Skip to main content
Erschienen in: Journal of Neuroinflammation 1/2016

Open Access 01.12.2016 | Research

Age exacerbates the CCR2/5-mediated neuroinflammatory response to traumatic brain injury

verfasst von: Josh M. Morganti, Lara-Kirstie Riparip, Austin Chou, Sharon Liu, Nalin Gupta, Susanna Rosi

Erschienen in: Journal of Neuroinflammation | Ausgabe 1/2016

Abstract

Background

Traumatic brain injury (TBI) is a major risk factor for the development of multiple neurodegenerative diseases, including Alzheimer’s disease (AD) and numerous recent reports document the development of dementia after TBI. Age is a significant factor in both the risk of and the incidence of acquired brain injury. TBI-induced inflammatory response is associated with activation of brain resident microglia and accumulation of infiltrating monocytes, which plays a pivotal role in chronic neurodegeneration and loss of neurological function after TBI. Despite the extensive clinical evidence implicating neuroinflammation with the TBI-related sequelae, the specific role of these different myeloid cells and the influence of age on TBI-initiated innate immune response remain unknown and poorly studied.

Methods

We used gene profiling and pathway analysis to define the effect of age on inflammatory response at the time of injury. The recruitment of peripheral CCR2+ macrophages was delineated using the CX3CR1 GFP/+ CCR2 RFP/+ reporter mouse. These responses were examined in the context of CCR2/5 antagonism using cenicriviroc.

Results

Unsupervised gene clustering and pathway analysis revealed that age predisposes exacerbated inflammatory response related to the recruitment and activation of peripheral monocytes to the injured brain. Using a unique reporter animal model able to discriminate resident versus peripherally derived myeloid cells, we demonstrate that in the aged brain, there is an increased accumulation of peripherally derived CCR2+ macrophages after TBI compared to young animals. Exaggerated recruitment of this population of cells was associated with an augmented inflammatory response in the aged TBI animals. Targeting this cellular response with cenicriviroc, a dual CCR2/5 antagonist, significantly ameliorated injury-induced sequelae in the aged TBI animals.

Conclusions

Importantly, these findings demonstrate that peripheral monocytes play a non-redundant and contributing role to the etiology of trauma-induced inflammatory sequelae in the aged brain.
Hinweise

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

JMM and SR designed research studies. JMM, L-KR, AC, and SL performed the experiments. JMM, NG, and SR analyzed the data. JMM and SR wrote the manuscript. All authors read and approved the final manuscript.

Background

Traumatic brain injury (TBI) is an environmental risk factor for the development of many neurological disorders including degenerative diseases such as Alzheimer’s and early onset dementia [1, 2]. Age significantly increases both the risk and incidence of acquired brain injury [3]. Elderly individuals are particularly vulnerable to TBI and have clinically worse outcomes after TBI with increased morbidity and mortality, and reduced functional recovery [4, 5]. While age as a prognostic factor after TBI has long been recognized [6], limited attention has been devoted to understanding and modulating the pathologic processes that contribute to poor outcomes seen in aged individuals.
Brain injury initiates an immediate response involving multiple cellular effectors of the innate immune response, notably the brain’s resident tissue macrophage and microglia, as well as the recruitment of peripherally derived monocytes/macrophages presumably through the disruption of the blood-brain barrier [79]. Aging in humans and rodents has been shown to alter this response [10, 11]. In the current study, we used unsupervised gene clustering and pathway analysis to define the effect of age on injury-induced inflammatory sequelae. Our data show that age predisposes the injured brain to an exaggerated inflammatory response involving the enrichment of chemotactic mediators associated with the recruitment and activation of the peripheral monocytes. Specifically, our data show that aged TBI animals have an exacerbated response in the production of ligands that bind to both CCR2 and CCR5 at a critical time point associated with migration of peripheral monocytes/macrophages to the injured brain parenchyma. This molecular response was paralleled by an increased recruitment of CCR2+ macrophages to the injured brain of aged mice. Given the exacerbated CCR2/5 cellular and molecular signatures, we used a novel small molecule antagonist for CCR2/5 to abrogate this phenotype. Using a clinically relevant pharmacological approach, our data show that the age-related phenotype in response to injury is significantly mitigated in treated animals. These data implicate a new important role for the accumulation of monocyte/macrophages in the maintenance of neuroinflammatory sequelae following neurotrauma in the aged brain.

Methods

Animals

All experiments were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee of the University of California (San Francisco, CA). Adult 3- (young) and 23-month-old (aged) male and female CX3CR1 GFP/+ CCR2 RFP/+ (double heterozygous (Dbl-Het)) and C57BL6/J (wild type (WT)) male mice were used for all experiments. Dbl-Het mice (n = 16) were generated as previously described [12] and genotyped using a commercial service (Transnetyx), while WT mice (n = 48) were purchased from the National Institute on Aging animal colony. Mice were group housed in environmentally controlled conditions with reverse light cycle (12:12 h light:dark cycle at 21 ± 1 °C) and provided food and water ad libitum.

Surgical procedure

All animals were randomly assigned and divided as equally possible between sexes (Dbl-Het) to their treatment group. Animals were anesthetized and maintained with 2.5 % isoflurane with a non-rebreathing nose cone and passive exhaust system connected to a stereotaxic frame (David Kopf). Once animals were secured with non-traumatic ear bars, eye ointment was applied and their heads were cleared of any hair around the scalp. Following betadine application, a midline incision was made through the scalp. TBI was reproduced using the controlled cortical impact model in the parietal lobe as previously described [13]. A craniectomy was created using an electric microdrill with center point to the coordinates: 2.0 mm; mediolateral, 2.0 mm, with respect to the bregma. Explicit attention was paid to prevent damage to the dura during craniectomy; any animal in which the dura was disrupted, as assessed by excessive bleeding, was omitted from the study and replaced by another littermate. After craniectomy, contusion was achieved using a 3.0-mm convex tip attached to an electromagnetic impactor (Leica) mounted to the digitally calibrated manipulator arm. To impact flush with the natural curvature of the head/tissue, the manipulator arm was rotated 20° on the vertical axis. The parameters for impact were for a contusion depth of 0.95 mm (from dura), velocity was constant at 4.0 m/s, and the impact was sustained for of 300 ms. After CCI injury, the scalp was sutured and each animal received 0.5 ml of physiologic saline (i.p.) before being placed in a water-heated incubation chamber (37 °C) until they fully recovered as exhibited by resumption of movement and grooming. Sham animals were treated to the above parameters, except that the CCI injury was omitted. All animals fully recovered from surgical procedures and exhibited normal weight gain for the duration.

Tissue collection

All mice were euthanized using a mixture of ketamine (150 mg/kg)/xylazine (15 mg/kg) in accordance with standard animal protocols. For flow cytometry endpoints; once the animal was completely anesthetized, the chest cavity was opened and transcardially perfused using ice-cold Hank’s balanced salt solution without calcium and magnesium (HBSS; Gibco). Immediately after perfusion, mice were decapitated and the ipsilateral brain hemisphere was placed into ice-cold RPMI-1640 medium without phenol (RPMI; Gibco). For qRT-PCR endpoints, animals were rapidly killed via cervical dislocation. Each brain was quickly removed, and the ipsilateral hippocampi were dissected and snap frozen.

Cenicriviroc administration

Cenicriviroc (CVC; Tobira Therapeutics), a small molecule dual antagonist for the human orthologs of CCR2 and CCR5 was dissolved in solution of 0.5 % hydroxypropyl methylcellulose (vehicle; HPMC + 1.0 % Tween80) to 5 mg/mL. Aged TBI animals were randomly divided between two treatment groups; vehicle and CVC. Two hours following surgery, animals were dosed at 100 mg/kg BID via oral gavage at 2 and 10 h post-surgery intervals. This treatment strategy was chosen to provide sufficient coverage of CCR2/5 through 24 h, with peak plasma concentrations of CVC reached by hour 2 (data not shown).

Flow cytometry

Brain hemispheres in RMPI were used for leukocyte isolation following standard procedures [14]. Fc receptor blocking was performed before all staining procedures using an anti-CD16/32 antibody (BD Pharmigen). The following reagents were used for labeling isolated macrophages: ZombieAqua (BD Biolegend), CD11b Alexafluor 700 (BD Pharmigen), and F4/80 APC (Invitrogen) CD45 FITC (AbD Serotec) Ly6C PE (AbD Serotec). Mandibular blood draws from naïve CCR2 RFP/RFP and CX3CR1 GFP/GFP mice were used as positive controls for RFP and GFP expression, respectively. Additionally, naïve WT isolated leukocytes served as negative control for RFP and GFP expression. Spectral compensation was achieved using polystyrene microparticles (BD Pharmigen) in combination with each of the above listed conjugated antibodies following manufacturer’s suggested protocol. Standard staining procedures were conducted as previously described [14] before analysis on FACSAria III cell sorter (BD Biosciences). Gating parameters for both WT and Dbl-Het endpoints were used as previously described [13]. All samples were run in duplicate. Flow cytometric data were analyzed using FlowJo (Treestar; v9.9).

qRT-PCR

Dissected ipsilateral hippocampi were used for all gene expression analyses. RNA isolation and cDNA conversion were completed as previously described [13]. RNA concentration and quality were determined using a NanoDrop (Thermo Scientific). Three hundred nanograms of RNA was reverse transcribed using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). For inflammatory profiling arrays [15], (Qiagen, #330131) equal volumes of cDNA for each sample were pooled (n = 8 animals/group/pool) and run on a single plate per condition (e.g., young sham, young TBI, aged sham, and aged TBI); cycling conditions were followed as suggested by manufacturer. Select analytes from the profiling arrays were validated using individual samples (n = 8/group) carried out in duplicate using SYBR Green Master Mix (Applied Biosystems) following manufacturer’s suggested protocol. The relative expression of target genes was determined by the 2−ΔΔCt method and normalized against beta-actin gene expression using a Statagene Mx3005P Real-Time PCR system. Specifically, the multiple genes were analyzed using the following primer sequences (5′ to 3′ sense/antisense);
CCL2 (GCTGACCCCAAGAAGGAATG/GTGCTTGAGGTGGTTGTGGA), CCL8 (GGGTGCTGAAAAGCTACGAGAG/GGATCTCCATGTACTCACTGACC), CCL7 (CAGAAGGATCACCAGTAGTCGG/ATAGCCTCCTCGACCCACTTCT), CCL12 (CAGTCCTCAGGTATTGGCTGGA/TCCTTGGGGTCAGCACAGAT), CCL5 (CCTGCTGCTTTGCCTACCTCTC/ACACACTTGGCGGTTCCTTCGA), TNFα (TGCCTATGTCTCAGCCTCTTC/GAGGCCATTTGGGAACTTCT), IL-1β (TGTAATGAAAGACGGCACACC/TCTTCTTTGGGTATTGCTTGG), Arg1 (GAACACGGCAGTGGCTTTAAC/TGCTTAGCTCTGTCTGCTTTGC), CD36 (GGACATTGAGATTCTTTTCCTCTG/GCAAAGGCATTGGCTGGAAGAAC), CX3CL1 (GGCTAAGCCTCAGAGCATTG/CTGTAGTGGAGGGGGACTCA), CXCL2 (CATCCAGAGCTTGAGTGTGACG/GGCTTCAGGGTCAAGGCAAACT), PTX3 (CGAAATAGACAATGGACTTCATCC/CATCTGCGAGTTCTCCAGCATG), JAK2 (GCTACCAGATGGAAACTGTGCG/GCCTCTGTAATGTTGGTGAGATC), JMJD3 (AGACCTCACCATCAGCCACTGT/TCTTGGGTTTCACAGACTGGGC), CD86 (ACGTATTGGAAGGAGATTACAGCT/TCTGTCAGCGTTACTATCCCGC), CD163 (GGCTAGACGAAGTCATCTGCAC/CTTCGTTGGTCAGCCTCAGAGA), gp91 phox (ACTCCTTGGGTCAGCACTGG/GTTCCTGTCCAGTTGTCTTCG), p22 phox (GCTCATCTGTCTGCTGGAGTATC/CGGACGTAGTAATTCCTGGTGAG), p40 phox (CAAAGACCTGCTAGCGCTCATG/CCACATCCTCATCTGACAGCAG), p47 phox (GCTGACTACGAGAAGAGTTCGG/CCTCGCTTTGTCTTCATCTGGC), p67 phox (GCAGAAGAGCAGTTGGCATTGG/CTGCCTCTCATTTGGACGGAAC). All primer pairs were independently validated using a standard curve of serially diluted mouse cDNA before use in any endpoint. In each PCR analysis, template and RT controls were included to account for contamination. Gene expression data are represented as the Log2 fold change relative to young sham or to aged TBI-vehicle (for CVC endpoints).

Hierarchical clustering analysis

Multi Experiment Viewer (v4.8) was used for hierarchical cluster analysis. This was performed using Pearson’s correlation for distance measure algorithm with average linking clustering parameters to identify multiple samples with similar expression patterns.

Ingenuity Pathway Analysis (IPA)

Data from mini arrays were analyzed using IPA. Differentially expressed genes (young TBI, aged sham, and aged TBI versus young sham) were uploaded into IPA and refined to limit only expression values of ±1.5-fold change before core analyses were commenced. Core analyses of the three groups were analyzed by comparison for the diseases and biological function analyses. These functional analyses were sorted by activation z-score of aged TBI group in a descending list, with exogenous chemicals omitted.

Statistical analyses

All analyses were performed in Prism v6.0 (GraphPad) using Student’s t test and one-way ANOVA with Tukey HSD correction for multiple comparisons for both flow cytometry and gene expression analyses. Significance for all measures was assessed at p < .05.

Results

Age alters gene expression profiles as a response to injury

We first conducted gene profiling of the injured parenchyma to examine the effect of age upon neuroinflammatory response to injury. Unsupervised hierarchical clustering (Fig. 1) revealed unique arrangements of both enriched and downregulated responses as a result of injury and/or age. Of these expression clusters, we examined three that visually represented alignment of genes that were downregulated in the aged TBI group (Fig. 1; green), upregulated in the aged TBI group (Fig. 1; red), and upregulated as a result of injury (Fig. 1; aquamarine). In general, the downregulated genes of the green cluster represented a repressed inflammatory function as a combination of age and injury. By contrast, the red cluster linked a group of genes related to recruitment and activation of pro-inflammatory monocytes. Notably, within this expression cluster, our data show increased responses of several CCR2 and CCR5 cognate ligands (e.g., CCL2, CCL7, CCL8, CCL5). While the aquamarine (Fig. 1) cluster was distinct from the changes found within the red cluster, there was a similar activation profile found between both TBI groups hierarchically. There was a heterogeneous mix of chemokines, cytokines, and signal transducers, and metabolic mediators found throughout this gene cluster, which seem to be indicative of a general inflammatory response to brain injury, as there was little to no activation of these mediators in the aged sham group (Fig. 1).
Selected genes were validated within each of the green, red, and aquamarine clusters of interest. In line with the pooled observations from the array and cluster, four genes from the green cluster (Fig. 1): CD163, CX3CL1, JAK2, and JMJD3 were disproportionately downregulated in the aged TBI group, compared to young TBI (Fig. 2a). Potentially indicating that as a result of age, there is a maladaptive response to injury related to the restraint of macrophage activation, similar to what is observed in humans [16]. Interestingly, we show that the anti-inflammatory [17] chemokine CX3CL1 is significantly downregulated in the aged TBI group compared to young animals following TBI. These findings are similar to a report on brain aging in healthy rodents that showed CX3CL1 expression is decreased with age [18], which can lead to pro-inflammatory neurotoxic responses [19, 20].
Comparatively, when we quantified selected genes from the red cluster (Fig. 1), we found that compared to young TBI, the aged TBI group had increased expression of CD86, a marker linked specifically with microglia [21], as well as CCL8, CCL7, and CCL5, which are ligands for CCR2 and/or CCR5 (Fig. 2b). However, we did not observe an increase of CCL2 gene expression in the aged TBI group, relative to young TBI as has been previously reported [22]. Although CCL2 is the strongest chemoattractant for CCR2+ monocytes/macrophages, the increased presence of other constituent ligands (e.g., CCL8, CCL7, CCL5) may indicate an additive effect. As a result of age, the increased presence of multiple monocyte chemotactic mediators would allow a greater permissive environment for increased recruitment.
Similarly, validation of selected genes within the aquamarine cluster (Fig. 1) showed that there was an exacerbated response to injury due to age (Fig. 2c). Specifically, as a response to injury, aged TBI animals had significantly increased expression of the inflammatory chemokines CXCL12, and CCL12, and similarly with pro-inflammatory cytokines TNFα and IL-1β, as well as PTX3. Arg1 was also significantly induced relative to young TBI. The elevated responses we observed are analogous to gene signatures from isolated CNS monocytes/macrophages in a mouse model of EAE-induced neuroinflammation [23].

Age alters injury-induced putative upstream and downstream regulatory networks

Next, we examined the gene expression profiles for translational observations through identification of putative upstream and downstream functional analyses using IPA software. This software converts gene expression data into recognized functional matrices related to disease etiology. Using this approach, IPA software identified regulatory genes associated with predicted upstream networks (Fig. 3a). Of these putative regulators, we sorted these responses by descending activation z-score and selected the top ten regulators that were either up- or downregulated for each of the three conditions (e.g., young TBI, aged sham, aged TBI), relative to young sham animals. These analyses revealed heterogeneous regulatory responses with respect to the variety of genes identified; however, there were a few instances where these regulators were conserved between conditions. Interestingly, among the conserved regulators between both young and aged TBI groups were the activation of CCL2 (Fig. 3b) and downregulation of GPX1 (Fig. 3c), involved in the recruitment of CCR2+ leukocytes and regulation of oxidative stress, respectively.
Comparatively, we examined if these gene expression responses were predictive of downstream disease-based functions using IPA software. Using IPA comparative analysis, we next sorted the top ten biological functions by the activation z-score in the aged TBI group. Of the top ten functions generated, there was a general theme of each related to innate immune response. In particular, there was an overrepresentation with both the differentiation and activation of monocytes in the aged TBI group, relative to young TBI (Fig. 4a; arrow). Examination of the putative response network associated with the activation of monocytes (Fig. 4a) revealed significant differential expression patterns in the mediators affecting this response system (Fig. 4b). Principal to this response was the induction of pro-inflammatory and chemotactic mediators within the CC and CXC motifs.

Age exaggerates the accumulation of CCR2+ monocytes following trauma

We next sought to determine if the predictive responses generated in IPA translated to in vivo reactions. Using the Dbl-Het reporter mice, our data show that aging results in a small, but significant increase in the mean number of CCR2+ infiltrated monocytes/macrophages relative to young mice (Fig. 4c). When compared to this result, following brain injury, there is a much greater recruitment and infiltration of CD11b+F4/80+CCR2+ macrophages into the parenchyma as compared to young animals. The nature of these cells in the diseased brain remains controversial, as there are reports detailing both beneficial and detrimental actions of this population of monocytes varying among disease models [13, 2426]. Interestingly, as a response of age, there was a visual increase in the number of resident F4/80+ microglia/macrophages (CX3CR1+CCR2; Fig. 4c), which was exaggerated in response to TBI. Recent work has shown that this subpopulation may have distinct roles in the inflammatory response to trauma [27].

Simultaneous CCR2/5 antagonism abrogates age-related response to injury

In order to abrogate this response, we treated aged TBI mice with cenicriviroc (CVC), a potent, oral, dual-antagonist of CCR2/5, which is currently being evaluated in a phase 2 clinical trial in adults with non-alcoholic fatty liver disease and liver fibrosis (NCT02217475). Separate cohorts of aged TBI animals were treated with either vehicle or CVC twice daily several hours after injury (Fig. 5a). Using this experimental approach, we observed a significant reduction in the numbers of CD11b+F4/80+CD45hiLy6C+ macrophages (Fig. 5b,c), which are analogous to CCR2+ macrophages, recruited into the diseased brain [12, 28].

CVC treatment mitigates the age-related inflammatory response to TBI

We next examined whether this treatment had any effect within the previously defined (Fig. 1) expression patterns identified by hierarchical clustering. Treatment with CVC significantly increased the expression of the genes in the green “restraint and anti-inflammatory” cluster (Fig. 6a), while significantly downregulating genes from the red “inflammatory chemotactic” cluster (Fig. 6b) and aquamarine “injury-induced inflammation” (Fig. 6c) gene clusters. The putative upstream network analysis predicted a proclivity for exaggerated oxidative stress response in the aged TBI group through downregulation of GPX1-regulated pathways (Fig. 3c). Importantly, we have recently shown that CCR2 antagonism ameliorates constituents mediating oxidative stress response following TBI through reduction of NADPH oxidase (NOX2) complex [13]. In agreement with those findings, our current data show that CVC treatment significantly downregulated multiple constituents of the neurotoxic ROS complex, NOX2 (Fig. 6d), which were previously shown to be upregulated in aged animals following TBI [22].

Discussion

The brain’s response to neurotrauma initiates a wide range of molecular signaling mechanisms involving a variety of cell types [29, 30]. Of principle concern is the activation of the myeloid constituents, microglia, and monocytes, due to their involvement and propagation of a variety of acute and chronic disorders [31]. The approaches taken in this study define the brain’s inflammatory milieu in response to TBI and how these molecular patterns are altered as a function of age. The altered shift in expression patterns of chemotactic mediators in aged TBI brain created a permissive environment for the exaggerated influx of peripheral monocytes/macrophages to the brain. This, in part, may be due to redundant increases in chemokines associated with CCR2/5 signaling. While the role of these monocyte populations is diverse across various neurological diseases, we have shown that these cells augment a pro-inflammatory and potentially neurotoxic bias in the aged brain. We also used an available CCR2/5 inhibitor to reduce the accumulation of pro-inflammatory myeloid cells in the brain. Cumulatively, our findings demonstrate that the CCR2-mediated recruitment of monocytes into the injured brain is a rational therapeutic target that may abrogate TBI-induced neuroinflammatory-mediated sequelae.
We recently described the leukocyte-mediated neuroinflammatory sequelae associated with this TBI model in young animals over a detailed time course spanning acute through chronic time points [13]. Our previous findings suggest that resident microglia are responsible for the initiation of specific inflammatory mediators and infiltrated CCR2+ macrophages significantly augment this response. However, in the context of aging, recent work has shown that the aged brain has an altered inflammatory profile relative to basal levels of adult mice [32], potentially priming these systems for maladaptive responses to insult or injury [33]. In the context of neurotrauma, our current data suggest that age dysregulates multiple signaling networks associated with the activation, chemotaxis, and inflammatory response of innate immune effectors. We have recently shown that these responses do not fall within the dichotomous constraints of “M1/M2” polarization [15]. In agreement with or previous work, our current data indicate that as a result of age, there is dysregulation across both pro- and anti-inflammatory mediators. While we highlighted several instances of exaggerated pro-inflammatory and chemotactic gene profiles using unsupervised hierarchical clustering, we also observed pro-inflammatory mediators such as CD40, CXCL11, CCL17, CCL19, and IL16 that were downregulated in the aged TBI group, relative to young TBI. Given these opposing inflammatory responses, it is difficult to conclude that TBI in the aged predisposes a purely pro-inflammatory bias, as there are both inductions of anti-inflammatory response with concomitant downregulation of pro-inflammatory responses, relative to young injured animals. However, our current data attribute, in part, that cumulatively, these maladaptive responses create an overly permissive environment for the exaggerated recruitment and accumulation of CCR2+ macrophages.
Although CCR2 is expressed on a variety of immune cells, circulating “inflammatory” monocytes are the main population that expresses this cytokine receptor [12]. CCR2 is currently known to have five cognate ligands; CCL2, CCL8, CCL7, CCL13 (human only), and CCL12 [34, 35]. However, there is a degree of promiscuity of the CCR2 receptor and its ligands as they are known to bind other C-C receptors; notably CCR5 [36, 37]. Expression of CCR5, like CCR2, is found on a variety of circulating immune effectors, but most relevant to our study, is co-expressed on CCR2+ monocytes [38]. Overall, in the context of our current findings, the cross-talk and co-expression of CCR2/5 on monocytes, and enhanced expression of their cognate ligands may potentiate the increased recruitment we observed in aged TBI animals. Therefore, our current data are consistent with the formation of a pro-chemotactic milieu created, in part, by increased signaling through CCR2/5 expressing cells.
NOX2 activation possesses a neurotoxic nature from the production of ROS intermediates [39, 40] as well as maintaining redox pro-inflammatory signaling cascades of macrophages [41]. Recent work has detailed an increase in some subunits of the ROS-producing NOX2 complex of aged TBI animals [22]. Our treatment paradigm with CVC significantly downregulated the expression of the multiple subunits that comprise the NOX2 complex, suggesting a decreased propensity for ROS intermediate formation relative to the vehicle-treated animals. These data align with our previous work implicating CCR2+ macrophages as the predominant source for NOX2 gene expression following TBI [13]. Importantly, in rodent models of TBI, inhibiting this complex decreased neuronal damage and improved recovery [42, 43].

Conclusions

Our current study demonstrates that the aged brain’s response to neurotrauma involves the exacerbated expression of multiple mediators involved in the recruitment of peripheral macrophages to the injured parenchyma. Blocking of these innate immune mediators via CCR2/5 antagonism significantly blunted their ingress, while concomitantly reducing inflammatory and potentially neurotoxic signatures. Intentionally, we limited the scope of this study to examine the period following injury where the maximum inflection of recruited CCR2+ macrophages was previously known [13], in an effort to define this time point within the context of age at the time of TBI. Therefore, the conclusions garnered in this study should not be expanded beyond the presented injury paradigm. Future work is needed to define how neurotrauma in the context of age affects inflammatory response in subacute and chronic periods and whether the responses and treatment currently examined may produce tangible outcome measures in those periods.

Acknowledgements

Cenicriviroc was a kind gift from Tobira Therapeutics.

Funding

Research reported in this publication was supported by the National Institute Of Neurological Disorders And Stroke and National Institute on Aging of the National Institutes of Health under award numbers F32NS090805 (J.M.M.), R21NS087458 (S.R.); R21AG042016 (S.R.). The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

JMM and SR designed research studies. JMM, L-KR, AC, and SL performed the experiments. JMM, NG, and SR analyzed the data. JMM and SR wrote the manuscript. All authors read and approved the final manuscript.
Literatur
1.
Zurück zum Zitat Johnson VE, Stewart W, Smith DH. Traumatic brain injury and amyloid-beta pathology: a link to Alzheimer’s disease? Nat Rev Neurosci. 2010;11:361–70.PubMedPubMedCentral Johnson VE, Stewart W, Smith DH. Traumatic brain injury and amyloid-beta pathology: a link to Alzheimer’s disease? Nat Rev Neurosci. 2010;11:361–70.PubMedPubMedCentral
2.
Zurück zum Zitat Jellinger KA. Traumatic brain injury as a risk factor for Alzheimer’s disease. J Neurol Neurosurg Psychiatry. 2004;75:511–2.PubMedPubMedCentral Jellinger KA. Traumatic brain injury as a risk factor for Alzheimer’s disease. J Neurol Neurosurg Psychiatry. 2004;75:511–2.PubMedPubMedCentral
3.
Zurück zum Zitat Stocchetti N, Paterno R, Citerio G, Beretta L, Colombo A: Traumatic brain injury in an aging population. J Neurotrauma. 2012; 29:1119-25. Stocchetti N, Paterno R, Citerio G, Beretta L, Colombo A: Traumatic brain injury in an aging population. J Neurotrauma. 2012; 29:1119-25.
4.
Zurück zum Zitat Schonberger M, Ponsford J, Reutens D, Beare R, O'Sullivan R. The Relationship between age, injury severity, and MRI findings after traumatic brain injury. J Neurotrauma. 2009;26:2157–67.CrossRefPubMed Schonberger M, Ponsford J, Reutens D, Beare R, O'Sullivan R. The Relationship between age, injury severity, and MRI findings after traumatic brain injury. J Neurotrauma. 2009;26:2157–67.CrossRefPubMed
5.
Zurück zum Zitat Himanen L, Portin R, Isoniemi H, Helenius H, Kurki T, Tenovuo O. Longitudinal cognitive changes in traumatic brain injury: a 30-year follow-up study. Neurology. 2006;66:187–92.CrossRefPubMed Himanen L, Portin R, Isoniemi H, Helenius H, Kurki T, Tenovuo O. Longitudinal cognitive changes in traumatic brain injury: a 30-year follow-up study. Neurology. 2006;66:187–92.CrossRefPubMed
6.
Zurück zum Zitat Mushkudiani NA, Engel DC, Steyerberg EW, Butcher I, Lu J, Marmarou A, Slieker F, McHugh GS, Murray GD, Maas AI. Prognostic value of demographic characteristics in traumatic brain injury: results from the IMPACT study. J Neurotrauma. 2007;24:259–69.CrossRefPubMed Mushkudiani NA, Engel DC, Steyerberg EW, Butcher I, Lu J, Marmarou A, Slieker F, McHugh GS, Murray GD, Maas AI. Prognostic value of demographic characteristics in traumatic brain injury: results from the IMPACT study. J Neurotrauma. 2007;24:259–69.CrossRefPubMed
8.
Zurück zum Zitat Giunta B, Obregon D, Velisetty R, Sanberg PR, Borlongan CV, Tan J. The immunology of traumatic brain injury: a prime target for Alzheimer’s disease prevention. J Neuroinflammation. 2012;9:185.CrossRefPubMedPubMedCentral Giunta B, Obregon D, Velisetty R, Sanberg PR, Borlongan CV, Tan J. The immunology of traumatic brain injury: a prime target for Alzheimer’s disease prevention. J Neuroinflammation. 2012;9:185.CrossRefPubMedPubMedCentral
9.
Zurück zum Zitat Ziebell JM, Morganti-Kossmann MC. Involvement of pro- and anti-inflammatory cytokines and chemokines in the pathophysiology of traumatic brain injury. Neurotherapeutics. 2010;7:22–30.CrossRefPubMed Ziebell JM, Morganti-Kossmann MC. Involvement of pro- and anti-inflammatory cytokines and chemokines in the pathophysiology of traumatic brain injury. Neurotherapeutics. 2010;7:22–30.CrossRefPubMed
10.
Zurück zum Zitat Lee DC, Ruiz CR, Lebson L, Selenica ML, Rizer J, Hunt Jr JB, Rojiani R, Reid P, Kammath S, Nash K, et al. Aging enhances classical activation but mitigates alternative activation in the central nervous system. Neurobiol Aging. 2013;34:1610–20.CrossRefPubMedPubMedCentral Lee DC, Ruiz CR, Lebson L, Selenica ML, Rizer J, Hunt Jr JB, Rojiani R, Reid P, Kammath S, Nash K, et al. Aging enhances classical activation but mitigates alternative activation in the central nervous system. Neurobiol Aging. 2013;34:1610–20.CrossRefPubMedPubMedCentral
11.
Zurück zum Zitat Inadera H, Egashira K, Takemoto M, Ouchi Y, Matsushima K. Increase in circulating levels of monocyte chemoattractant protein-1 with aging. J Interferon Cytokine Res. 1999;19:1179–82.CrossRefPubMed Inadera H, Egashira K, Takemoto M, Ouchi Y, Matsushima K. Increase in circulating levels of monocyte chemoattractant protein-1 with aging. J Interferon Cytokine Res. 1999;19:1179–82.CrossRefPubMed
12.
Zurück zum Zitat Saederup N, Cardona AE, Croft K, Mizutani M, Cotleur AC, Tsou C-L, Ransohoff RM, Charo IF. Selective chemokine receptor usage by central nervous system myeloid cells in CCR2-Red fluorescent protein knock-in mice. PLoS One. 2010;5:e13693.CrossRefPubMedPubMedCentral Saederup N, Cardona AE, Croft K, Mizutani M, Cotleur AC, Tsou C-L, Ransohoff RM, Charo IF. Selective chemokine receptor usage by central nervous system myeloid cells in CCR2-Red fluorescent protein knock-in mice. PLoS One. 2010;5:e13693.CrossRefPubMedPubMedCentral
13.
Zurück zum Zitat Morganti JM, Jopson TD, Liu S, Riparip LK, Guandique CK, Gupta N, Ferguson AR, Rosi S. CCR2 antagonism alters brain macrophage polarization and ameliorates cognitive dysfunction induced by traumatic brain injury. J Neurosci. 2015;35:748–60.CrossRefPubMedPubMedCentral Morganti JM, Jopson TD, Liu S, Riparip LK, Guandique CK, Gupta N, Ferguson AR, Rosi S. CCR2 antagonism alters brain macrophage polarization and ameliorates cognitive dysfunction induced by traumatic brain injury. J Neurosci. 2015;35:748–60.CrossRefPubMedPubMedCentral
14.
Zurück zum Zitat Cardona AE, Huang D, Sasse ME, Ransohoff RM. Isolation of murine microglial cells for RNA analysis or flow cytometry. Nat Protoc. 2006;1:1947–51.CrossRefPubMed Cardona AE, Huang D, Sasse ME, Ransohoff RM. Isolation of murine microglial cells for RNA analysis or flow cytometry. Nat Protoc. 2006;1:1947–51.CrossRefPubMed
15.
Zurück zum Zitat Morganti JM, Riparip L-K, Rosi S. Call Off the Dog(ma): M1/M2 polarization is concurrent following traumatic brain injury. PLoS One. 2016;11:e0148001.CrossRefPubMedPubMedCentral Morganti JM, Riparip L-K, Rosi S. Call Off the Dog(ma): M1/M2 polarization is concurrent following traumatic brain injury. PLoS One. 2016;11:e0148001.CrossRefPubMedPubMedCentral
16.
Zurück zum Zitat Stefini R, Catenacci E, Piva S, Sozzani S, Valerio A, Bergomi R, Cenzato M, Mortini P, Latronico N. Chemokine detection in the cerebral tissue of patients with posttraumatic brain contusions. J Neurosurg. 2008;108:958–62.CrossRefPubMed Stefini R, Catenacci E, Piva S, Sozzani S, Valerio A, Bergomi R, Cenzato M, Mortini P, Latronico N. Chemokine detection in the cerebral tissue of patients with posttraumatic brain contusions. J Neurosurg. 2008;108:958–62.CrossRefPubMed
17.
Zurück zum Zitat Limatola C, Ransohoff RM: Modulating neurotoxicity through CX3CL1/CX3CR1 signaling. Front Cell Neuro 2014; 8:229. Limatola C, Ransohoff RM: Modulating neurotoxicity through CX3CL1/CX3CR1 signaling. Front Cell Neuro 2014; 8:229.
18.
Zurück zum Zitat Bachstetter AD, Morganti JM, Jernberg J, Schlunk A, Mitchell SH, Brewster KW, Hudson CE, Cole MJ, Harrison JK, Bickford PC, Gemma C. Fractalkine and CX 3 CR1 regulate hippocampal neurogenesis in adult and aged rats. Neurobiol Aging. 2011;32:2030–44.CrossRefPubMedPubMedCentral Bachstetter AD, Morganti JM, Jernberg J, Schlunk A, Mitchell SH, Brewster KW, Hudson CE, Cole MJ, Harrison JK, Bickford PC, Gemma C. Fractalkine and CX 3 CR1 regulate hippocampal neurogenesis in adult and aged rats. Neurobiol Aging. 2011;32:2030–44.CrossRefPubMedPubMedCentral
19.
Zurück zum Zitat Cardona AE, Pioro EP, Sasse ME, Kostenko V, Cardona SM, Dijkstra IM, Huang D, Kidd G, Dombrowski S, Dutta R, et al. Control of microglial neurotoxicity by the fractalkine receptor. Nat Neurosci. 2006;9:917–24.CrossRefPubMed Cardona AE, Pioro EP, Sasse ME, Kostenko V, Cardona SM, Dijkstra IM, Huang D, Kidd G, Dombrowski S, Dutta R, et al. Control of microglial neurotoxicity by the fractalkine receptor. Nat Neurosci. 2006;9:917–24.CrossRefPubMed
20.
Zurück zum Zitat Morganti JM, Nash KR, Grimmig BA, Ranjit S, Small B, Bickford PC, Gemma C. The soluble isoform of CX3CL1 is necessary for neuroprotection in a mouse model of Parkinson’s disease. J Neurosci. 2012;32:14592–601.CrossRefPubMedPubMedCentral Morganti JM, Nash KR, Grimmig BA, Ranjit S, Small B, Bickford PC, Gemma C. The soluble isoform of CX3CL1 is necessary for neuroprotection in a mouse model of Parkinson’s disease. J Neurosci. 2012;32:14592–601.CrossRefPubMedPubMedCentral
21.
Zurück zum Zitat Hickman SE, Kingery ND, Ohsumi T, Borowsky M, Wang L-c, Means TK, Khoury JE. The microglial sensome revealed by direct RNA sequencing. Nat Neurosci. 2013;16:1896–905.CrossRefPubMedPubMedCentral Hickman SE, Kingery ND, Ohsumi T, Borowsky M, Wang L-c, Means TK, Khoury JE. The microglial sensome revealed by direct RNA sequencing. Nat Neurosci. 2013;16:1896–905.CrossRefPubMedPubMedCentral
22.
Zurück zum Zitat Kumar A, Stoica BA, Sabirzhanov B, Burns MP, Faden AI, Loane DJ. Traumatic brain injury in aged animals increases lesion size and chronically alters microglial/macrophage classical and alternative activation states. Neurobiol Aging. 2013;34:1397–411.CrossRefPubMedPubMedCentral Kumar A, Stoica BA, Sabirzhanov B, Burns MP, Faden AI, Loane DJ. Traumatic brain injury in aged animals increases lesion size and chronically alters microglial/macrophage classical and alternative activation states. Neurobiol Aging. 2013;34:1397–411.CrossRefPubMedPubMedCentral
23.
Zurück zum Zitat Yamasaki R, Lu H, Butovsky O, Ohno N, Rietsch AM, Cialic R, Wu PM, Doykan CE, Lin J, Cotleur AC, et al. Differential roles of microglia and monocytes in the inflamed central nervous system. J Exp Med. 2014;211:1533–49.CrossRefPubMedPubMedCentral Yamasaki R, Lu H, Butovsky O, Ohno N, Rietsch AM, Cialic R, Wu PM, Doykan CE, Lin J, Cotleur AC, et al. Differential roles of microglia and monocytes in the inflamed central nervous system. J Exp Med. 2014;211:1533–49.CrossRefPubMedPubMedCentral
24.
Zurück zum Zitat El Khoury J, Toft M, Hickman SE, Means TK, Terada K, Geula C, Luster AD. Ccr2 deficiency impairs microglial accumulation and accelerates progression of Alzheimer-like disease. Nat Med. 2007;13:432–8.CrossRefPubMed El Khoury J, Toft M, Hickman SE, Means TK, Terada K, Geula C, Luster AD. Ccr2 deficiency impairs microglial accumulation and accelerates progression of Alzheimer-like disease. Nat Med. 2007;13:432–8.CrossRefPubMed
25.
Zurück zum Zitat Mildner A, Mack M, Schmidt H, Bruck W, Djukic M, Zabel MD, Hille A, Priller J, Prinz M. CCR2+ Ly-6Chi monocytes are crucial for the effector phase of autoimmunity in the central nervous system. Brain. 2009;132:2487–500.CrossRefPubMed Mildner A, Mack M, Schmidt H, Bruck W, Djukic M, Zabel MD, Hille A, Priller J, Prinz M. CCR2+ Ly-6Chi monocytes are crucial for the effector phase of autoimmunity in the central nervous system. Brain. 2009;132:2487–500.CrossRefPubMed
26.
Zurück zum Zitat Shechter R, Miller O, Yovel G, Rosenzweig N, London A, Ruckh J, Kim KW, Klein E, Kalchenko V, Bendel P, et al. Recruitment of beneficial M2 macrophages to injured spinal cord is orchestrated by remote brain choroid plexus. Immunity. 2013;38:555–69.CrossRefPubMedPubMedCentral Shechter R, Miller O, Yovel G, Rosenzweig N, London A, Ruckh J, Kim KW, Klein E, Kalchenko V, Bendel P, et al. Recruitment of beneficial M2 macrophages to injured spinal cord is orchestrated by remote brain choroid plexus. Immunity. 2013;38:555–69.CrossRefPubMedPubMedCentral
27.
Zurück zum Zitat Donnelly DJ, Longbrake EE, Shawler TM, Kigerl KA, Lai W, Tovar CA, Ransohoff RM, Popovich PG. Deficient CX3CR1 signaling promotes recovery after mouse spinal cord injury by limiting the recruitment and activation of Ly6Clo/iNOS+ macrophages. J Neurosci. 2011;31:9910–22.CrossRefPubMedPubMedCentral Donnelly DJ, Longbrake EE, Shawler TM, Kigerl KA, Lai W, Tovar CA, Ransohoff RM, Popovich PG. Deficient CX3CR1 signaling promotes recovery after mouse spinal cord injury by limiting the recruitment and activation of Ly6Clo/iNOS+ macrophages. J Neurosci. 2011;31:9910–22.CrossRefPubMedPubMedCentral
28.
Zurück zum Zitat Auffray C, Fogg D, Garfa M, Elain G, Join-Lambert O, Kayal S, Sarnacki S, Cumano A, Lauvau G, Geissmann F. Monitoring of blood vessels and tissues by a population of monocytes with patrolling behavior. Science. 2007;317:666–70.CrossRefPubMed Auffray C, Fogg D, Garfa M, Elain G, Join-Lambert O, Kayal S, Sarnacki S, Cumano A, Lauvau G, Geissmann F. Monitoring of blood vessels and tissues by a population of monocytes with patrolling behavior. Science. 2007;317:666–70.CrossRefPubMed
29.
Zurück zum Zitat Gyoneva S, Ransohoff RM. Inflammatory reaction after traumatic brain injury: therapeutic potential of targeting cell-cell communication by chemokines. Trends Pharmacol Sci. 2015;36:471–80.CrossRefPubMed Gyoneva S, Ransohoff RM. Inflammatory reaction after traumatic brain injury: therapeutic potential of targeting cell-cell communication by chemokines. Trends Pharmacol Sci. 2015;36:471–80.CrossRefPubMed
30.
Zurück zum Zitat Hernandez-Ontiveros DG, Tajiri N, Acosta S, Giunta B, Tan J, Borlongan CV. Microglia activation as a biomarker for traumatic brain injury. Front Neurol. 2013;4:30.CrossRefPubMedPubMedCentral Hernandez-Ontiveros DG, Tajiri N, Acosta S, Giunta B, Tan J, Borlongan CV. Microglia activation as a biomarker for traumatic brain injury. Front Neurol. 2013;4:30.CrossRefPubMedPubMedCentral
32.
Zurück zum Zitat Norden DM, Muccigrosso MM, Godbout JP. Microglial priming and enhanced reactivity to secondary insult in aging, and traumatic CNS injury, and neurodegenerative disease. Neuropharmacology. 2015;96:29–41.CrossRefPubMed Norden DM, Muccigrosso MM, Godbout JP. Microglial priming and enhanced reactivity to secondary insult in aging, and traumatic CNS injury, and neurodegenerative disease. Neuropharmacology. 2015;96:29–41.CrossRefPubMed
33.
Zurück zum Zitat Norden DM, Godbout JP. Review: microglia of the aged brain: primed to be activated and resistant to regulation. Neuropathol Appl Neurobiol. 2013;39:19–34.CrossRefPubMedPubMedCentral Norden DM, Godbout JP. Review: microglia of the aged brain: primed to be activated and resistant to regulation. Neuropathol Appl Neurobiol. 2013;39:19–34.CrossRefPubMedPubMedCentral
34.
Zurück zum Zitat Deshmane SL, Kremlev S, Amini S, Sawaya BE. Monocyte chemoattractant protein-1 (MCP-1): an overview. J Interferon Cytokine Res. 2009;29:313–26.CrossRefPubMedPubMedCentral Deshmane SL, Kremlev S, Amini S, Sawaya BE. Monocyte chemoattractant protein-1 (MCP-1): an overview. J Interferon Cytokine Res. 2009;29:313–26.CrossRefPubMedPubMedCentral
35.
Zurück zum Zitat Takahashi M, Galligan C, Tessarollo L, Yoshimura T. Monocyte chemoattractant protein-1 (MCP-1), not MCP-3, is the primary chemokine required for monocyte recruitment in mouse peritonitis induced with thioglycollate or zymosan A. J Immunol. 2009;183:3463–71.CrossRefPubMed Takahashi M, Galligan C, Tessarollo L, Yoshimura T. Monocyte chemoattractant protein-1 (MCP-1), not MCP-3, is the primary chemokine required for monocyte recruitment in mouse peritonitis induced with thioglycollate or zymosan A. J Immunol. 2009;183:3463–71.CrossRefPubMed
36.
Zurück zum Zitat Mueller A, Kelly E, Strange PG. Pathways for internalization and recycling of the chemokine receptor CCR5. Blood .2002; 99:785–91. Mueller A, Kelly E, Strange PG. Pathways for internalization and recycling of the chemokine receptor CCR5. Blood .2002; 99:785–91.
37.
Zurück zum Zitat Blanpain C, Migeotte I, Lee B, Vakili J, Doranz BJ, Govaerts C, Vassart G, Doms RW, Parmentier M. CCR5 binds multiple CC-chemokines: MCP-3 acts as a natural antagonist. Blood. 1999;94:1899–905.PubMed Blanpain C, Migeotte I, Lee B, Vakili J, Doranz BJ, Govaerts C, Vassart G, Doms RW, Parmentier M. CCR5 binds multiple CC-chemokines: MCP-3 acts as a natural antagonist. Blood. 1999;94:1899–905.PubMed
38.
Zurück zum Zitat Balboa L, Romero MM, Basile JI, Sabio y Garcia CA, Schierloh P, Yokobori N, Geffner L, Musella RM, Castagnino J, Abbate E, et al. Paradoxical role of CD16+ CCR2+ CCR5+ monocytes in tuberculosis: efficient APC in pleural effusion but also mark disease severity in blood. J Leukoc Biol. 2011;90:69–75.CrossRefPubMed Balboa L, Romero MM, Basile JI, Sabio y Garcia CA, Schierloh P, Yokobori N, Geffner L, Musella RM, Castagnino J, Abbate E, et al. Paradoxical role of CD16+ CCR2+ CCR5+ monocytes in tuberculosis: efficient APC in pleural effusion but also mark disease severity in blood. J Leukoc Biol. 2011;90:69–75.CrossRefPubMed
39.
Zurück zum Zitat Wu DC, Teismann P, Tieu K, Vila M, Jackson-Lewis V, Ischiropoulos H, Przedborski S. NADPH oxidase mediates oxidative stress in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine model of Parkinson’s disease. Proc Natl Acad Sci U S A. 2003;100:6145–50.CrossRefPubMedPubMedCentral Wu DC, Teismann P, Tieu K, Vila M, Jackson-Lewis V, Ischiropoulos H, Przedborski S. NADPH oxidase mediates oxidative stress in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine model of Parkinson’s disease. Proc Natl Acad Sci U S A. 2003;100:6145–50.CrossRefPubMedPubMedCentral
41.
Zurück zum Zitat Block ML, Zecca L, Hong JS. Microglia-mediated neurotoxicity: uncovering the molecular mechanisms. Nat Rev Neurosci. 2007;8:57–69.CrossRefPubMed Block ML, Zecca L, Hong JS. Microglia-mediated neurotoxicity: uncovering the molecular mechanisms. Nat Rev Neurosci. 2007;8:57–69.CrossRefPubMed
42.
Zurück zum Zitat Zhang QG, Laird MD, Han D, Nguyen K, Scott E, Dong Y, Dhandapani KM, Brann DW. Critical role of NADPH oxidase in neuronal oxidative damage and microglia activation following traumatic brain injury. PLoS One. 2012;7:e34504.CrossRefPubMedPubMedCentral Zhang QG, Laird MD, Han D, Nguyen K, Scott E, Dong Y, Dhandapani KM, Brann DW. Critical role of NADPH oxidase in neuronal oxidative damage and microglia activation following traumatic brain injury. PLoS One. 2012;7:e34504.CrossRefPubMedPubMedCentral
43.
Zurück zum Zitat Loane DJ, Stoica BA, Byrnes KR, Jeong W, Faden AI. Activation of mGluR5 and inhibition of NADPH oxidase improves functional recovery after traumatic brain injury. J Neurotrauma. 2013;30:403–12.CrossRefPubMedPubMedCentral Loane DJ, Stoica BA, Byrnes KR, Jeong W, Faden AI. Activation of mGluR5 and inhibition of NADPH oxidase improves functional recovery after traumatic brain injury. J Neurotrauma. 2013;30:403–12.CrossRefPubMedPubMedCentral
Metadaten
Titel
Age exacerbates the CCR2/5-mediated neuroinflammatory response to traumatic brain injury
verfasst von
Josh M. Morganti
Lara-Kirstie Riparip
Austin Chou
Sharon Liu
Nalin Gupta
Susanna Rosi
Publikationsdatum
01.12.2016
Verlag
BioMed Central
Erschienen in
Journal of Neuroinflammation / Ausgabe 1/2016
Elektronische ISSN: 1742-2094
DOI
https://doi.org/10.1186/s12974-016-0547-1

Weitere Artikel der Ausgabe 1/2016

Journal of Neuroinflammation 1/2016 Zur Ausgabe

Neu in den Fachgebieten Neurologie und Psychiatrie

Akuter Schwindel: Wann lohnt sich eine MRT?

28.04.2024 Schwindel Nachrichten

Akuter Schwindel stellt oft eine diagnostische Herausforderung dar. Wie nützlich dabei eine MRT ist, hat eine Studie aus Finnland untersucht. Immerhin einer von sechs Patienten wurde mit akutem ischämischem Schlaganfall diagnostiziert.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Frühe Alzheimertherapie lohnt sich

25.04.2024 AAN-Jahrestagung 2024 Nachrichten

Ist die Tau-Last noch gering, scheint der Vorteil von Lecanemab besonders groß zu sein. Und beginnen Erkrankte verzögert mit der Behandlung, erreichen sie nicht mehr die kognitive Leistung wie bei einem früheren Start. Darauf deuten neue Analysen der Phase-3-Studie Clarity AD.

Viel Bewegung in der Parkinsonforschung

25.04.2024 Parkinson-Krankheit Nachrichten

Neue arznei- und zellbasierte Ansätze, Frühdiagnose mit Bewegungssensoren, Rückenmarkstimulation gegen Gehblockaden – in der Parkinsonforschung tut sich einiges. Auf dem Deutschen Parkinsonkongress ging es auch viel um technische Innovationen.