Skip to main content
Erschienen in: Virology Journal 1/2022

Open Access 01.12.2022 | Methodology

Development of a multiplex droplet digital PCR assay for detection of enterovirus, parechovirus, herpes simplex virus 1 and 2 simultaneously for diagnosis of viral CNS infections

verfasst von: Xunhua Zhu, Pengcheng Liu, Lijuan Lu, Huaqing Zhong, Menghua Xu, Ran Jia, Liyun Su, Lingfeng Cao, Yameng Sun, Meijun Guo, Jianyue Sun, Jin Xu

Erschienen in: Virology Journal | Ausgabe 1/2022

Abstract

Background

Enterovirus (EV), parechovirus (HPeV), herpes simplex virus 1 and 2 (HSV1/2) are common viruses leading to viral central nervous system (CNS) infections which are increasingly predominant but exhibit deficiency in definite pathogen diagnosis with gold-standard quantitative PCR method. Previous studies have shown that droplet digital PCR (ddPCR) has great potential in pathogen detection and quantification, especially in low concentration samples.

Methods

Targeting four common viruses of EV, HPeV, HSV1, and HSV2 in cerebrospinal fluid (CSF), we developed a multiplex ddPCR assay using probe ratio-based multiplexing strategy, analyzed the performance, and evaluated it in 97 CSF samples collected from patients with suspected viral CNS infections on a two-channel ddPCR detection system.

Results

The four viruses were clearly distinguished by their corresponding fluorescence amplitude. The limits of detection for EV, HPeV, HSV1, and HSV2 were 5, 10, 5, and 10 copies per reaction, respectively. The dynamic range was at least four orders of magnitude spanning from 2000 to 2 copies per reaction. The results of 97 tested clinical CSF specimens were identical to those deduced from qPCR/qRT-PCR assays using commercial kits.

Conclusion

The multiplex ddPCR assay was demonstrated to be an accurate and robust method which could detect EV, HPeV, HSV1, and HSV2 simultaneously. It provides a useful tool for clinical diagnosis and disease monitoring of viral CNS infections.
Hinweise

Supplementary Information

The online version contains supplementary material available at https://​doi.​org/​10.​1186/​s12985-022-01798-y.
Xunhua Zhu and Pengcheng Liu have contributed equally to this work.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
CNS
Central nervous system
ddPCR
Droplet digital PCR
EV
Enterovirus
HSV1
Herpes simplex virus 1
HSV2
Herpes simplex virus 2
HPeV
Parechovirus
CSF
Cerebrospinal fluid
qPCR
Quantitative PCR
RT-qPCR
Reverse transcription quantitative PCR
5’UTR
5’ Untranslated region
LOD
Limit of detection
LOQ
Limit of quantification
CV
Coefficient of variation
SD
Standard deviation

Background

Viral infections of the central nervous system (CNS) are potentially life-threatening and important causes of morbidity and mortality which take two primary forms: meningitis and encephalitis [1, 2]. Viral meningitis has symptoms similar to bacterial meningitis like fever, headache, vomiting, and signs of meningeal irritation [3]. Since the bacterial conjugate vaccine has greatly reduced the incidence of meningitis in children, the viral etiology has become increasingly prominent [4]. Encephalitis is a syndrome characterized by high fever, headache, vomiting, coma, convulsion, and mostly caused by neurotropic viruses [5].
The etiology of these viral CNS diseases is complicated. Enterovirus (EV) is the most common pathogen of viral meningitis in Western and South Asian countries. Herpesviruses, including herpes simplex virus 1 and 2 (HSV1 and HSV2) are also responsible for viral meningitis and encephalitis worldwide [6, 7]. In Australia, parechovirus makes almost equal contributions to CNS infection compared with EV [8]. The CNS of children is susceptible to EV and HPeV, and HSV encephalitis is common in both children and the elderly [911]. As these infections may lead to serious sequelae, prompt recognition and treatment are crucial for patients [6].
Quantitative real-time PCR (qPCR) is most commonly used in cerebrospinal fluid (CSF) detection. However, with relation to low viral-load body fluid such as serum and CSF, its accuracy, sensitivity, and repeatability are still not satisfying [12]. In addition, qPCR is susceptible to inhibitors and relies on standard calibrators which lead to variable qualitative and quantitative results among different laboratories. These limitations may compromise the timely diagnosis, early treatment, and antiviral therapy assessment in some viral infection cases [13]. And still, there is a large number of probable viral CNS infections not confirmed indeed due to the relatively limited diagnostic tools [2].
Digital PCR, a third-generation PCR technology, involves separately amplifying one or several nucleic acid molecules in small partitions to quantitate the initial targets [14, 15]. Droplet digital PCR (ddPCR) divides samples using water-in-oil droplets, then each droplet undergoes a PCR simultaneously, the number of positive and negative droplets is counted after the amplification and the copy number of targets is calculated based on Poisson statistics. Thus, the ddPCR approach has an absolute quantification capacity without using standard materials [16].
With the advantage of absolute quantitation without a standard curve and the potential of more accurate and sensitive end-point measurements, ddPCR has been applied to pathogens detection of infectious diseases like human immunodeficiency virus (HIV) [1719], hepatitis B virus (HBV) [20], hepatitis C virus (HCV) [21] and viruses in aqueous humor [13].
Similar to qPCR, ddPCR can develop multiplex assays as well to reduce cost, labor, time, sample consumption, and accumulated pipetting inaccuracy [22]. The term “higher-order multiplexing” is used to describe the unique ability of dPCR to measure more targets precisely in one single reaction which overcomes the restriction of fluorescent detection channels [23, 24].
In clinical virology application, this capability has been described for typing of seasonal influenza virus and detecting the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) with more than two targets by probe ratio- and amplitude-based multiplexing [22, 25]. As far as we are concerned, the multiplex detection of viruses in CSF using ddPCR has not been previously reported. In this study, we aimed to develop a quadruplex ddPCR assay using the probe ratio-based multiplexing strategy to detect and quantify EV, HPeV, HSV1, and HSV2 simultaneously in CSF and to diagnose the viral CNS infections.

Methods

Primers and probes

Primers and probes targeting HSV1, HSV2, and HPeV were reported previously [26, 27]. Primer–probe set targeting highly conserved 5’ untranslated region (5’UTR) of EV was designed from an alignment of GenBank sequences using Primer Premier 5.0 (Primer Biosoft International, USA). An in-silico analysis using the tool of Primer-BLAST in NCBI was performed. All primers and probes are highly specific to the different types of virus sequences in the Nucleotide database of NCBI and synthesized by Sangon, China. EV probe was labeled with a fluorophore of FAM. HSV1 was labeled with VIC. HPeV and HSV2 were labeled with FAM and VIC. The sequences of the primers and probes and their optimized concentrations were given in Table 1.
Table 1
Sequences of primers and probes
Primer/probe
Sequence (5′–3′)
Concentration, nmol/L
Refs.
Simplex ddPCR
Quadruplex ddPCR
EV-fora
GGTGTGAAGAGCCTATTGAGCT
400
400
In house
EV-revb
GAAACACGGACACCCAAAGTAGT
400
400
 
EV-probe
FAM-TCCTCCGGCCCCTGAATGCGGCTAATCC-BHQ1
200
200
 
HSV2-for
CGCTCTCGTAAATGCTTCCCT
400
400
[23]
HSV2-rev
TCTACCCACAACAGACCCACG
400
400
 
HSV2-probe
FAM-CGCGGAGACATTCGAGTACCAGATCG-BHQ1
100
 
 
VIC-CGCGGAGACATTCGAGTACCAGATCG-BHQ1
200
100
 
HPeV-for
GTGCCTCTGGGGCCAAAAG
400
400
[24]
HPeV-rev
TCAGATCCATAGTGTCGCTTGTTAC
400
400
 
HPeV-probe
FAM-ACGGGTACCTTCTGGGCATCCTTCG-BHQ1
200
50
 
 
VIC-ACGGGTACCTTCTGGGCATCCTTCG-BHQ1
150
 
HSV1-for
CGGCCGTGTGACACTATCG
400
400
[23]
HSV1-rev
CTCGTAAAATGGCCCCTCC
400
400
 
HSV1-probe
VIC-CCATACCGACCACACCGACGAAC-BHQ1
200
400
 
aForward primer
bReverse primer

Test materials, nucleic acid extraction, and reverse transcription

EV strain and positive clinical specimens of HSV1/2 and HPeV confirmed by sanger sequencing were used for assay development and performance evaluation. The viral RNA and DNA were simultaneously extracted and purified with a kit on an automated extraction machine both from Tianlong, China. Reverse transcription was performed then on T100 thermal cycler (Bio-Rad, USA) with a mixture of 8 μl of EV or HPeV nucleic acid, 4 μl of 5 × PrimeScritBuffer, 2 μl of Random 6mers, 1 μl of PrimeScript RT Enzyme Mix I, and 5 μl of nuclease-free water (TaKaRa, Japan). The reaction was carried out at 37 °C for 30 min and 85 °C for 5 s.

Simplex and quadruplex ddPCR

The QX200 Droplet Digital PCR System (Bio-Rad, USA) was used for the assay development of simplex and quadruplex ddPCR. For simplex ddPCR, the reaction mixture consisted of 10 µL 2 × ddPCR Supermix for probes (No dUTP), a pair of specific primer–probe set including 1 µL primers and 1 µL probes at a final concentration of 400 and 200 nM, respectively, 2 µL cDNA/DNA, and 6 µL nuclease-free water to 20 µL.
As the QX200 ddPCR System has only two detection channels, two targets at most can be quantified within a single reaction in general settings. In this study, we adopted the strategy of probe ratio-based multiplexing to develop a quadruplex ddPCR assay. Based on the simplex ddPCR, 4 sets of primers and probes were added in one single reaction to develop the quadruplex ddPCR. For EV, 200 nmol FAM-labeled probe was added; for HSV1, 400 nmol VIC-labeled probe was added; for HSV2, 100 nmol FAM-labeled and 100 nmol VIC-labeled probe were added; for HPeV, 50 nmol FAM-labeled and 150 nmol VIC-labeled probe were added. All the primers were added at a final concentration of 400 nM. A reaction mixture of 20μL was composed of 10μL 2 × ddPCR Supermix for probes (No dUTP, Bio-Rad), 1 μL primer mix, 1 μL probe mix, 2 μL cDNA/DNA, and 6μL nuclease-free water. The 20 μL reaction mix and 70 μL droplet generation oil were added to a droplet generation cartridge (DG8, Bio-Rad) to generate approximately 20,000 nanoliter-sized droplets in a droplet generator (QX200 system, Bio-Rad). Then 40 μL emulsion made of water-in-oil droplets was transferred to a 96-well plate and sealed with a pierceable aluminum foil using a PX1 PCR plate sealer (Bio-Rad) at 180 °C for 5 s. Samples were amplified in the T100 Thermal Cycler (Bio-Rad) according to the following steps: 96 °C for 10 min (enzyme activation), 40 cycles of 98 °C for 30 s (denaturation) and 55 °C for 60 s (annealing), and 60 °C for 2 min. The amplified droplets were detected in a Droplet Reader (Bio-Rad).

Performance evaluation of quadruplex ddPCR

The cDNA/DNA mixture of four targets from EV stock and positive clinical specimens confirmed by Sanger sequencing after reverse transcription was used to evaluate the performance of the Quadruplex ddPCR assay. The copy number of each target was determined by simplex ddPCR and then diluted to the corresponding concentrations we need.
The analytical sensitivity or limit of detection (LOD) was assessed using dilutions of the cDNA/DNA mixture in DNase- and RNase-free water with concentrations of 50, 10, 5, and 2 copies per reaction. Each concentration was detected in 20 replicates. The LOD for each target was defined as the lowest dilution where at least 19 replicates still produced a positive result [28]. Based on the LOD assessment, the limit of quantification (LOQ) was defined as the lowest concentration at which the CV (coefficient of variation) of all replicates was below 25% [28].
Another group of tenfold serial dilutions of nucleic acid mixture throughout 2000 to 2 copies per reaction was used to evaluate the dynamic range. Each concentration was run in 3 replicates.
For the limit of blank (LOB), 10 mNGS-negative (metagenomic next-generation sequencing) CSF samples and 4 no-template controls (NTC) were used. The number of positive droplets ≥ LOB was considered positive.
The analytical specificity of the assay was determined by performing cross-reactivity tests in other pathogens susceptible to CNS infections as well including varicella-zoster virus, Epstein-Barr virus, cytomegalovirus, human herpesvirus 6 (positive clinical specimens confirmed by mNGS), Streptococcus aureus (ATCC25923), Pseudomonas aeruginosa (ATCC27853), Streptococcus pneumonia (ATCC49619), Escherichia coli (ATCC25922), Staphylococcus epidermidis, Staphylococcus hominis, group B streptococcus, Staphylococcus haemolyticus, Klebsiella pneumonia and Acinetobacter baumannii (clinical isolation strains identified by mass spectrometry). After DNA extraction, the concentration of these strains was measured by NanoDrop2000 (Thermo Scientific, USA).

Validation of quadruplex ddPCR using clinical specimens

A total of 97 CSF samples from patients suspected of viral CNS infections were collected for assay validation from May 2020 to December 2021 and stored at -70℃ before use. These samples along with 10 HPeV-positive stool samples and 2 HSV2-positive secretion samples were simultaneously detected by qPCR/RT-qPCR and ddPCR methods. When testing patient CSF samples, multiplex assays always included a positive control that was a nucleic acid mixture of four viruses to assure no abnormalities in cluster distribution thus no misidentification for each virus, especially for HSV2 and HPeV. The commercial qPCR/RT-qPCR kits (HSV1 from Bai Tai, HSV2 from Da-An, EV from Mo Le, and HPeV from Shuo Shi, China) were used to detect these clinical samples following the manufacturer's instructions on an Applied Biosystems 7500 system (Thermo Fisher, USA). Among the kits, EV, HSV1, and HSV2 are approved by the Chinese FDA. Since the HPeV is not commonly and routinely detected in clinical laboratories in China, the assay provided for China CDC for surveillance and research is used. The results of the two methods were compared. This study was approved by the ethical committee of the Children’s Hospital of Fudan University (2021276).

Data analysis

The results and data of ddPCR were generated and analyzed by QuantaSoft software version 1.7.4.0917 or QuantaSoft™ Analysis Pro version 1.0.596 when templates were relatively high (Bio-Rad). Linear regressions were done using the GraphPad Prism7 software and CV for LOQ was calculated by Excel.

Results

Simplex ddPCR

Each simplex assay could produce a positive result with an obvious amplitude difference between positive and negative droplets as shown in Fig. 1. Both the EV and HPeV were FAM-labeled hence present in Channel 1 (Ch 1) with blue positive droplets above the threshold line (red line). Gray negative droplets with background amplitude were below the line. The HSV1 and HSV2 were labeled with VIC hence present in Channel 2 (Ch 2) with green positive droplets.

Droplet separation of quadruplex ddPCR

The test materials described above were used to develop the quadruplex ddPCR. A total of 4 primer–probe sets labeled with different fluorophores and in optimized concentrations were added to a single multiplex ddPCR reaction. By adding appropriate template concentrations (not very high), 5 droplet clusters could be observed as shown in Fig. 2A. A quadruple negative cluster was located at the left bottom; the EV-positive cluster added with 200 nM FAM only was found in channel 1 directly above the quadruple negative; the HSV1-positive cluster added with 400 nM VIC only was observed in channel 2 right next to the quadruple negative; the HSV2-positive both added with 100 nM FAM and 100 nM VIC was hence read between the two channels at an about > 45° angle from the quadruple negative; added with 50 nM FAM and 150 nM VIC, the HPeV-positive was presented at a < 30° angle from the quadruple negative. The fluorescence amplitude of HSV2 in the x-axis is about 7000 and the y-axis is about 6000. The fluorescence amplitude of HPeV in the x-axis is about 11,000 and the y-axis is about 5000. All the clusters were separated distinctly and maintained at the same position even changing the concentration of templates (Fig. 2A–C). When more concentrated templates were used, 16 (24) clusters were produced at most in the 2D amplitude. The reason is that there were two or more targets present in one droplet at the same time, so the fluorescence increased accordingly (Fig. 2F).

Performance of the quadruplex ddPCR assay

The LODs of the quadruplex ddPCR for EV, HPeV, HSV1, and HSV2 were 5, 10, 5, and 10 copies per reaction, respectively. The LOQ values of our four targets defined as the lowest concentration that can be quantified with a CV ≤ 25% were 10, 10, 50, and 10 copies per reaction, respectively (Table 2). All the LOB was determined to be 1 positive droplet (Additional file 1: Fig. S1). No cross-reactions were observed with other common pathogens not included in our panel which is also related to CNS infections described above, indicating that the quadruplex ddPCR assay had a great analytical specificity for the detection of our targeting viruses (Additional file 1: Fig. S2). The dynamic range was turned out to be at least four orders of magnitude spanning from 2000 to 2 copies per reaction. The linear regression of each virus between expected and observed concentrations were made and the R2 was as follows: EV: 0.9991; HPeV: 0.9996; HSV1: 0.9995; HSV2: 1, which showed a good linear relationship and hence a great capacity of quantification in this range of dilutions at least (Fig. 3).
Table 2
Limit of detection and quantification
 
Virus
EV
HPeV
HSV1
HSV2
Meana
13.43 (10b)
13.25 (10)
37.80 (50)
12.68 (10)
SD
2.70
3.23
7.76
3.07
CV%
20.14
24.38
20.52
24.17
LOQc
10
10
50
10
LODd
5
10
5
10
SD, standard deviation; CV, coefficient of variation
aAverage of twenty replicates, in copies per reaction
bExpected concentration determined by simplex ddPCR
cLimit of quantification
dLimit of detection

Clinical specimen detection for validation

Of the 119 clinical specimens tested, the 10 HPeV-, 10 HSV1- and 2 HSV2-positive samples confirmed by qPCR/RT-qPCR previously produced positive results by quadruplex ddPCR too. The other 97 CSF specimens were detected by qPCR/RT-qPCR and quadruplex ddPCR simultaneously. The results of the 97 samples were fully consistent using the two assays. EV was found in most cases (15/97, 15.46%). HPeV and HSV1 were found in 3 (3.09%) and 2 (2.06%) cases, respectively. No HSV2 was found (Table 3).
Table 3
Diagnostic performance of quadruplex ddPCR and qPCR/RT-qPCR in detecting clinical CSF samples
Virus
No. of specimens by quadruplex ddPCR Versus qPCR/RT-qPCR
Detection rate (%)
+/+a
−/−b
EV
15
82
15.46
HPeV
3
94
3.09
HSV1
2
95
2.06
HSV2
0
97
0
aPositive in two assays
bNegative in two assays
All but 2 children with positive CSF were born at term. 55% of patients were < 28 days. The median length of hospitalization was 11 days ranging from 1 to 43 days. 13 patients were diagnosed with meningitis, 6 with encephalitis, and 1 with meningoencephalitis (Additional file 1: Table S1).

Discussion

Viral CNS infection, which is characterized by fever, headache, seizures, vomiting, and altered mental status caused by various viruses is being increasingly serious and prominent since the popularity of vaccines and the increase of immunodeficient patients [35]. EV, HPeV, HSV1, and HSV2 have become the main causes around the world [6, 8]. However, due to the characteristic of low viral loads in CSF, the detection rate of pathogens is underestimated and the definite pathogen diagnoses are insufficient [2]. Moreover, it’s reported that the viral loads can assess disease severity and predict clinical outcomes [9]. Thus, a highly sensitive approach with strong quantitative ability is needed. Compared to qPCR, digital PCR is more accurate in low nucleic acid samples and resistant to PCR inhibitors [16]. Compared with the simplex assay, multiplex ddPCR can save cost, labor time, and sample given to the few CSF volumes in children, especially in neonates.
In this study, we have developed and evaluated a quadruplex ddPCR. There are two main strategies when related to multiplex ddPCR assay development with more than two targets: probe ratio-based multiplexing with three targets and amplitude-based multiplexing with four or more targets [25]. In our study, we innovatively adopted the multiplex probe ratio strategy with four different targets. In this way, there are two distinct single-positive droplet clusters (HSV2-, HPeV-positive, Fig. 2) between the X and Y axes. The stable separate clusters in the 2D plot (Fig. 2) proved that we have developed a quadruplex ddPCR distinguishing four targets successfully with a broad range of linearity and good sensitivity (Fig. 3).
LOB is an important parameter for a digital PCR assay which defines the qualitative results of negative or positive. The determination of LOB depends on the accumulating results by testing a large number of negative samples. Different assays have different LOB values due to the difference in templates, probe concentration, and reaction conditions. Researchers are supposed to determine the LOB themselves. In our study, the LOB of each virus was one positive droplet. This means the false-positive droplets are few in our method.
In our study, the results of qPCR and ddPCR are completely consistent, which means our quadruplex ddPCR assay has great sensitivity comparable to commercial qPCR/qRT-PCR kits but more detectable targets and powerful quantitative quality, especially in low concentration samples. EV was the main cause of viral CNS infection (15/97, 15.46%), identical to other studies in China [29, 30]. HPeV was found in 3 cases. Notably, it’s reported that HPeV especially the HPeV3 associated with severe cases is as common as EV in CNS infection enjoying similar symptoms [31]. So, the detection and identification of these two viruses are very important and urgent. However, few laboratories include HPeV in routine testing items in China. Our multiplex ddPCR assay is a useful tool for confirmatory and differential diagnosis of these two viruses. HSV1 was found in 2 cases and encephalitis caused by HSV1 is generally severe [32].
There were several limitations in our study. First, HSV2 was not found due to the limited CSF sample numbers. So, we have tested 2 HSV2-positive secretion samples to alternately evaluate the clinical diagnosis capacity of HSV2. Second, because of the limited detection channels, internal control was not added to the multiplex assay. Third, we determined the LOB using 10 mNGS-negative CSF samples because the CSF of healthy population couldn't be obtained.
In the future, more CSF samples should be detected to further improve the method and apply it to clinical use. New panels focusing on other pathogens in CSF or bloodstream infections which is also featured by low concentration of pathogens could be developed using the multiplex ddPCR approach. In addition, we will continue to focus on increasing the number of detection targets and then incorporate more pathogens and the internal control into our assay, optimizing analytical performance, and further improving the sensitivity and accuracy of the multiplex ddPCR.

Conclusion

In conclusion, we have developed a sensitive and robust quadruplex ddPCR assay which could detect EV, HPeV, HSV1, and HSV2 simultaneously. It provides a useful tool for clinical diagnosis and disease monitoring of viral CNS infections.

Acknowledgements

We thank the participants for their contributions to this study.

Declarations

This study was approved by the ethical committee of the Children’s Hospital of Fudan University (2021276).
Not applicable.

Competing interests

The authors declared no competing interests.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visithttp://​creativecommons.​org/​licenses/​by/​4.​0/​. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Literatur
2.
4.
Zurück zum Zitat Sadarangani M, Willis L, Kadambari S, Gormley S, Young Z, Beckley R, et al. Childhood meningitis in the conjugate vaccine era: a prospective cohort study. Arch Dis Child. 2015;100(3):292–4.CrossRefPubMed Sadarangani M, Willis L, Kadambari S, Gormley S, Young Z, Beckley R, et al. Childhood meningitis in the conjugate vaccine era: a prospective cohort study. Arch Dis Child. 2015;100(3):292–4.CrossRefPubMed
6.
Zurück zum Zitat Ben Abid F, Abukhattab M, Ghazouani H, Khalil O, Gohar A, Al Soub H, et al. Epidemiology and clinical outcomes of viral central nervous system infections. Int J Infect Dis. 2018;73:85–90.CrossRefPubMed Ben Abid F, Abukhattab M, Ghazouani H, Khalil O, Gohar A, Al Soub H, et al. Epidemiology and clinical outcomes of viral central nervous system infections. Int J Infect Dis. 2018;73:85–90.CrossRefPubMed
7.
Zurück zum Zitat B’Krong N, Minh NNQ, Qui PT, Chau TTH, Nghia HDT, Do LAH, et al. Enterovirus serotypes in patients with central nervous system and respiratory infections in Viet Nam 1997–2010. Virol J. 2018;15(1):69.CrossRefPubMedPubMedCentral B’Krong N, Minh NNQ, Qui PT, Chau TTH, Nghia HDT, Do LAH, et al. Enterovirus serotypes in patients with central nervous system and respiratory infections in Viet Nam 1997–2010. Virol J. 2018;15(1):69.CrossRefPubMedPubMedCentral
8.
Zurück zum Zitat Britton PN, Dale RC, Blyth CC, Clark JE, Crawford N, Marshall H, et al. Causes and clinical features of childhood encephalitis: a multicenter, prospective cohort study. Clin Infect Dis. 2020;70(12):2517–26.CrossRefPubMed Britton PN, Dale RC, Blyth CC, Clark JE, Crawford N, Marshall H, et al. Causes and clinical features of childhood encephalitis: a multicenter, prospective cohort study. Clin Infect Dis. 2020;70(12):2517–26.CrossRefPubMed
9.
Zurück zum Zitat Song C, Li Y, Zhou Y, Liang L, Turtle L, Wang F, et al. Enterovirus genomic load and disease severity among children hospitalised with hand, foot and mouth disease. EBioMedicine. 2020;62:103078.CrossRefPubMedPubMedCentral Song C, Li Y, Zhou Y, Liang L, Turtle L, Wang F, et al. Enterovirus genomic load and disease severity among children hospitalised with hand, foot and mouth disease. EBioMedicine. 2020;62:103078.CrossRefPubMedPubMedCentral
10.
Zurück zum Zitat Britton PN, Jones CA, Macartney K, Cheng AC. Parechovirus: an important emerging infection in young infants. Med J Aust. 2018;208(8):365–9.CrossRefPubMed Britton PN, Jones CA, Macartney K, Cheng AC. Parechovirus: an important emerging infection in young infants. Med J Aust. 2018;208(8):365–9.CrossRefPubMed
11.
Zurück zum Zitat Stahl JP, Mailles A. Herpes simplex virus encephalitis update. Curr Opin Infect Dis. 2019;32(3):239–43.CrossRefPubMed Stahl JP, Mailles A. Herpes simplex virus encephalitis update. Curr Opin Infect Dis. 2019;32(3):239–43.CrossRefPubMed
12.
Zurück zum Zitat Li H, Bai R, Zhao Z, Tao L, Ma M, Ji Z, et al. Application of droplet digital PCR to detect the pathogens of infectious diseases. Biosci Rep. 2018;38(6). Li H, Bai R, Zhao Z, Tao L, Ma M, Ji Z, et al. Application of droplet digital PCR to detect the pathogens of infectious diseases. Biosci Rep. 2018;38(6).
13.
Zurück zum Zitat Cao G, Tan C, Zhang Y, Kong X, Sun X, Ma Y, et al. Digital droplet polymerase chain reaction analysis of common viruses in the aqueous humour of patients with Posner-Schlossman syndrome in Chinese population. Clin Exp Ophthalmol. 2019;47(4):513–20.CrossRefPubMed Cao G, Tan C, Zhang Y, Kong X, Sun X, Ma Y, et al. Digital droplet polymerase chain reaction analysis of common viruses in the aqueous humour of patients with Posner-Schlossman syndrome in Chinese population. Clin Exp Ophthalmol. 2019;47(4):513–20.CrossRefPubMed
15.
Zurück zum Zitat Sykes PJ, Neoh SH, Brisco MJ, Hughes E, Condon J, Morley AA. Quantitation of targets for PCR by use of limiting dilution. Biotechniques. 1992;13(3):444–9.PubMed Sykes PJ, Neoh SH, Brisco MJ, Hughes E, Condon J, Morley AA. Quantitation of targets for PCR by use of limiting dilution. Biotechniques. 1992;13(3):444–9.PubMed
17.
Zurück zum Zitat Yukl SA, Kaiser P, Kim P, Telwatte S, Joshi SK, Vu M, et al. HIV latency in isolated patient CD4(+) T cells may be due to blocks in HIV transcriptional elongation, completion, and splicing. Sci Transl Med. 2018;10(430). Yukl SA, Kaiser P, Kim P, Telwatte S, Joshi SK, Vu M, et al. HIV latency in isolated patient CD4(+) T cells may be due to blocks in HIV transcriptional elongation, completion, and splicing. Sci Transl Med. 2018;10(430).
18.
Zurück zum Zitat Bosman KJ, Wensing AM, Pijning AE, van Snippenberg WJ, van Ham PM, de Jong DM, et al. Development of sensitive ddPCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant forms. J Int AIDS Soc. 2018;21(9):e25185.CrossRefPubMedPubMedCentral Bosman KJ, Wensing AM, Pijning AE, van Snippenberg WJ, van Ham PM, de Jong DM, et al. Development of sensitive ddPCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant forms. J Int AIDS Soc. 2018;21(9):e25185.CrossRefPubMedPubMedCentral
19.
Zurück zum Zitat Gálvez C, Urrea V, Dalmau J, Jimenez M, Clotet B, Monceaux V, et al. Extremely low viral reservoir in treated chronically HIV-1-infected individuals. EBioMedicine. 2020;57:102830.CrossRefPubMedPubMedCentral Gálvez C, Urrea V, Dalmau J, Jimenez M, Clotet B, Monceaux V, et al. Extremely low viral reservoir in treated chronically HIV-1-infected individuals. EBioMedicine. 2020;57:102830.CrossRefPubMedPubMedCentral
20.
Zurück zum Zitat Caviglia GP, Abate ML, Tandoi F, Ciancio A, Amoroso A, Salizzoni M, et al. Quantitation of HBV cccDNA in anti-HBc-positive liver donors by droplet digital PCR: a new tool to detect occult infection. J Hepatol. 2018;69(2):301–7.CrossRefPubMed Caviglia GP, Abate ML, Tandoi F, Ciancio A, Amoroso A, Salizzoni M, et al. Quantitation of HBV cccDNA in anti-HBc-positive liver donors by droplet digital PCR: a new tool to detect occult infection. J Hepatol. 2018;69(2):301–7.CrossRefPubMed
21.
Zurück zum Zitat Frías M, Rivero-Juárez A, Téllez F, Palacios R, Jiménez-Arranz Á, Pineda JA, et al. Evaluation of hepatitis C viral RNA persistence in HIV-infected patients with long-term sustained virological response by droplet digital PCR. Sci Rep. 2019;9(1):12507.CrossRefPubMedPubMedCentral Frías M, Rivero-Juárez A, Téllez F, Palacios R, Jiménez-Arranz Á, Pineda JA, et al. Evaluation of hepatitis C viral RNA persistence in HIV-infected patients with long-term sustained virological response by droplet digital PCR. Sci Rep. 2019;9(1):12507.CrossRefPubMedPubMedCentral
22.
Zurück zum Zitat Leong NKC, Chu DKW, Chu JTS, Tam YH, Ip DKM, Cowling BJ, et al. A six-plex droplet digital RT-PCR assay for seasonal influenza virus typing, subtyping, and lineage determination. Influenza Other Respir. 2020;14(6):720–9.CrossRef Leong NKC, Chu DKW, Chu JTS, Tam YH, Ip DKM, Cowling BJ, et al. A six-plex droplet digital RT-PCR assay for seasonal influenza virus typing, subtyping, and lineage determination. Influenza Other Respir. 2020;14(6):720–9.CrossRef
24.
Zurück zum Zitat Huggett JF. The digital MIQE guidelines update: minimum information for publication of quantitative digital PCR experiments for 2020. Clin Chem. 2020;66(8):1012–29.CrossRefPubMed Huggett JF. The digital MIQE guidelines update: minimum information for publication of quantitative digital PCR experiments for 2020. Clin Chem. 2020;66(8):1012–29.CrossRefPubMed
25.
Zurück zum Zitat Nyaruaba R, Li C, Mwaliko C, Mwau M, Odiwuor N, Muturi E, et al. Developing multiplex ddPCR assays for SARS-CoV-2 detection based on probe mix and amplitude based multiplexing. Expert Rev Mol Diagn. 2021;21(1):119–29.CrossRefPubMed Nyaruaba R, Li C, Mwaliko C, Mwau M, Odiwuor N, Muturi E, et al. Developing multiplex ddPCR assays for SARS-CoV-2 detection based on probe mix and amplitude based multiplexing. Expert Rev Mol Diagn. 2021;21(1):119–29.CrossRefPubMed
26.
Zurück zum Zitat Sarquiz-Martinez B, Gonzalez-Bonilla CR, Santacruz-Tinoco CE, Munoz-Medina JE, Pardave-Alejandre HD, Barbosa-Cabrera E, et al. Differential detection of enterovirus and herpes simplex virus in cerebrospinal fluid by real-time RT-PCR. Intervirology. 2017;60(3):118–24.CrossRefPubMed Sarquiz-Martinez B, Gonzalez-Bonilla CR, Santacruz-Tinoco CE, Munoz-Medina JE, Pardave-Alejandre HD, Barbosa-Cabrera E, et al. Differential detection of enterovirus and herpes simplex virus in cerebrospinal fluid by real-time RT-PCR. Intervirology. 2017;60(3):118–24.CrossRefPubMed
27.
Zurück zum Zitat Baumgarte S, de Souza Luna LK, Grywna K, Panning M, Drexler JF, Karsten C, et al. Prevalence, types, and RNA concentrations of human parechoviruses, including a sixth parechovirus type, in stool samples from patients with acute enteritis. J Clin Microbiol. 2008;46(1):242–8.CrossRefPubMed Baumgarte S, de Souza Luna LK, Grywna K, Panning M, Drexler JF, Karsten C, et al. Prevalence, types, and RNA concentrations of human parechoviruses, including a sixth parechovirus type, in stool samples from patients with acute enteritis. J Clin Microbiol. 2008;46(1):242–8.CrossRefPubMed
28.
Zurück zum Zitat Nutz S, Döll K, Karlovsky P. Determination of the LOQ in real-time PCR by receiver operating characteristic curve analysis: application to qPCR assays for Fusarium verticillioides and F. proliferatum. Anal Bioanal Chem. 2011;401(2):717–26.CrossRefPubMedPubMedCentral Nutz S, Döll K, Karlovsky P. Determination of the LOQ in real-time PCR by receiver operating characteristic curve analysis: application to qPCR assays for Fusarium verticillioides and F. proliferatum. Anal Bioanal Chem. 2011;401(2):717–26.CrossRefPubMedPubMedCentral
29.
Zurück zum Zitat Ai J, Xie Z, Liu G, Chen Z, Yang Y, Li Y, et al. Etiology and prognosis of acute viral encephalitis and meningitis in Chinese children: a multicentre prospective study. BMC Infect Dis. 2017;17(1):494.CrossRefPubMedPubMedCentral Ai J, Xie Z, Liu G, Chen Z, Yang Y, Li Y, et al. Etiology and prognosis of acute viral encephalitis and meningitis in Chinese children: a multicentre prospective study. BMC Infect Dis. 2017;17(1):494.CrossRefPubMedPubMedCentral
30.
Zurück zum Zitat Shen H, Zhu C, Liu X, Ma D, Song C, Zhou L, et al. The etiology of acute meningitis and encephalitis syndromes in a sentinel pediatric hospital, Shenzhen, China. BMC Infect Dis. 2019;19(1):560.CrossRefPubMedPubMedCentral Shen H, Zhu C, Liu X, Ma D, Song C, Zhou L, et al. The etiology of acute meningitis and encephalitis syndromes in a sentinel pediatric hospital, Shenzhen, China. BMC Infect Dis. 2019;19(1):560.CrossRefPubMedPubMedCentral
31.
Zurück zum Zitat Abedi GR, Watson JT, Pham H, Nix WA, Oberste MS, Gerber SI. Enterovirus and human parechovirus surveillance—United States, 2009–2013. MMWR-Morb Mortal Wkly Rep. 2015;64(34):940–3.CrossRefPubMed Abedi GR, Watson JT, Pham H, Nix WA, Oberste MS, Gerber SI. Enterovirus and human parechovirus surveillance—United States, 2009–2013. MMWR-Morb Mortal Wkly Rep. 2015;64(34):940–3.CrossRefPubMed
Metadaten
Titel
Development of a multiplex droplet digital PCR assay for detection of enterovirus, parechovirus, herpes simplex virus 1 and 2 simultaneously for diagnosis of viral CNS infections
verfasst von
Xunhua Zhu
Pengcheng Liu
Lijuan Lu
Huaqing Zhong
Menghua Xu
Ran Jia
Liyun Su
Lingfeng Cao
Yameng Sun
Meijun Guo
Jianyue Sun
Jin Xu
Publikationsdatum
01.12.2022
Verlag
BioMed Central
Erschienen in
Virology Journal / Ausgabe 1/2022
Elektronische ISSN: 1743-422X
DOI
https://doi.org/10.1186/s12985-022-01798-y

Weitere Artikel der Ausgabe 1/2022

Virology Journal 1/2022 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.

Therapiestart mit Blutdrucksenkern erhöht Frakturrisiko

25.04.2024 Hypertonie Nachrichten

Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.