Background
Coronary heart disease (CHD) is a common and frequently-occurring disease [
1]. There are more than 3.8 million men and 3.4 million women die of the CHD each year and have a tendency to increase in recent years globally [
2]. In clinical, Dan-Lou prescription (DLP) is given to patients with angina pectoris, and has advantages in the improvement of sputum, the lip empurples, etc. [
3‐
5]. Researchers indicate that the pharmacological effects are attributed to increasing coronary flow [
6], antagonizing platelet aggregation [
7], thrombosis formation [
8], hypertention [
9], hyperglycemia and hyperlipidemia [
10].
DLP is derived from the traditional Chinese medicine formula Gualou Xiebai Banxia Tang which is recorded in the Synopsis of Prescriptions of the Golden Chamber (Jin-Gui-Yao-Lue) and has been used for about 2000 years in China. DLP is consisted of 10 herbs, including
Trichosanthes kirilowii Maxim. (Cucurbitaceae),
Allium macrostemon Bunge. (Liliaceae),
Pueraria lobata (Willd.) Ohwi (Leguminosae),
Ligusticum chuanxiong Hort. (Umbelliferae),
Salvia miltiorrhiza Bunge. (Labiatae),
Paeonia lactiflora Pall. (Ranunculaceae),
Alisma plantago-aquatica Linn. (Alismataceae),
Astragalus membranaceus (Fisch.) Bunge. (Leguminosae),
Davallia mariesii Moore ex Bak. (Davalliaceae), and
Curcuma aromatica Salisb. (Zingiberaceae). To further investigate the chemical composition and pharmacological mechanism, numerous detection methods have been established such as liquid chromatography-mass spectrometry (LC-MS), gas chromatography–mass spectrometry (GC-MS), high performance liquid chromatography-chemiluminescence detection (HPLC-CL), high performance liquid chromatography-diode-array detector (HPLC-DAD) and ultra high performance liquid chromatography/diode-array detector/quadrupole time-of flight tandem mass spectrometry (UPLC-DAD-QTOF) [
7,
11‐
14]. In this study, eight highest level ingredients of DLP ethanol extract (EEDL), gallic acid, salvianic acid, puerarin, daidzin, paeoniflorin, salvianolic acid B, cryptotanshinone and tanshinone IIA, were chosen as marker substances to investigate pharmacological mechanism.
More and more studies show that inflammation plays a vital role in CHD [
15]. Atherosclerosis acts as the main cause of CHD and is formerly considered as a bland lipid storage disease. However, atherosclerosis is actually a process of inflammation invasion. In the pathological processes of atherosclerosis, all stages such as initiation, growth and complication of atherosclerotic plaque involve an inflammatory response [
16]. The circulating inflammatory markers such as C-reactive protein (CRP), serum amyloid A (SAA), interleukin (IL)-6 and IL-1 receptor commonly accompany with acute coronary syndromes [
17]. Pharmacological studies demonstrate that many active components of DLP such as gallic acid [
18], puerarin [
19], paeoniflorin [
20], cryptotanshinone [
21] and tanshinone IIA [
22] have anti-inflammatory effects by antagonizing over-expression cyclooxygenase (COX)-2, inducible nitric oxide synthase (iNOS), IL-6, etc. In detail, gallic acid inhibits lipopolysaccharide (LPS)-induced inflammation in nuclear transcription factor (NF)-κB transgenic mice [
18], cryptotanshinone suppresses LPS-induced mice cytokines secretion via inhibition of NF-κB [
21], tanshinone IIA reduces LPS-induced mice acute lung injury via NF-κB inhibition [
22]. For these facts, propose new strategies from anti-inflammation may be a new viewpoint for the prediction, prevention, and treatment of DLP on CHD.
The exploration of EEDL on inflammatory response is the most fundamental research to illustrate the pharmacological mechanisms. LPS-induced inflammatory models in mice and macrophages are widely used to preliminarily screen anti-inflammatory drugs [
23]. In the present study, we designed inflammatory models induced by LPS
in vivo and
in vitro to investigate the anti-inflammation of EEDL and the potential mechanisms.
Methods
Reagents
The drug powder of DLP was provided by Jilin Connell Medicine Co., Ltd (Jilin, China). Dulbecco’s modified Eagle’s medium-high glucose (DMEM), 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT), aspirin and LPS from Escherichia coli 0111:B4 were obtained from Sigma-Aldrich Co. (St. Louis, USA). IL-6 Mouse ELISA Kit was obtained from eBioscience (San Diedo, USA). Mammalian Cell Lysis Kit and UNIQ-10 column Trizol total RNA extraction kit were obtained from Sangon Biological Engineering Technology & Services Co., Ltd (Shanghai, China). Improm-II Reverse Transcription System was purchased from Promega Corporation (Madison, USA). FastStart Universal SYBR Green Master (ROX) kit was purchased from Roche (Mannheim, Germany). BCA Protein Assay Kit was purchased from Thermo Fisher (Rochford, USA). Dexamethasone injection was obtained from Shanghai General Pharmaceutical Co., Ltd. (Shanghai, China). 4-amino-5-methylamino-2′, 7′-difluorofluorescein diacetate (DAF-FM-DA) was obtained from Invitrogen (Carlsbad, USA). Prostaglandin (PG)E2 EIA monoclonal kit and Mouse Cytokine Array Panel A Array kit were obtained from R&D Systems, Inc. (Minneapoils, USA). Mouse anti-cyclooxygenase (COX)-2 monoclonal antibody was from BD PharMingen (San Diego, USA) and goat anti-Mouse IgG peroxidase conjugate was from Merck (Darmstadt, Germany). BAY 11–7082 and Nuclear and Cytoplasmic Protein Extraction Kit were purchased from Beyotime Institute of Biotechnology (Haimen, China). Antibody for iNOS was purchased from Cell Signaling Technology (Beverly, USA). Goat anti-rabbit IgG peroxidase conjugate was bought from Merck (Darmstadt, Germany). Transcription Factor Assay Kit for nuclear transcription factor (NF)-κB p65 was purchased from Thermo Fisher (Rochford, USA).
The DLP drug powder (50 g) was extracted with 75 % ethanol (500 mL) in an ultrasonic bath for 30 min at room temperature and then filtrated. The extraction process above mentioned was repeated for three times, mixed the filtrates and concentrated to 100 mL under reduced pressure at 60 °C. Finally, the concentrate was lyophilized, sealed and stored lucifugally in 50 mL centrifuge tube at 4 °C for use. The EEDL was dissolved in DMEM to obtain the desired concentrations in experiments.
Quantitative chromatographic analysis
To ensure the consistent results, the constituents of EEDL were analyzed by HPLC using a Waters 2695 system (Waters, New York, USA), which is equipped with a quaternary pump, an autosampler, an online vacuum degasser, and an ultraviolet detector. The chromatographic analyses were performed on a Kromasil C18 Column (250 mm × 4.6 mm, 5 μm, Sweden) at 25 °C. For HPLC analysis, a 5 μL sample was injected into the column with a constant flow rate of 1.0 mL/min. The mobile phase consisted of acetonitrile (A) and water (containing 0.1 % formic acid, v/v, B). The elution was carried out as follows: 10–11 % A at 0–6 min, 11 % A at 6–8 min, 11–18 % A at 8–10 min, 18–33 % A at 10–17 min, 33 % A at 17–20 min, 33–52 % A at 20–21 min, 52–55 % A at 21–25 min, 55–75 % A at 25–26 min, 75–90 % A at 26–35 min, 90 % A at 35–40 min, 90–100 % A at 40–40.1 min. Chromatograms were monitored at a wavelength of 280 nm [
7].
In vivo anti-inflammatory analysis
Animals and acute inflammatory injury
Male ICR mice (18–22 g) were obtained from Beijing HuaFuKang Bio-technology Co., Ltd. They were group-housed in cages at constant humidity (55 ± 5 %), temperature (24 ± 1 °C) and light–dark cycle (on at 7:00 a.m. and off at 7:00 p.m.). All animals were allowed ad libitum water according to the experimental protocols. Studies were performed in accordance with NIH Guide for the Care and Use of Laboratory Animals and protocol was approved by the Ethics Committee of Tianjin University of Traditional Chinese Medicine (TCM-2009-037-E12).
Forty-eight mice were randomly divided into 6 groups (8 mice per group): blank control, LPS (dissolved in sterile pyrogen-free saline solution, 1 mg/kg body weight), LPS + EEDL (0.25, 1 and 4 g/kg); positive control (LPS + dexamethasone injection, 10 mg/kg). Mice were firstly pretreated intraperitoneally (i.p.) with 0.9 % saline, different amount of EEDL and dexamethasone injection, which were dissolved in 0.9 % saline to make a total volume of 200 μL. After drug administration for 30 min, LPS were then i.p. given to mice for 90 min, while blank control mice received only 0.9 % saline. Subsequently, mice were anesthetized with ether and blood samples were collected. Serum was obtained by incubating for 1 h at 37 °C (water bath), and then centrifuged at 3000 rpm for 10 min at 4 °C and stored at −20 °C until use. Simultaneously, the liver tissues were quickly removed, frozen in liquid nitrogen immediately and stored at −80 °C until analysis.
Analysis of IL-6 protein and mRNA expression in liver
The IL-6 level in mice liver was detected according to the manufacturer’s instructions of commercially available ELISA kits. The protein was quantified by BCA method. For total RNA extraction, the mice tissues of liver samples (about 30 mg) were homogenized in 500 μL of Trizol reagent. Real-time RT-PCR was performed according to a previously described method [
23]. The real-time RT-PCR oligonucleotide primers used for mouse IL-6 and β-actin (internal control) were shown in Table
1.
Table 1
Real-time RT-PCR oligonucleotide primers
β-actin | Forward | TGTTACCAACTGGGACGACA | 165 |
(NM_007393.3) | Reverse | GGGGTGTTGAAGGTCTCAAA | |
iNOS | Forward | CACCTTGGAGTTCACCCAGT | 170 |
(NM_010927.3) | Reverse | ACCACTCGTACTTGGGATGC | |
COX-2 | Forward | TGAGTACCGCAAACGCTTCTC | 151 |
(NM_011198.3) | Reverse | TGGACGAGGTTTTTCCACCAG | |
IL-6 | Forward | TCCAGTTGCCTTCTTGGGAC | 140 |
(NM_031168.1) | Reverse | GTGTAATTAAGCCTCCGACTTG | |
Cytokine protein array analysis
To screen for different acute phase proteins, cytokines, and chemokines in mice serum, a protein profile array kit (Mouse Cytokine Array Panel A) from R&D Systems (cat.no.ARY006) was performed according to the manufacturer’s instructions. Samples of mice serum (150 μL) were separately run on the array [
24‐
26]. The proteins were detected including: BLC, C5a, G-CSF, GM-CSF, I-309, Etoaxin, sICAM-1, IFN-γ, IL-1α, IL-1β, IL-1ra, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-10, IL-13, IL-12p70, IL-16, IL-17, IL-23, IL-27, IP-10, I-TAC, KC, M-CSF, JE, MCP-5, MIG, MIP-1α, MIP-1β, MIP-2, RANTES, SDF-1, TARC, TIMP-1, TNF-α and TREM-1. Horseradish peroxidase chemiluminescent substrate (Millipore Corporation, USA) was used to detect protein blotting by exposure to Kodak BioMax Light films. Films were scanned into a computer and densitometry of the image was performed using an Image-Pro Plus Software version 6.0 (Media Cybernetics, Sliver Spring, MD, USA).
In vitro anti-inflammatory activities
Cells and cell culture
The murine macrophage cell line RAW 264.7 was obtained from Cell Culture Center of Chinese Academy of Medical Sciences (Beijing, China). Cells were cultured in DMEM supplemented with 10 % HI-FBS, 100 U/mL penicillin and 100 μg/mL streptomycin at 37 °C in a fully humidified incubator containing 5 % CO2. For all experiments, cells were grown to a confluence of 80–90 %, and were subjected to no more than seven cell passages.
Drug dilution
EEDL was prepared as above mentioned. Then a series of concentrations (200, 100, 50 and 25 μg/mL) were obtained by diluting with DMEM (without phenol red) which was supplemented with 5 % heat inactivated fetal bovine serum (HI-FBS) and 0.2 μg/mL LPS.
Analysis of cell viability
RAW 264.7 cells were distributed into 96-well plates (1.0 × 104 cells per well) for 24 h, and treated with various concentrations of EEDL (200, 100, 50, and 25 μg/mL), L-NAME (100 μM), and aspirin (100 μM). In this assay, both L-NAME and aspirin work as positive control drugs. L-NAME is an inhibitor of NOS, and aspirin is a commonly used anti-inflammatory drug which prevent the transformation of arachidonic acid to both PGE and thromboxanes by inhibiting COX activity. After incubated for 20 h, MTT reagent was added to a final concentration of 0.5 mg/mL and incubated for an additional 2 h at 37 °C and 5 % CO2. After discarding the medium, the formazan precipitate was solubilized in 100 μL DMSO, and the absorbance was recorded at 570 nm using a multifunctional microplate reader (FlexStation 3, Molecular Devices, USA).
Determination of nitrite secretion, intracellular NO production, iNOS mRNA and protein expression
Nitrite is the stable product from NO and is used as an indicator of NO secreted into the culture medium. RAW 264.7 cells, cultured in 96-well plates (5.0 × 10
4 cells per well) overnight were pretreated with various concentrations of EEDL (200, 100, 50 and 25 μg/mL), L-NAME (100 μM) or aspirin (100 μM) containing 0.2 μg/mL LPS. The LPS-treated group and blank control group was given equal volume of medium with or without LPS (0.2 μg/mL), respectively. After 24 h, the nitrite concentration accumulated in the culture supernatants was monitored by Griess reagent system (Promega, USA). Intracellular NO was detected by using the NO-sensitive fluorescent dye DAF-FM-DA. In detail, the RAW 264.7 cells were seeded in 35-mm dishes for 24 h at 37 °C and 5 % CO
2, and stimulated with EEDL (200 μg/mL) and L-NAME (100 μM) in the present of LPS (0.2 μg/mL) for an additional 24 h. Similarly, LPS-treated group and blank control group was given equal volume of medium with or without LPS (0.2 μg/mL), respectively. Subsequently, the culture medium was discarded and cells were fixed with 4 % paraformaldehyde. Finally, 10 μM DAF-FM-DA was incubated for 1 h and washed with PBS (pH 7.4) for three times. Digitized images were picked with a Zeiss LSM 710 confocal laser scanning microscope with an excitation wavelength of 495 nm and an emission wavelength of 515 nm. For the detection of iNOS mRNA expression, cells were collected from 6-well plates with or without the stimulation of LPS, and performed as earlier described [
23].
Assay for PGE2 production, COX-2 mRNA and protein expression
RAW 264.7 cells were treated with the indicated concentrations of EEDL (200, 100 and 50 μg/mL) containing 0.2 μg/mL LPS for 24 h, in addition to the LPS-treated group and blank control group which was given equal volume of medium with or without LPS (0.2 μg/mL), respectively. The cell supernatants were drawn off for the detection of PGE
2 using the PGE
2 EIA monoclonal kit (Minneapoils, USA), and cells were used to measure the expression of COX-2 protein with cell-based ELISA as previously reported [
23,
27]. The COX-2 mRNA expression was conducted similarly as earlier described.
Determination of IL-6 mRNA expression and protein secretion
To determine the level of IL-6 production in cell supernatants, cells were plated at 1 × 10
5 cells per well in 48-well plate and stimulated with various concentrations of EEDL (200, 100 and 50 μg/mL) in the presence of 0.2 μg/mL LPS for an additional 24 h. Similarly, the LPS-treated group and blank control group was given equal volume of medium with or without LPS (0.2 μg/mL), respectively. For the detection of IL-6 mRNA, cells were cultured in 6-well plate with the density of 1 × 10
6 cells per well. After stimulation with LPS, cells were harvested for real-time RT-PCR as earlier described [
23].
Cytokine protein array analysis and western blot
To screen for different acute phase proteins, cytokines, and chemokines in RAW 264.7 cell lysate, a total protein content of 20 μg was run on the array and performed as earlier described. Cell lysate was prepared with a Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime Institute of Biotechnology, China) according to the manufacturer’s protocol. For the protein analysis of iNOS, cells were seeded in the 6-well plates at a density of 1 × 106 cells per well. After stimulation with LPS for 24 h, cell lysate was prepared as above mentioned. Subsequently, BCA method was employed to determine the protein concentration, and equal amounts (40 μg) of protein were subjected to SDS-PAGE and boiled for 5 min. following transferring samples onto polyvinylidene fluoride (PVDF) membrane, TTBS (0.5 % Tween 20, 10 mM Tris–HCl, pH 7.5, 150 mM NaCl) containing 5 % nonfat milk was used for blocking at room temperature for 1 h. One hour later, blots were incubated with antibodies against iNOS (1:500), or β-actin (1:5000) overnight at 4 °C. After washing, appropriate secondary antibodies were selected for incubation at room temperature for another 1 h. Finally, the redundant secondary antibodies were washed and the protein bands were detected by a chemiluminescence detection kit (Millipore, Billerica, MA, USA) and exposure to Kodak BioMax Light films. After the films were scanned and saved as tagged image file format (TIFF) image files, images were quantified using Image-Pro Plus version 6.0 (Media Cybernetics, Sliver Spring, MD, USA).
DNA-binding activity of NF-κB p65
RAW 264.7 cells, cultured in 60-mm dishes with a density of 1.5 × 106 cells per well, were pretreated with EEDL (200, 100 and 50 μg/mL) or BAY 11–7082 for 2 h. BAY 11–7082 is a commonly used inhibitor of NF-κB. Then LPS (with a final concentration of 0.2 μg/mL) was added for an additional 30 min. The LPS-treated group and blank control group was given equal volume of medium with or without LPS (0.2 μg/mL), respectively. Then the cell lysate was prepared with a Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime Institute of Biotechnology, China) according to the manufacturer’s protocol. For the DNA-binding activity of NF-κB p65, BCA method was applied for the quantification of protein concentration. Finally, 3 μg protein was added as the manufacture’s instruction of Transcription Factor Assay Kit (Thermo Fisher Scientific Inc., USA).
Statistical analysis
The Origin 7.5 software (MicroCal, USA) was applied to perform statistical analysis. N indicated the number of animals in each group or the number of wells studied in each category. In vivo experiments, data were expressed as means ± SE, and in vitro, means ± SD were calculated. For statistical comparisons, the results were analyzed using one-way analysis of variance (ANOVA) and a P < 0.05 was considered statistically significant.
Discussion
Mounting evidence highlights that a systemic inflammatory state contributes to the cardiovascular risk [
28]. The circulating inflammation mediators take part in the mechanisms of vascular insult and atheromatous changes. As a cardiovascular protective agent, many components of DLP have been proved to have the capacity of anti-inflammation such as gallic acid [
29], salvianic acid [
30], puerarin [
13], daidzin [
31], paeoniflorin [
32], salvianolic acid B [
33], cryptotanshinone [
21], and tanshinone IIA [
34]. Here, we presented results from the investigation on the efficacy of EEDL on inflammation induced by LPS
in vivo and
in vitro.
Studies have shown that LPS injection in mice caused significant inflammatory damage (such as biochemical and histological damage in lung and liver) [
23,
35]. In the present study, we used the mice model to investigate anti-inflammation of EEDL. Results showed that EEDL possessed a strong and wide anti-inflammatory effect. In detail, EEDL was effective for antagonizing the over-expression of C5/C5a, G-CSF, I-309, sICAM-1, IL-1ra, IL-6, IP-10, KC, M-CSF, MCP-1, MIP-1α, MIP-1β, MIP-2, RANTES, SDF-1, TIMP-1, and TNF-α (
P < 0.01), and increasing IL-10 protein level in mice serum (
P < 0.01). The
in vivo experiments preliminarily indicated that EEDL might be an effective anti-inflammatory agent.
According to the animal experiments, we tried to further explore the anti-inflammation mechanisms on RAW 264.7 cells, which depicted that treatment of RAW 264.7 cells with EEDL could modulate the iNOS/NO, COX-2/PGE
2 and cytokine levels by declining the DNA-binding activity of NF-κB p65. iNOS is an important enzyme for mediating inflammatory processes. Generally, NO is at low concentration under physiological conditions which acts as a vasodilator by inhibiting the adhesion of neutrophils to the vascular endothelium [
36]. However, large amounts of NO are produced in the inflammatory tissue by the activation of iNOS in both resident tissue cells and infiltrating leucocytes when inflammation was triggered [
37]. In this study, we found that the production of NO, intracellular NO, as well as the mRNA and protein expression of iNOS were all up-regulated by LPS, whereas they were attenuated by EEDL treatment. These results indicated that the inhibition of iNOS/NO might be one of the anti-inflammatory targets of EEDL.
In addition to iNOS, COX-2, which is an inducible and isoform enzyme in inflammatory cells [
38], is another vital enzyme for mediating inflammatory processes. COX-2 is activated by physiologic stimuli such as inflammation, and is involved in the production of PGs that mediate pain and support the inflammatory process [
39]. The PGE
2, produced by the enzymatic oxidation of arachidonic acid, has been implicated as inflammatory mediators for many years [
40]. Additionally, PGs have wide-ranging effects in the body [
38]. In this work, we found that EEDL could remarkably decrease the burst production of PGE
2 based on the detection of EEDL on LPS-induced inflammation.
Moreover, the cell-based ELISA showed that EEDL could dose-dependently antagonize the over-expression of COX-2, which depicted that inhibition of COX-2/PGE2 might be another anti-inflammatory target.
Numerous pro-inflammatory cytokines are present in the inflammation process, such as IL-1, TNF, macrophage inflammatory protein (MIP). Firstly, we found that EEDL effectively attenuated the over-expression of IL-6 mRNA and protein induced by LPS in a concentrate-dependent manner. In addition to the ELISA method, protein profile array analysis, a high-throughput way to screen the different acute phase proteins, cytokines, and chemokines in a particular inflammatory process, further indicated that EEDL suppressed LPS-induced inflammation via decreasing multiple pro-inflammatory cytokines such as the common IL-1β, TNF-α, MIP-2.
Studies have demonstrated that NF-κB is involved in the regulation of COX-2 and iNOS expression, namely, blocking the improper NF-κB activation could inhibit the expression of COX-2 and iNOS [
41]. Syntheses of cytokines, such as IL-1β, TNF-α, IL-6, are also mediated by NF-κB [
42]. Various proteins in NF-κB family play an important role in the defense of the host against certain pathogens [
42]. For example, studies have shown that NF-κB p65 plays a role in constitutive IL-6 production in rheumatoid arthritis synovial fibroblasts. In this study, we designed experiment to investigate the DNA-binding activity of NF-κB p65 by transcription factor assay, which showed that the LPS-stimulated NF-κB activation was notably inhibited by EEDL, as indicated by a decreased DNA-binding activity of NF-κB p65.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
The study concepts and design were provided by CYL and YCQ. GLN, ZX and ZY contributed to experiments performance and data collection. GLN, ZX and GS participated in data evaluation. The manuscript was drafted by GLN and ZX. Manuscript editing and review was performed by CYL and GLN. GLN and ZX contributed equally to this paper. All authors read and approved the final manuscript.