highlights the need for urgent therapeutic strategies. miRNAs are novel targets for cancer therapies and their dysregulation occurs in LCa tissue [1922]. Duan et al. showed that miR-203 binds to ZEB2 to suppress EMT [23], Yuan et al. showed that miR-30a inhibits EYA2 migration and invasion [24], and Li et al. showed that miR-1304 inhibits LCa cell division through heme oxygenase-1 [25]. The cellular roles of miR-425-5p in LCa are poorly understood. In the present work, we further explore the underlying mechanisms of miR-425-5p-induced LCa cell progression.
In the present study, we confirmed that miR-425-5p is overexpressed in LCa cell lines and tissues implicating a role in LCa tumorigenesis. Upregulating miR-425-5p levels enhanced the cell survival and colony formation ability of LCa cells in vitro, implicating it as a novel LCa oncogene. In the mechanism, using the algorithms TargetScan website tools, we identified PTEN as the potential target of miR-425-5p. Furthermore, we performed Luciferase reporter assays and the results showed that miR-425-5p may directly target PTEN-3’UTR. The result of qRT-PCR and western blot also confirmed that over-expression of miR-425-5p could suppress the expression level of PTEN. All the above suggested that PTEN was a potential functional target of miR-425-5p. Moreover, MiR-425-5p also negatively related PTEN mRNA levels in LCa tissue. Rescue experiment indicated that exogenous PTEN expression inhibited the pro-cancer effects of miR-425-5p. PTEN was downregulated in LCa tissue. PTEN is a tumor suppressor with well-characterized phosphatase activity [26]. PI3K/AKT promotes cell cycle progression, inhibits apoptosis, and is known to be overactive in a multitude of human cancers [27, 28]. PTEN can suppress PI3K/AKT signaling and thus displays anti-cancer effects [29]. Upon assessment of the molecular mechanisms of miR-425-5p in LCa cells, its pro-cancer effects were found to be mediated through manipulation of the PTEN/PI3K/AKT signaling axis.

Conclusion

In conclusion, we highlight miR-425-5p as an oncogene in LCa that promotes an oncogene phenotype by inhibiting PTEN. These findings enhance our knowledge of the role of miR-425-5p and reveal new therapeutic strategies for the diagnosis and treatment of LCa. Angiogenesis and metastasis biological experiments will clarify the functions and roles of miR-425-5p in LCa.

Supplementary information

Supplementary information accompanies this paper at https://​doi.​org/​10.​1186/​s12890-020-01261-0.

Acknowledgements

Not applicable.
Ethics approval for this study was obtained from the Fourth Affiliated Hospital, Zhejiang University School of Medicine (No.2015-0-09). All patients gave written informed consent for participation in the study.
Not applicable.

Competing interests

All authors declare no conflicts of interest.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creativecommons.​org/​licenses/​by/​4.​0/​. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Anhänge

Supplementary information

Additional file 1: Supplement Figure S1. Uncropped images of blots and gels related to Fig. 3. Supplement Figure S2. Uncropped images of blots and gels related to Fig. 4. Supplement Figure S3. Uncropped images of blots and gels related to Fig. 5. Table S1. The raw data of all colony formation experiments.
Literatur
1.
Zurück zum Zitat Chen W, Zheng R, Zuo T, Zeng H, Zhang S, He J. National cancer incidence and mortality in China, 2012. Chin J Cancer Res. 2016;28(1):1–11.PubMedPubMedCentral Chen W, Zheng R, Zuo T, Zeng H, Zhang S, He J. National cancer incidence and mortality in China, 2012. Chin J Cancer Res. 2016;28(1):1–11.PubMedPubMedCentral
2.
Zurück zum Zitat Aberle DR, Berg CD, Black WC, et al. The National Lung Screening Trial: overview and study design. Radiology. 2011;258(1):243–53.PubMedCrossRef Aberle DR, Berg CD, Black WC, et al. The National Lung Screening Trial: overview and study design. Radiology. 2011;258(1):243–53.PubMedCrossRef
3.
Zurück zum Zitat Ni JS, Zheng H, Huang ZP, et al. MicroRNA-197-3p acts as a prognostic marker and inhibits cell invasion in hepatocellular carcinoma. Oncol Lett. 2019;17(2):2317–27.PubMed Ni JS, Zheng H, Huang ZP, et al. MicroRNA-197-3p acts as a prognostic marker and inhibits cell invasion in hepatocellular carcinoma. Oncol Lett. 2019;17(2):2317–27.PubMed
4.
Zurück zum Zitat Zhang TJ, Wang YX, Yang DQ, et al. Down-regulation of miR-186 correlates with poor survival in de novo acute myeloid leukemia. Clin Lab. 2016;62(1–2):113–20.PubMed Zhang TJ, Wang YX, Yang DQ, et al. Down-regulation of miR-186 correlates with poor survival in de novo acute myeloid leukemia. Clin Lab. 2016;62(1–2):113–20.PubMed
5.
Zurück zum Zitat Wang B, Teng Y, Liu Q. MicroRNA-153 regulates NRF2 expression and is associated with breast carcinogenesis. Clin Lab. 2016;62(1–2):39–47.PubMed Wang B, Teng Y, Liu Q. MicroRNA-153 regulates NRF2 expression and is associated with breast carcinogenesis. Clin Lab. 2016;62(1–2):39–47.PubMed
6.
Zurück zum Zitat Lin H, Huang ZP, Liu J, et al. MiR-494-3p promotes PI3K/AKT pathway hyperactivation and human hepatocellular carcinoma progression by targeting PTEN. Sci Rep. 2018;8(1):10461.PubMedPubMedCentralCrossRef Lin H, Huang ZP, Liu J, et al. MiR-494-3p promotes PI3K/AKT pathway hyperactivation and human hepatocellular carcinoma progression by targeting PTEN. Sci Rep. 2018;8(1):10461.PubMedPubMedCentralCrossRef
7.
Zurück zum Zitat Yang J, Li J, Le Y, Zhou C, Zhang S, Gong Z. PFKL/miR-128 axis regulates glycolysis by inhibiting AKT phosphorylation and predicts poor survival in lung cancer. Am J Cancer Res. 2016;6(2):473–85.PubMedPubMedCentral Yang J, Li J, Le Y, Zhou C, Zhang S, Gong Z. PFKL/miR-128 axis regulates glycolysis by inhibiting AKT phosphorylation and predicts poor survival in lung cancer. Am J Cancer Res. 2016;6(2):473–85.PubMedPubMedCentral
8.
Zurück zum Zitat Wang R, Chen X, Xu T, et al. MiR-326 regulates cell proliferation and migration in lung cancer by targeting phox2a and is regulated by HOTAIR. Am J Cancer Res. 2016;6(2):173–86.PubMedPubMedCentral Wang R, Chen X, Xu T, et al. MiR-326 regulates cell proliferation and migration in lung cancer by targeting phox2a and is regulated by HOTAIR. Am J Cancer Res. 2016;6(2):173–86.PubMedPubMedCentral
9.
Zurück zum Zitat Qin Q, Wei F, Zhang J, Wang X, Li B. miR-134 inhibits non-small cell lung cancer growth by targeting the epidermal growth factor receptor. J Cell Mol Med. 2016;20(10):1974–83.PubMedPubMedCentralCrossRef Qin Q, Wei F, Zhang J, Wang X, Li B. miR-134 inhibits non-small cell lung cancer growth by targeting the epidermal growth factor receptor. J Cell Mol Med. 2016;20(10):1974–83.PubMedPubMedCentralCrossRef
10.
Zurück zum Zitat Hu H, Xu Z, Li C, et al. MiR-145 and miR-203 represses TGF-beta-induced epithelial-mesenchymal transition and invasion by inhibiting SMAD3 in non-small cell lung cancer cells. Lung Cancer. 2016;97:87–94.PubMedCrossRef Hu H, Xu Z, Li C, et al. MiR-145 and miR-203 represses TGF-beta-induced epithelial-mesenchymal transition and invasion by inhibiting SMAD3 in non-small cell lung cancer cells. Lung Cancer. 2016;97:87–94.PubMedCrossRef
11.
Zurück zum Zitat Fang F, Song T, Zhang T, Cui Y, Zhang G, Xiong Q. MiR-425-5p promotes invasion and metastasis of hepatocellular carcinoma cells through SCAI-mediated dysregulation of multiple signaling pathways. Oncotarget. 2017;8(19):31745–57.PubMedPubMedCentralCrossRef Fang F, Song T, Zhang T, Cui Y, Zhang G, Xiong Q. MiR-425-5p promotes invasion and metastasis of hepatocellular carcinoma cells through SCAI-mediated dysregulation of multiple signaling pathways. Oncotarget. 2017;8(19):31745–57.PubMedPubMedCentralCrossRef
12.
Zurück zum Zitat Cristobal I, Madoz-Gurpide J, Rojo F, Garcia-Foncillas J. Potential therapeutic value of miR-425-5p in metastatic colorectal cancer. J Cell Mol Med. 2016;20(11):2213–4.PubMedPubMedCentralCrossRef Cristobal I, Madoz-Gurpide J, Rojo F, Garcia-Foncillas J. Potential therapeutic value of miR-425-5p in metastatic colorectal cancer. J Cell Mol Med. 2016;20(11):2213–4.PubMedPubMedCentralCrossRef
13.
Zurück zum Zitat Zhang Z, Wen M, Guo J, et al. Clinical value of miR-425-5p detection and its association with cell proliferation and apoptosis of gastric cancer. Pathol Res Pract. 2017;213(8):929–37.PubMedCrossRef Zhang Z, Wen M, Guo J, et al. Clinical value of miR-425-5p detection and its association with cell proliferation and apoptosis of gastric cancer. Pathol Res Pract. 2017;213(8):929–37.PubMedCrossRef
14.
Zurück zum Zitat Huang Z, Xing S, Liu M, Deng W, Wang Y, Huang Z, Huang Y, Huang X, Wu C, Guo X, Pan X, Jiang J, Feng F, Li T. miR-26a-5p enhances cells proliferation, invasion and apoptosis resistance of fibroblast-like synoviocytes in rheumatoid arthritis by regulating PTEN/PI3K/AKT pathway. Biosci Rep. 2019;39:7. Huang Z, Xing S, Liu M, Deng W, Wang Y, Huang Z, Huang Y, Huang X, Wu C, Guo X, Pan X, Jiang J, Feng F, Li T. miR-26a-5p enhances cells proliferation, invasion and apoptosis resistance of fibroblast-like synoviocytes in rheumatoid arthritis by regulating PTEN/PI3K/AKT pathway. Biosci Rep. 2019;39:7.
15.
Zurück zum Zitat Meng J, Liu GJ, Song JY, Chen L, Wang AH, Gao XX, Wang ZJ. Preliminary results indicate resveratrol affects proliferation and apoptosis of leukemia cells by regulating PTEN/PI3K/AKT pathway. Eur Rev Med Pharmacol Sci. 2019;23(10):4285–92.PubMed Meng J, Liu GJ, Song JY, Chen L, Wang AH, Gao XX, Wang ZJ. Preliminary results indicate resveratrol affects proliferation and apoptosis of leukemia cells by regulating PTEN/PI3K/AKT pathway. Eur Rev Med Pharmacol Sci. 2019;23(10):4285–92.PubMed
16.
Zurück zum Zitat Liu HY, Zhang YY, Zhu BL, Feng FZ, Yan H, Zhang HY, Zhou B. miR-21 regulates the proliferation and apoptosis of ovarian cancer cells through PTEN/PI3K/AKT. Eur Rev Med Pharmacol Sci. 2019;23(10):4149–55.PubMed Liu HY, Zhang YY, Zhu BL, Feng FZ, Yan H, Zhang HY, Zhou B. miR-21 regulates the proliferation and apoptosis of ovarian cancer cells through PTEN/PI3K/AKT. Eur Rev Med Pharmacol Sci. 2019;23(10):4149–55.PubMed
17.
Zurück zum Zitat Yu G, Wang C, Song X, Liu S, Zhang Y, Fan L, Yang Y, Huang Y, Song J. Formaldehyde induces the apoptosis of BMCs of BALB/c mice via the PTEN/PI3K/Akt signal transduction pathway. Mol Med Rep. 2019;20(1):341–9.PubMedPubMedCentral Yu G, Wang C, Song X, Liu S, Zhang Y, Fan L, Yang Y, Huang Y, Song J. Formaldehyde induces the apoptosis of BMCs of BALB/c mice via the PTEN/PI3K/Akt signal transduction pathway. Mol Med Rep. 2019;20(1):341–9.PubMedPubMedCentral
18.
Zurück zum Zitat Sun XH, Wang X, Zhang Y, Hui J. Exosomes of bone-marrow stromal cells inhibit cardiomyocyte apoptosis under ischemic and hypoxic conditions via miR-486-5p targeting the PTEN/PI3K/AKT signaling pathway. Thromb Res. 2019;177:23–32.PubMedCrossRef Sun XH, Wang X, Zhang Y, Hui J. Exosomes of bone-marrow stromal cells inhibit cardiomyocyte apoptosis under ischemic and hypoxic conditions via miR-486-5p targeting the PTEN/PI3K/AKT signaling pathway. Thromb Res. 2019;177:23–32.PubMedCrossRef
19.
Zurück zum Zitat Mou X, Liu S. MiR-485 inhibits metastasis and EMT of lung adenocarcinoma by targeting Flot2. Biochem Biophys Res Commun. 2016;477(4):521–6.PubMedCrossRef Mou X, Liu S. MiR-485 inhibits metastasis and EMT of lung adenocarcinoma by targeting Flot2. Biochem Biophys Res Commun. 2016;477(4):521–6.PubMedCrossRef
20.
Zurück zum Zitat Su TJ, Ku WH, Chen HY, et al. Oncogenic miR-137 contributes to cisplatin resistance via repressing CASP3 in lung adenocarcinoma. Am J Cancer Res. 2016;6(6):1317–30.PubMedPubMedCentral Su TJ, Ku WH, Chen HY, et al. Oncogenic miR-137 contributes to cisplatin resistance via repressing CASP3 in lung adenocarcinoma. Am J Cancer Res. 2016;6(6):1317–30.PubMedPubMedCentral
21.
Zurück zum Zitat Liu Y, Wang F, Xu P. miR-590 accelerates lung adenocarcinoma migration and invasion through directly suppressing functional target OLFM4. Biomed Pharmacother. 2017;86:466–74.PubMedCrossRef Liu Y, Wang F, Xu P. miR-590 accelerates lung adenocarcinoma migration and invasion through directly suppressing functional target OLFM4. Biomed Pharmacother. 2017;86:466–74.PubMedCrossRef
22.
Zurück zum Zitat Yang L, Luo P, Song Q, Fei X. DNMT1/miR-200a/GOLM1 signaling pathway regulates lung adenocarcinoma cells proliferation. Biomed Pharmacother. 2018;99:839–47.PubMedCrossRef Yang L, Luo P, Song Q, Fei X. DNMT1/miR-200a/GOLM1 signaling pathway regulates lung adenocarcinoma cells proliferation. Biomed Pharmacother. 2018;99:839–47.PubMedCrossRef
23.
Zurück zum Zitat Duan X, Fu Z, Gao L, et al. Direct interaction between miR-203 and ZEB2 suppresses epithelial-mesenchymal transition signaling and reduces lung adenocarcinoma chemoresistance. Acta Biochim Biophys Sin Shanghai. 2016;48(11):1042–9.PubMedCrossRef Duan X, Fu Z, Gao L, et al. Direct interaction between miR-203 and ZEB2 suppresses epithelial-mesenchymal transition signaling and reduces lung adenocarcinoma chemoresistance. Acta Biochim Biophys Sin Shanghai. 2016;48(11):1042–9.PubMedCrossRef
24.
Zurück zum Zitat Yuan Y, Zheng S, Li Q, et al. Overexpression of miR-30a in lung adenocarcinoma A549 cell line inhibits migration and invasion via targeting EYA2. Acta Biochim Biophys Sin Shanghai. 2016;48(3):220–8.PubMedPubMedCentralCrossRef Yuan Y, Zheng S, Li Q, et al. Overexpression of miR-30a in lung adenocarcinoma A549 cell line inhibits migration and invasion via targeting EYA2. Acta Biochim Biophys Sin Shanghai. 2016;48(3):220–8.PubMedPubMedCentralCrossRef
25.
Zurück zum Zitat Li CG, Pu MF, Li CZ, et al. MicroRNA-1304 suppresses human non-small cell lung cancer cell growth in vitro by targeting heme oxygenase-1. Acta Pharmacol Sin. 2017;38(1):110–9.PubMedCrossRef Li CG, Pu MF, Li CZ, et al. MicroRNA-1304 suppresses human non-small cell lung cancer cell growth in vitro by targeting heme oxygenase-1. Acta Pharmacol Sin. 2017;38(1):110–9.PubMedCrossRef
26.
Zurück zum Zitat Li DM, Sun H. PTEN/MMAC1/TEP1 suppresses the tumorigenicity and induces G1 cell cycle arrest in human glioblastoma cells. Proc Natl Acad Sci U S A. 1998;95(26):15406–11.PubMedPubMedCentralCrossRef Li DM, Sun H. PTEN/MMAC1/TEP1 suppresses the tumorigenicity and induces G1 cell cycle arrest in human glioblastoma cells. Proc Natl Acad Sci U S A. 1998;95(26):15406–11.PubMedPubMedCentralCrossRef
27.
Zurück zum Zitat Bellacosa A, Chan TO, Ahmed NN, et al. Akt activation by growth factors is a multiple-step process: the role of the PH domain. Oncogene. 1998;17(3):313–25.PubMedCrossRef Bellacosa A, Chan TO, Ahmed NN, et al. Akt activation by growth factors is a multiple-step process: the role of the PH domain. Oncogene. 1998;17(3):313–25.PubMedCrossRef
28.
Zurück zum Zitat Li JW, Wang XY, Zhang X, Gao L, Wang LF, Yin XH. Epicatechin protects against myocardial ischemiainduced cardiac injury via activation of the PTEN/PI3K/AKT pathway. Mol Med Rep. 2018;17(6):8300–8.PubMedPubMedCentral Li JW, Wang XY, Zhang X, Gao L, Wang LF, Yin XH. Epicatechin protects against myocardial ischemiainduced cardiac injury via activation of the PTEN/PI3K/AKT pathway. Mol Med Rep. 2018;17(6):8300–8.PubMedPubMedCentral
29.
Zurück zum Zitat Qin Y, Huo Z, Song X, Chen X, Tian X, Wang X. Mir-106a regulates cell proliferation and apoptosis of colon cancer cells through targeting the PTEN/PI3K/AKT signaling pathway. Oncol Lett. 2018;15(3):3197–201.PubMed Qin Y, Huo Z, Song X, Chen X, Tian X, Wang X. Mir-106a regulates cell proliferation and apoptosis of colon cancer cells through targeting the PTEN/PI3K/AKT signaling pathway. Oncol Lett. 2018;15(3):3197–201.PubMed
Metadaten
Titel
miRNA-425-5p enhances lung cancer growth via the PTEN/PI3K/AKT signaling axis
verfasst von
Jin-shan Zhou
Ze-shan Yang
Si-yang Cheng
Jiang-hao Yu
Chao-Jun Huang
Qiang Feng
Publikationsdatum
01.12.2020
Verlag
BioMed Central
Erschienen in
BMC Pulmonary Medicine / Ausgabe 1/2020
Elektronische ISSN: 1471-2466
DOI
https://doi.org/10.1186/s12890-020-01261-0

Weitere Artikel der Ausgabe 1/2020

BMC Pulmonary Medicine 1/2020 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Reizdarmsyndrom: Diäten wirksamer als Medikamente

29.04.2024 Reizdarmsyndrom Nachrichten

Bei Reizdarmsyndrom scheinen Diäten, wie etwa die FODMAP-arme oder die kohlenhydratreduzierte Ernährung, effektiver als eine medikamentöse Therapie zu sein. Das hat eine Studie aus Schweden ergeben, die die drei Therapieoptionen im direkten Vergleich analysierte.

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.