Acute myeloid leukemia can develop as myoblasts infiltrate into organs and tissues anywhere other than the bone marrow, which called extramedullary infiltration (EMI), indicating a poor prognosis. Circular RNAs (circRNAs) are a novel class of non-coding RNAs that feature covalently closed continuous loops, suggesting their potential as micro RNA (miRNA) “sponges” that can participate in biological processes and pathogenesis. However, investigations on circRNAs in EMI were conducted rarely. In this study, the overall alterations of circRNAs and their regulatory network between EMI and non-EMI AML were delineated.
Methods
CircRNA and whole genome microarrays derived from EMI and non-EMI AML bone marrow mononuclear cells were carried out. Functional analysis was performed via Gene Ontology and KEGG test methods. The speculated functional roles of circRNAs were based on mRNAs and predicted miRNAs that played intermediate roles. Integrated bioinformatic analysis was conducted to further characterize the circRNA/miRNA/mRNA regulatory network and identify the functions of distinct circRNAs. The Cancer Genome Atlas (TCGA) data were acquired to evaluate the poor prognosis of distinct target genes of circRNAs. Reverse transcription-quantitative polymerase chain reaction was conducted to identify the expression of has_circRNA_0004520. Connectivity map (CMap) analysis was further performed to predict potential therapeutic agents for EMI.
Results
253 circRNAs and 663 genes were upregulated and 259 circRNAs and 838 genes were downregulated in EMI compared to non-EMI AML samples. GO pathways were enriched in progress including cell adhesion (GO:0030155; GO:0007155), migration (GO:0016477; GO:0030334), signal transduction (GO:0009966; GO:0007165) and cell–cell communication. Overlapping circRNAs envolved in pathways related to regulate cell–cell crosstalk, 17 circRNAs were chosen based on their putative roles. 7 target genes of 17 circRNAs (LRRK1, PLXNB2, OLFML2A, LYPD5, APOL3, ZNF511, and ASB2) indicated a poor prognosis, while overexpression of PAPLN and NRXN3 indicated a better one based on data from TCGA. LY-294002, trichostatin A and SB-202190 were identified as therapeutic candidates for EMI by the CMap analysis.
Conclusion
Taken together, this study reveals the overall alterations of circRNA and mRNA involved in EMI and suggests potential circRNAs may act as biomarkers and targets for early diagnosis and treatment of EMI.
Acute myeloid leukemia (AML) is one of the most common hematologic malignancies that aggressive myeloid blasts derived from bone marrow (BM) have disseminated into the peripheral blood (PB), leading to the accumulation of myeloblasts in both the BM and PB [1]. Remarkably, BM-derived blasts may also represent extramedullary infiltration (EMI) in areas other than the BM, including cutis injury, myeloid sarcoma, lymphoid infiltration and central nervous system (CNS) infiltration [2]. EMI may be present at the initial diagnosis of AML, during relapse, or even when patients achieve a complete remission in the BM. EMI predicts a poor outcome of AML due to the destruction of important organs (e.g., in the CNS) and indicates that refractory and relapse leukemia are likely to develop [3]. EMI is often misdiagnosed as inflammation, lymphoma or melanoma [4].
Current studies on the molecular and cellular manifestations of EMI center on cytogenetic backgrounds [1, 5], gene mutations [6], cluster of differentiation (CD) markers and significant non-coding RNAs [7]. Early diagnosis before the appearance of clinical manifestations and interventional treatment may delay disease progression. Furthermore, clarifying the alterations of biological function underlying EMI may provide support to overcome the disease.
Anzeige
Circular RNAs (circRNAs) were considered outcomes of a “splicing error” for decades [8]. However, with the development of high throughput analysis, the functions of circRNAs are being identified. Their specific covalently closed loop structure facilitates their resistance to RNase R, which leads to a half-life of approximately 24 h, compared to the 4–6 h half-life of mRNA at 4 °C [9]. Additionally, circRNAs exhibit tissue and temporal expression specificity and participate in multiple biological processes and human diseases. Emerging evidence reveals that circRNAs can act as miRNA “sponges” [10], interact with RNA binding proteins [11], and regulate parental gene expression, and some can even be translated [12]. Deregulated circRNAs exhibit close relationships with hematological malignancies, especially in AML, where circRNAs are derived from the NMP1 gene [13], and fusion-circRNA (f-circRNA) is derived from the fusion gene MLL-AF9 [14]. However, neither circRNA analysis nor microarray analysis of EMI in AML have been previously conducted.
This study aims to provide an overview of circRNA profiles in EMI to identify biomarkers to aid early diagnosis and treatment. A circRNA/miRNA/mRNA regulatory network was constructed and subjected to a pathway analysis, which revealed that cell–cell interactions are instrumental in EMI; a connectivity map (CMap) analysis was performed based on mRNA dysregulated in the whole regulatory network that indicates three potential therapeutic agents (LY-294002, trichostatin A and SB-202190) for EMI; these results improve our understanding of the cellular progression and pathogenesis of EMI.
Materials and methods
Samples
Twelve samples from 4 matched AML patients with and without EMI and healthy volunteers were used in our study. The study was approved by the Ethics Committee of the First Affiliated Hospital of Harbin Medical University. Informed consent was obtained in accordance with the Declaration of Helsinki. Patients with EMI found at diagnosis or at relapse were included, and the clinical features included leukemic cutis, imaging evidence of sarcoma, lymphadenectasis, or manifestations of other types of organ destruction, together with morphological characteristics of myoblast infiltration. The diagnosis was established using the WHO diagnostic criteria [15]. Samples of AML patients without EMI were collected during diagnostic biopsy. The detailed patient information is described in Table 1.
Table 1
Clinical characters of patients with or without EMI subject to circRNA expression profiles
FAB French–American–British classification system classifications, N/A not available, EMI extramedullary infiltration
Cell separation
Bone marrow mononuclear cells (BMMCs) from AML patients and healthy volunteers were separated through density gradient centrifugation by Ficoll-Hypaque (Solarbio, Beijing, China) as previously reported [16, 17].
Anzeige
Total RNA extraction
The total RNA was isolated from the samples of both groups using TRIzol (Invitrogen, CA, USA) and a miRNeasy mini kit (QIAGEN, CA, USA) according to the manufacturer’s instructions. The RNA quality and quantity were accurately measured using a NanoDrop spectrophotometer (ND-1000, Nanodrop Technologies, DE, USA). The RNA integrity was assessed by gel electrophoresis.
Whole genome microarray
The Human Whole Genome Oligo Microarrays (one-color) (Agilent, CA, USA), which covers 44,000 probes detecting approximately 27,958 genes obtained from NCBI and other authoritative data sources. Total RNA was then subjected to reverse transcription and converted to double-strand cDNA (ds-cDNA) using an Invitrogen SuperScript ds-cDNA synthesis kit with oligo dT primers. The ds-cDNA was then purified and labeled with Cy3 using the NimbleGen One-Color DNA labeling kit in accordance with the NimbleGen Gene Expression Analysis Procedure (NimbleGen Systems, Inc., Madison, WI, USA). Thus, the Cy3 labeled-ds-cDNA was hybridized with the microarrays, which were then washed with the Wash Buffer kit (NimbleGen Systems, Inc., Madison, WI, USA).
CircRNA microarray
CircRNAs from the 12 samples were detected by the Arraystar Human circRNA Array V2 (8 × 15 K, Arraystar, Rockville, MD, USA) including 15,000 probes detecting 13,617 circRNAs ever obtained from circbase and other databases. Total RNA from each sample was quantified using the NanoDrop ND-1000 (Thermo Scientific, DE, USA). The sample preparation and microarray hybridization were performed based on the Arraystar’s standard protocols. Briefly, total RNAs were digested with Rnase R (Epicentre, WI, USA) to remove linear RNAs and enrich circular RNAs. Then, the enriched circular RNAs were amplified and transcribed into fluorescent cRNA utilizing a random priming method (Arraystar Super RNA Labeling Kit; Arraystar, Rockville, MD, USA). The labeled cRNAs were hybridized onto the Arraystar Human circRNA Array V2. After having washed the slides, the arrays were scanned by the Agilent Scanner G2505C.
Microarray data analysis
Agilent feature extraction software (version 11.0.1.1) was used to analyze acquired both genome expression and circRNA array images. Quantile normalization and subsequent data processing were performed using the R software limma package. Differentially expressed genes and circRNAs with statistical significance between two groups were identified through Volcano Plot filtering. Differentially expressed circRNAs between two samples were identified through Fold Change filtering. Hierarchical Clustering was performed to show the distinguishable circRNAs expression pattern among samples.
To explore the underlying pathways and biological processes in EMI, we conducted GO and KEGG pathway analyses based on all differentially expressed mRNAs using the Database for Annotation Visualization and Integrated Discovery (DAVID version 6.8; https://david.ncifcrf.gov/) [18] and the latest KEGG database (http://www.genome.jp/kegg/) [19].
Target miRNA and mRNA prediction and regulatory network construction
MiRNAs targeted by circRNAs were predicted using TagetScan [20] and miRanda [21] (Threshold: targetscan ≤ 0.05, sitecoverage ≥ 3). miRanda was used for MRE identification and evaluation, and TargetScan was used to supplement the MRE evaluation. Putative miRNAs were listed based on competitive binding ability, and the top 5 miRNAs were selected for further mRNA predictions.
mRNA was predicted by TargetScan, microT and Tarbase on the DIANA-miRPath v.3 platform [22] (Threshold: TargetScan: − 0.4, microT:0.8), and only the target mRNAs presented more than 2 times among the 3 databases were considered target genes of the given miRNAs. The targeted mRNAs were then overlapped with our whole genome microarray data.
Anzeige
A circRNA/miRNA/mRNA regulatory network was then constructed. Cytoscape software (version 3.6.0; http://www.cytoscape.org) was used to delineate the EMI-related gene regulatory network [23].
Validation the expression of hsa_circRNA_0004520 by reverse transcription-quantitative polymerase chain reaction
RT-PCR was conducted on ViiA 7 Real-time PCR System (Applied Biosystems, Foster City, CA, USA) based on the above 4 pairs of EMI and non-EMI AML samples. Hsa_circRNA_0004520 was amplified using the specific primers shown in Table 2. The PCR reaction system with 10 μl volume consisted of 2 μl cDNA, 0.5 μl of primers (10 μM), 5 μl of 2× Master Mix and 2 μl of H2O. The amplification conditions of qRT-PCR reaction was carried out at 95 °Cfor 10 min, followed by 40 cycles at 95 °C for 10 s, 60 °C for 60 s to collect fluorescence, and finally followed by the melting program at 95 °C for 10 s, 60 °C for 60 s,95 °C for 15 s, and 60 °C to 99 °C slowly.
Table 2
Primer sequences of circRNA and mRNA measured by qRT-PCR
ID
Primer sequence
Product length (bp)
Forward (5′–3′)
Reverse (5′–3′)
β-actin(H)
GTGGCCGAGGACTTTGATTG
CCTGTAACAACGCATCTCATATT
73
hsa_circRNA_004520
TGAGACCAAGAAGGAGAAAAGAAAA
CTCGCACATCGAAGAGGTCA
145
TCGA data accession and prognostic analysis
To further validate that EMI-related circRNAs and targeted genes have the potential to predict a poor prognosis in AML patients, clinical and RNA-seq data were acquired from TCGA database via LinkedOmics (http://www.linkedomics.org/) [24]. Thirty-five genes targeted by 17 candidate circRNAs were further analyzed according to the protocol, and the parameters were set as follows: Cancer Type: acute myeloid leukemia (AML); RNA-seq based on HiSeq RNA conducted on 01/28/2016 was selected; the dataset for an ethnicity of not Hispanic or Latino was chosen; the target dataset was a clinical dataset conducted on 01/28/2016. Statistical analysis was performed by a non-parametric test, with a value of p ≤ 0.05 considered statistically significant.
CMap analysis
Differentially expressed genes involved in the circRNA/miRNA/mRNA regulatory network were listed into up- and down-regulated tags and then were uploaded into the CMap web tool (https://portals.broadinstitute.org). Matches between the signatures of interest and chemicals from CMap were assessed through a connectivity score from −1 to 1 that a positive score indicates the stimulative effect of compound on the RNAs; while a negative score implicates a inhibiting effect of a compound [25].
Anzeige
Results
CircRNA and differential gene expression in EMI and non-EMI AML BM samples
We examined 4 matched samples each of AML patients with or without EMI and healthy adults using circRNA (Arraystar Human circRNA Array V2, 8 × 15 K, Arraystar, Rockville, MD, USA) and whole genome microarrays (Agilent, CA, USA) at the Department of Hematology of The First Affiliated Hospital of Harbin Medical University.
CircRNAs and mRNAs with fold changes ≥ 2.0 and p-values ≤ 0.05 were considered significantly differentially expressed. Two hundred fifty-three circRNAs and 663 genes were upregulated, while 259 circRNAs and 838 genes were downregulated in AML patients with EMI compared to those without EMI (Additional file 1: Tables S1 and Additional file 2: Table S2). Of the differentially expressed circRNAs detected, 84.77% were covered in the exon of the genome (Fig. 1a). Hierarchical clustering was performed between of the AML with and without EMI groups to demonstrate the circRNA expression patterns (Fig. 1b, c). Furthermore, clustering overlapping was conducted to identify the circRNAs likely responsible for EMI. There were 353 upregulated circRNAs in the EMI versus non-EMI AML groups, which further overlapped with circRNAs upregulated in the AML with EMI versus the healthy groups. Finally, 82 upregulated and 27 downregulated circRNAs were considered to have closer relationships with EMI (Fig. 2a–d).
×
×
Pathway enrichment of differentially expressed genes in EMI based on GO and KEGG analysis
To clarify the biological processes related to EMI, Gene Ontology (GO) analysis and Kyoto Encyclopedia of Genes and Genomics (KEGG) pathway enrichment were performed on all 663 upregulated and 838 downregulated genes aberrantly expressed in the EMI group.
The GO analysis results revealed that these upregulated genes participated in vital biological processes including cell adhesion (GO:0030155; GO:0007155), migration (GO:0016477; GO:0030334), signal transduction (GO:0009966; GO:0007165) and cell–cell communication (GO:0010646; 0007154) (Fig. 3a, b, Additional file 3: Table S3 and Additional file 4: Table S4), which is consistent with current reports on the relationship between EMI and the microenvironment [26].
×
Anzeige
KEGG enriched pathway analysis indicated that several significative pathways might be aberrantly activated in response to EMI, including the RAP1 signaling pathway (hsa04015), Cell adhesion molecules (hsa04514) and other immunology related pathways (Additional file 5: Table S5 and Additional file 6: Table S6).
Construction and visualization of the circRNA/miRNA/mRNA regulatory network
Given the potential regulatory roles of circRNAs on miRNA “sponges”, two algorithms that focused on miRNA response elements (MREs) between circRNA and miRNA (miRanda and TargetScan) were used to predict miRNAs related to EMI. To further associate circRNAs with biological processes, we delineated the regulation of circRNAs and expressed genes indirectly, i.e., the circRNA/miRNA/mRNA network. We included the top 5 miRNAs regulated by circRNAs, and then searched the list of miRNAs in both the miRTarBase and TargetScan databases to obtain putative target genes. Finally, we overlapped the predicted target mRNAs with our whole genome microarray profiles. A regulatory network involving circRNAs/miRNAs/genes was constructed using Cytoscape software (version 3.6.0; http://www.cytoscape.org) Additional file 7: Figure S1), and the prediction of functional roles of circRNA was based on the downstream genes.
Seventeen circRNAs were associated with vital processes in EMI
To explore the candidate circRNAs that may play vital roles in EMI of AML, 82 upregulated and 27 downregulated circRNAs were selected for further analysis after overlapping. We then eliminated candidate circRNAs based on their associated biological processes. To determine which circRNAs were involved in the regulation of cell–cell interactions, genes related to these processes were retained. Thirty circRNAs were responsible for cell migration, 51 were responsible for cell–cell communication, 53 were responsible for signal transduction, and 27 were responsible for cell adhesion. CircRNAs involved in the processes mentioned above were further overlapped to identify the “kernel” circRNA. After excluding “irrelevant” genes, miRNAs and circRNAs, 17 circRNAs likely to play important roles in EMI remained, and the network of circRNAs related to EMI was diagrammed (Table 3, Fig. 4). And the structure of 9 circRNAs (8 not available) were described in Fig. 5 based on the data from Cancer Specific CircRNA (CSCD, http://gb.whu.edu.cn/CSCD/) [27].
Table 3
Essential characters of the 17 key DECs responsible for EMI
CircRNA
Alias
CircRNA type
Chrom
Strand
txStart
txEnd
Best transcript
Gene symbol
hsa_circRNA_100178
hsa_circ_0008844
Exonic
chr1
+
40,422,758
40,424,497
NM_032793
MFSD2A
hsa_circRNA_404837
–
Intronic
chr11
−
3,777,940
3,778,768
ENST00000324932
NUP98
hsa_circRNA_033628
hsa_circ_0033628
Exonic
chr14
+
105,953,535
105,955,124
NM_001311
CRIP1
hsa_circRNA_100983
hsa_circ_0024766
Exonic
chr11
+
125,472,197
125,474,142
NM_152713
STT3A
hsa_circRNA_001655
hsa_circ_0001655
Intergenic
chr6
−
156,468,903
156,489,628
–
–
hsa_circRNA_103410
hsa_circ_0003266
Exonic
chr3
−
66,501,982
66,512,933
NM_015541
LRIG1
hsa_circRNA_000481
hsa_circ_0001828
Intronic
chr8
+
142,139,086
142,139,265
ENST00000262585
DENND3
hsa_circRNA_000791
hsa_circ_0000282
Intronic
chr11
+
28,250,417
28,255,132
ENST00000303459
METTL15
hsa_circRNA_004520
hsa_circ_0004520
Sense overlapping
chr9
−
136,790,964
136,804,341
NM_003371
VAV2
hsa_circRNA_017648
hsa_circ_0017648
Exonic
chr10
−
7,409,610
7,423,911
NM_001018039
SFMBT2
hsa_circRNA_000525
hsa_circ_0000212
Sense overlapping
chr10
−
7,405,839
7,423,911
NM_001018039
SFMBT2
hsa_circRNA_000361
hsa_circ_0001275
Antisense
chr3
−
17,059,499
17,059,748
NM_015184
PLCL2
hsa_circRNA_405007
–
Intronic
chr12
−
53,468,590
53,468,877
ENST00000301463
SPRYD3
hsa_circRNA_100751
hsa_circ_0020934
Exonic
chr11
+
4,076,755
4,080,626
NM_003156
STIM1
hsa_circRNA_000404
hsa_circ_0001477
Antisense
chr5
+
39,073,734
39,073,896
NM_152756
RICTOR
hsa_circRNA_104756
hsa_circ_0086694
Exonic
chr9
−
33,932,559
33,933,626
NM_018449
UBAP2
hsa_circRNA_102483
hsa_circ_0049998
Exonic
chr19
+
17,626,981
17,628,659
NM_012088
PGLS
×
×
Validation of the expression of hsa_circRNA_0004520
RT-PCR was conducted in 4 pairs of EMI and non-EMI AML BMMCs to validate the expression of key circRNAs. Hsa_circRNA_0004520 was chosen for our interest on its target genes: PLXNB2 and VEGFA. The expression of hsa_circRNA_0004520 was upregulated by 4.38-fold (p = 0.144) (Fig. 6).
×
Validation of the prognostic value of 17 circRNAs that target genes involved in AML
To validate the prognostic value of circRNAs related to EMI, we obtained access to the Cancer Genome Atlas (TCGA) database to assess the relationship between the target genes of the 17 circRNAs and the prognosis in AML patients because EMI is associated with a poorer prognosis than non-EMI AML. A non-parametric test was applied to clinical and RNA-seq data, and a value of p ≤ 0.05 was considered a statistically significant difference. AML with overexpression of 7 genes (LRRK1, PLXNB2, OLFML2A, LYPD5, APOL3, ZNF511, and ASB2) indicated a poor prognosis, while overexpression of PAPLN and NRXN3 indicated a better prognosis (Fig. 7).
×
The data obtained from TCGA suggested the potential roles of circRNA and differentially expressed genes in the AML prognosis and further indicated that they might play crucial roles in EMI. However, this finding should be confirmed in further investigations.
Identification of three bioactive compounds for the treatment of EMI based on CMap analysis
All differentially expressed mRNA in the circRNA/miRNA/mRNA regulatory network were loaded into the CMap web tool. Following the signature query, three compounds with potential anti-tumor effect, LY-294002, trichostatin A (TSA) and SB-202190, i.e. with the highest negative enrichment score were determined as the potential therapeutic agents for EMI (Table 4). The 3D chemical structures of the three compounds obtained from NCBI are presented in Fig. 8.
Table 4
Compounds identified as potential treatment options for EMI based on CMap analysis
CMap names
Enrichment score
Dose (µM)
Cell
Up scores
Down scores
LY-294002
− 0.969
10
PC3
− 0.228
0.284
LY-294002
− 0.968
10
PC3
− 0.307
0.205
LY-294002
− 0.884
10
HL60
− 0.227
0.24
LY-294002
− 0.859
10
HL60
− 0.252
0.202
Trichostatin A
− 0.847
1
HL60
− 0.229
0.219
LY-294002
− 0.833
10
HL60
− 0.319
0.122
LY-294002
− 0.809
10
HL60
− 0.212
0.215
SB-202190
− 0.801
1
MCF7
− 0.149
0.275
CMap connectivity map
×
Discussion
In this study, we delineated a circRNA/miRNA/gene regulatory network related to EMI using microarray and bioinformatic tools for the first time. The altered genes are downstream in the regulatory network, and the functions were predicted via bioinformatics methods. MiRNAs were used to link mRNAs and circRNAs to predict their function in EMI pathogenesis. CMap analysis revealed LY-294002, trichostatin A (TSA) and SB-202190 to be treatment candidates for EMI based on dysregulated mRNAs. We explored potential biological processes and pathogenesis and predicted conceivable roles for circRNA throughout the EMI network.
EMI is relatively common in AML, with myeloid sarcoma appearing in nearly 1.4–9% of AML patients [28], and leukemic cutis present in approximately 15% of patients. It has been estimated that EMI occurs in 18–25% of childhood AML cases [29]. EMI exhibits a close relationship with relapse and refractory AML. Strikingly, after patients have undergone allo-hematopoietic stem cell transplantation (HSCT), EMI may still appear or even worsen [30].
Previous studies have investigated cytogenetic factors in EMI, such as alterations in chromosome 8 alteration, FLT3-ITD and NPM1 mutations. As the application of high throughput technology has increased, the roles of circRNAs are being clarified. Based on the circRNA/miRNA/mRNA regulatory network, the functions of circRNA in EMI were assessed, which primarily involved cell adhesion, migration, signal transduction and cell–cell communication. Previous reports on EMI have also considered cell–cell communication to play an important role in EMI, with leukemic cells subverting normal interactions and converting a normal niche into a neoplastic niche [31]. circRNAs responsible for multiple processes were thought to play an even more important role. After overlapping of four processes, 17 circRNAs in our study were identified. Due to the interesting targets (PLXNB2 and VEGFA, which may take part in angiogenesis pathways) of has_circRNA-0004520, RT-PCR was performed to validate its expression, and the function needs to be identified in our further investigation. Clinical and RNA-seq data were obtained from TCGA to further evaluate the prognostic predictive ability of EMI-related genes and circRNAs. Prognostic data of 34 in 35 genes targeted by all 17 circRNAs were obtained, of which 9 genes seemed to have a significant prediction. The high expression of 7 genes (ZNF511, APOL3, ASB2, OLFML2A, PLXNB2, LRRK1 and LYPD5, i.e.) predicted a worse outcome. These AML patients might suffer from EMI or molecular alterations before clinical symptoms, and it is our aim to find a biomarker before clinical manifestation arises. Interestingly, 2 genes (PALPN and NRXN3) seemed to exhibit a protective effect against EMI thus prolong the overall survival, which needs to be investigated. We selected circRNA as a novel biomarker for early diagnosis and treatment, thus hinder the progression of EMI and further efforts to overcome this process.
Interestingly, a CMap analysis based on mRNAs dysregulated in EMI was applied to explore practicable drugs for the treatment of EMI. Drugs on CMap were all available for human use and listed in the Food and Drug Administration. Data on CMap are based on genome-wide transcriptional expression profiles and accurately show the promoting and inhibiting effects on gene expression in transcriptional level. Three chemicals were identified to be options for EMI based on CMap results. LY-294002 is considered to be a conventional specific inhibitor of phosphatidylinositol 3-kinase (PI3K) [32]. PI3K/Akt pathways play important roles in multiple oncogenetic processes. LY-294002 has been applied for solid tumors for decades. While in hematological malignancies, there are not any PI3K inhibitors for clinical application. Recent studies on the resistance of chronic myeloid leukemia or to be a sensitizer for chemotherapy reveal that LY-294002 might work in refractory and relapsed leukemia [33, 34], such as EMI. SB-202190 is inhibitor for p38 MAPK signaling pathway [35]. P38 MAPK pathways may even play opposite effect in diverse tumors. Compared to LY-294002, SB-202190 has more applications in AML. SB-202190 can diminish doxorubicin-induced resistance in K562 cells [36], but promote THP-1 and MV4:11 cells also [37], and the exact effect of SB-202190 in EMI needs to be clarified later. As an inhibitor of histone deacetylases (HDAC), trichostatin A (TSA) has been reported for a potent inducer of tumor cell growth arrest, and apoptosis in many diverse transformed cells and tumor-bearing animals by regulating the expression of tumor suppressor genes [38]. HDAC inhibitors are gradually in use for lymphoma and multiple myeloma in this decade [39, 40]. The use of HDAC inhibitor in our EMI patients also appears a modest curative effect (data not shown).
However, there are limitations in this study. First, EMI is a very complex disease. The mechanisms of different subtypes and organs may be different. A larger and more accurate group of samples is needed to clarify these differences. In addition, only parts of circRNAs function as miRNA “sponges”. Some circRNAs may also regulate parent gene expression and participate in EMI. Additionally, classical post-transcriptional regulation of miRNAs allows them to bind to the 3′ UTR region of mRNAs and thus degrade them, while the targeted relationship still needs to be validated. Subsequent investigations will take this finding into account. Notably, our study focused on RNA levels, and further research on protein levels in cell lines and in vivo models is needed.
Conclusions
Our research is the first to use microarrays of circRNAs and whole genome expression together with bioinformatic tools to identify a circRNA/miRNA/gene regulatory network of EMI in AML patients. Seventeen circRNAs may act as key regulators of cell–cell crosstalk in EMI, and most of their target genes predict a poor prognosis. LY-294002, trichostatin A (TSA) and SB-202190 are potential treatment candidates for EMI. The unique structure and function makes circRNA an ideal biomarker for early, rapid and accurate diagnosis, which can aid efforts to overcome the disease.
Authors’ contributions
YHL and JZ designed the study and performed editing and critical revision of this manuscript; CFL, LLS and ZBG performed the experiments, analyzed the data and drafted the manuscript. HBL, DSK, and LLL collected and classified the samples. TJL, BQX and DG conducted bioinformatic analyses. All authors read and approved the final manuscript.
Acknowledgements
We thank Ms. Yabo Liu for the provision of the morphology techniques.
Competing interests
The authors declare that they have no competing interests.
This study was approved by the Ethics Committee of Human Experimentation at Harbin Medical University. Informed consent was provided in accordance with the Declaration of Helsinki.
Funding
This study was supported by the Foundation for the Returned Overseas Chinese Scholars of Heilongjiang Province (LCO7C22) and the Overseas Scholars Education Department of Heilongjiang Province (1153h12).
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.
Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.
Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.
Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.
Update Innere Medizin
Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.