Background
Lung cancer (LCa) is a leading cause of cancer related mortality across the globe. LCa is prevalent in males [
1] and asymptomatic during early disease stages. As many as 2 in every 3 cases are at an advanced stage (III or IV) when diagnosed and the 5-year survival rates remain low, particularly for those with metastatic LCa [
2]. Improved LCa therapeutics is thus urgently required.
MicroRNAs (miRNAs) regulate many cell processes including differentiation, metabolism and tumorigenesis [
3‐
6]. Emerging evidence suggests that miRNAs are key players during LCa tumorigenesis [
7‐
10]. The aberrant expression of miR-425-5p is linked to hepatocellular carcinoma (HCC), gastric cancer (GCa) and colorectal cancer (CRC) [
11‐
13]. Here, we report the upregulation of miR-425-5p in LCa and highlight its contribution to LCa development. We further identify PTEN as a novel miR-425-5p target that is inhibited in LCa to promote PTEN/PI3K/AKT signaling.
Methods
Patient specimens
LCa samples (n = 25) and adjacent healthy tissue (at least 2 cm from the resection margin) were collected from the Fourth Affiliated Hospital, Zhejiang University School of Medicine. The study was fully supported by the Institutional Review Board of the Fourth Affiliated Hospital, Zhejiang University School of Medicine (No.2015-0-09). All participants provided consent for sample analysis and anything about their identities will not be included in the data.
LCa cell lines, cell culture and cell transfection
Human lung cancer cell lines A549, NCI-H1299, NCI-H460, HCC827 and Normal Human Lung Epithelial cell line (BEAS-2B) were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). A549 & HCC827 cells were cultured in DMEM plus 10% FBS and pen/strep. NCI-H1299 & NCI-H460 cells were grown in RPMI-1640 plus 10% FBS at 37 °C in 5% CO2. BEAS-2Bs were cultured in Clonetics™ media.
The miR-425-5p mimics and negative control miRNA (NC) were chemically synthesized by Shanghai GenePharma Co., Ltd. (Songjiang, Shanghai, China). Lipofectamine 2000 (Invitrogen, Eugene, OR, USA) was used for transfection according to the manufacturer’s protocol. PI3K activity was assayed as previously described [
6]. PI3K inhibitor LY294002 was obtained from Abcam. To analyze the effects of miR-425-5p on PI3K/AKT, indicated Lca cells were cultured in the presence or absence of the drugs for 24 h at 37 °C, the working concentrations of LY294002 were 30 μM. For experiments with LY294002 treatments, indicated Lca cells were pre-treated with LY294002 for 1 h prior to exposure to proteasome inhibitors.
Cell growth assays
LCa viability was assessed using Cell Counting Kit-8 from Shanghai Haling Biotechnology, Co., Ltd. (Shanghai, China) as per the manufacturer’s protocols. Briefly, after incubating the transfected cells for one full day, they were collected after trypsinization and seeded (~ 5000 cells/well) into 96-well plates. Ten microliters of CCK-8 solution were added per well and kept for 2 h at 37 °C. The absorbance of the mixture was estimated in a microplate reader from Bio-Rad Laboratories, Inc. (Hercules, USA) at 450 nm.
The colony formation assays were performed as previous [
6]. Each group of treated cells (1 × 10
3 per well) was seeded into 10 cm culture dish, and cultured for 2 weeks. Finally, colonies were stained using 1% crystal violet and the number of cell colonies was counted.
qRT-PCR analysis
Total RNA was isolated by TRIzol® reagent from Invitrogen (Thermo Fisher Scientific, Inc.), and a NanoDrop (NanoDrop Technologies; Thermo Fisher Scientific, Inc.) was used to estimate its quality and concentration. The expression of miR-425-5p was done by reverse transcription using the Mir-X™ miRNA First-Strand Synthesis Kit from TaKaRa Biotechnology, Co., Ltd. (Dalian, China), and quantitative evaluation of the synthesized cDNA was done by quantitative PCR (RT-qPCR) using the Mir-X™ miRNA qRT-PCR TB Green® Kit from TaKaRa Biotechnology. As an endogenous control, the small nuclear RNA U6 normalized the expression of miR-425-5p. The 2−ΔΔCq system was used to evaluate all genes expressions and the primer sequences were shown as follows: miR-425-5p (forward: 5′- GGGGAGTTAGGATTAGGTC-3′, reverse: 5′- TGCGTGTCGTGGAGTC-3′), U6 (forward: 5′-CTCGCT TCGGCAGCACA-3′, reverse: 5′-AAC GCT TCA CGA ATT TGC GT-3′), PTEN (forward: 5′- TGGATTCGACTTAGACTTGACC − 3′, reverse: 5′- AGGATATTGTGCAACTCTGCAA -3′), GAPDH (forward: 5′-CATCACCATCTTCCAGGAGCG-3′, reverse: 5’TGACCTTGCCCACAGCCTT-3′).
Dual luciferase assays
The design and synthesis of PTEN fragments containing binding sites for WT (wild-type) and MUT (mutant) on miR-425-5p was done by Shanghai GenePharma. These were cloned into the Target Expression Vector pmirGLO Dual-luciferase from Promega Corporation (WI, USA) to get the reporter plasmids WT-PTEN and MUT-PTEN. One night prior to transfection, seeding of cells (60–70% confluence) was done in plates with 24-wells. Transfection of these cells was done with reporter plasmids harboring WT or MUT in the presence of miR-NC or miR-425-5p mimic. Post 48 h of transfection, luciferase activity of the cells was estimated as per instructions using the Dual-Luciferase Reporter Assay System from Promega Corporation (Promega, Fitchburg, WI, USA). The data normalization was done by the activity of Renilla luciferase.
WB
Cell lysates (RIPA lysates) were resolved on SDS page and transferred to PVDF membranes. Membranes were blocked for 1 h in 5% milk plus TBST, incubated with primary antibodies against PTEN (dilution, 1:5000; cat. no. ab170941; Abcam), PI3K (dilution, 1:8000; cat. no. ab32089; Abcam), p-AKT (dilution, 1:8000; cat. no. ab81283; Abcam), AKT (dilution, 1:8000; cat. no. ab32505; Abcam), p-AKT (dilution, 1:8000; cat. no. ab81283; Abcam), ACTIN (dilution, 1:8000; cat. no. ab8226; Abcam) at 4 °C overnights, and labeled with HRP-conjugated secondary’s for 2 h at room temperature. Bands were visualized using chemiluminescent HRP Substrate and analyzed using Image Lab TM Software.
Statistical analyses
Data analysis was performed using SPSS 19.0. Treatment groups were compared using a one-way ANOVA. P-values < 0.05 were taken as significant. Experiments were performed on at least three occasions. Data represent the mean ± SD.
Discussion
The poor prognosis of LCa highlights the need for urgent therapeutic strategies. miRNAs are novel targets for cancer therapies and their dysregulation occurs in LCa tissue [
19‐
22]. Duan et al. showed that miR-203 binds to ZEB2 to suppress EMT [
23], Yuan et al. showed that miR-30a inhibits EYA2 migration and invasion [
24], and Li et al. showed that miR-1304 inhibits LCa cell division through heme oxygenase-1 [
25]. The cellular roles of miR-425-5p in LCa are poorly understood. In the present work, we further explore the underlying mechanisms of miR-425-5p-induced LCa cell progression.
In the present study, we confirmed that miR-425-5p is overexpressed in LCa cell lines and tissues implicating a role in LCa tumorigenesis. Upregulating miR-425-5p levels enhanced the cell survival and colony formation ability of LCa cells in vitro, implicating it as a novel LCa oncogene. In the mechanism, using the algorithms TargetScan website tools, we identified PTEN as the potential target of miR-425-5p. Furthermore, we performed Luciferase reporter assays and the results showed that miR-425-5p may directly target PTEN-3’UTR. The result of qRT-PCR and western blot also confirmed that over-expression of miR-425-5p could suppress the expression level of PTEN. All the above suggested that PTEN was a potential functional target of miR-425-5p. Moreover, MiR-425-5p also negatively related PTEN mRNA levels in LCa tissue. Rescue experiment indicated that exogenous PTEN expression inhibited the pro-cancer effects of miR-425-5p. PTEN was downregulated in LCa tissue. PTEN is a tumor suppressor with well-characterized phosphatase activity [
26]. PI3K/AKT promotes cell cycle progression, inhibits apoptosis, and is known to be overactive in a multitude of human cancers [
27,
28]. PTEN can suppress PI3K/AKT signaling and thus displays anti-cancer effects [
29]. Upon assessment of the molecular mechanisms of miR-425-5p in LCa cells, its pro-cancer effects were found to be mediated through manipulation of the PTEN/PI3K/AKT signaling axis.
Conclusion
In conclusion, we highlight miR-425-5p as an oncogene in LCa that promotes an oncogene phenotype by inhibiting PTEN. These findings enhance our knowledge of the role of miR-425-5p and reveal new therapeutic strategies for the diagnosis and treatment of LCa. Angiogenesis and metastasis biological experiments will clarify the functions and roles of miR-425-5p in LCa.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.