Background
Nasopharyngeal carcinoma (NPC) is the most common head and neck cancer in Southern China and Southeast Asia [
1]. Although local and regional control has improved since the introduction of intensity-modulated radiation therapy and chemoradiotherapy, approximately 30% of patients eventually develop recurrence and/or distant metastasis [
2]. Therefore, improved understanding the molecular mechanisms that regulate NPC progression is essential to develop novel treatment strategies.
Uncontrolled proliferation is a pathological characteristic of cancer cells. Protein kinase complexes composed of cyclins and cyclin-dependent kinases (CDKs) determine the progression of cells through the cell cycle. Cyclins function as the regulatory subunit and CDKs function as the catalytic subunit of the activated heterodimer complexes, which orchestrate coordinated entry into the S phase of the cell cycle [
3]. Dysregulation of cell cycle components can lead to uncontrolled tumor cell proliferation and cancer [
4,
5]. Clinical trials targeting CDK inhibitors have shown promise for the treatment of cancer [
6,
7]; therapeutic strategies targeting cell cycle-related proteins may be effective for the treatment of myeloma and breast cancer. However, the mechanisms leading to malignant proliferation in NPC remain poorly characterized.
DNA methylation is a critical epigenetic modification involved in regulation of gene expression [
8]. Dysregulated methylation of specific genes has been shown to increase NPC cell growth, invasion and migration, and may contribute to the progression and recurrence of NPC [
9‐
11]. In a previous study, we employed Illumina Human Methylation 450 K Beadchips to perform genome-wide DNA methylation analysis of 48 samples (between 24 nasopharyngeal carcinoma tissues and 24 normal nasopharyngeal epithelial tissues) to identify aberrantly methylated genes (GSE52068) [
10]. One of the top-ranked hypermethylated genes, zinc finger protein 671 (
ZNF671), which contains C2H2-type zinc fingers (ZFs) and a Krüppel associated box (KRAB) domain, is a member of the KRAB-ZFP family of mammalian transcriptional repressors [
12,
13] that play important roles in regulation of cell differentiation, proliferation, apoptosis and tumor suppression [
14,
15]. Recent studies have demonstrated that
ZNF671 is epigenetically silenced by DNA methylation and functions as a tumor suppressor in multiple carcinomas [
16‐
18]. However, little is known about the function and mechanism of action of
ZNF671 in NPC.
Here, we report that ZNF671 is downregulated and the ZNF671 promoter is hypermethylated in NPC cell lines and tissues. Overexpression of ZNF671 suppressed, while silencing ZNF671 promoted, NPC cell proliferation and colony formation in vitro and tumorigenicity in vivo. Further studies demonstrated overexpression of ZNF671 inhibited NPC cell proliferation and tumorigenicity by inducing S phase cell cycle arrest.
Methods
Cell culture and clinical specimens
Human NPC cell lines (CNE1, CNE2, HNE1, HONE1, SUNE1, 5-8F, 6-10B) were cultured in RPMI-1640 (Invitrogen, Life Technologies, Grand Island, NY) supplemented with 5% fetal bovine serum (FBS) (Gibco-BRL, Carlsbad, CA, USA). Human immortalized nasopharyngeal epithelial cell line (NP69, N2Tert) were cultured in keratinocyte serum-free medium (Invitrogen) supplemented with bovine pituitary extract (BD influx, Biosciences, USA). 293 T cells were obtained from the ATCC (Manassas, VA, USA) and maintained in DMEM (Invitrogen) supplemented with 10% FBS. Four freshly frozen NPC samples and four normal nasopharyngeal epithelium samples were collected from patients undergoing biopsy at Sun Yat-sen University Cancer Center.
RNA isolation and reverse transcription-PCR (RT-PCR)
Total RNA was isolated from NPC cell lines using TRIzol Reagent (Invitrogen) following the manufacturer’s instructions, cDNA was synthesized using M-MLV reverse transcriptase (Promega, Madison, WI, USA) and amplified with Platinum SYBR Green qPCR SuperMix-UDG reagents (Invitrogen) using the CFX96 sequence detection system (Bio-Rad, Hercules, CA, USA) with the following primers: ZNF671 forward, 5′- GACTTAGACCTGGTTGTTGG -3′ and reverse, 5′- GTATTTAGCCAGGTGTAAGGT-3′. GAPDH was used as control for normalization.
Western blotting
RIPA lysis buffer (Beyotime, Shanghai, China) was used to isolate proteins and the Bradford method, to determine protein concentrations. Proteins (20 μg) were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE, Beyotime), transferred onto PVDF membranes (Millipore, Billerica, MA, USA) and incubated with primary anti-ZNF671 (1:500; Proteintech, Chicago, IL, USA), anti-cyclin D1 (1:1000; Cell Signaling Technology, Danvers, MA, USA), anti-c-myc (1:1000; Proteintech) or anti-p21 (1:1000; Proteintech) antibodies overnight at 4 °C, followed by species-matched secondary antibodies. Bands were detected using enhanced chemiluminescence.
DNA isolation and bisulfite pyrosequencing analysis
NPC cell lines were treated with or without 10 μmol/L 5-aza-2′-deoxycytidine (DAC; Sigma-Aldrich, Munich, Germany) for 72 h, with the drug/media replaced every 24 h. DNA was isolated using the EZ1 DNA Tissue Kit (Qiagen, Hilden, Germany), then 1–2 μg DNA was treated with sodium bisulfite using the EpiTect Bisulfite kit (Qiagen) according to the manufacturer’s instructions. Bisulfite pyrosequencing primers were designed using PyroMark Assay Design Software 2.0 (Qiagen), and were: PCR forward primer: 5′-GAATTTAGGTTAGGGATAGTTTGAT-3′ (F); PCR reverse primer: 5′-CCAAAAAAAAAATATTTCAATACC-3′ (R); sequencing primer: 5′-GG ATAGTTTGA TAGAAATAAAATG-3′(S). The PyroMark Q96 System (Qiagen) was used for the sequencing reactions and to quantify methylation.
Stable cell line establishment and ZNF671 small interfering RNAs (siRNAs)
The pSin-EF2-puro-ZNF671-HA or pSin-EF2-puro-vector plasmids were obtained from Land. Hua Gene Biosciences (Guangzhou, China); pSin-EF2-puro-Vector plasmid was used as a control. Stably transfected cells were selected using puromycin and confirmed using RT-PCR. SiRNAs targeting ZNF671 were obtained from GenePharma Co., Ltd. (Shanghai, China); siRNA #1 targets ZNF671-Homo-626 cDNA (sense strand: CCUUACACCUGGCUAAAUATT; antisense strand: UAUUUAGCCAGGUGUAAGGTT) and siRNA #2 targets ZNF671-Homo-279 cDNA (sense strand: GGAAGAAUGGGAGCUUCUUTT; antisense strand: AAGAAGCUCCCAUUCUUCCTT).
Cell proliferation and colony formation assays
For the CCK-8 assay, cells (1 × 103) were seeded into 96-well plates, incubated for 0–4 days, stained with CCK-8 (Dojindo, Tokyo, Japan), and absorbance values were determined at 450 nm using a spectrophotometer. For the colony formation assay, cells (0.3 × 103) were seeded into 6-well plates, cultured for 2 weeks and the colonies were fixed in methanol, stained with crystal violet and counted.
Cell cycle analysis
Cells (2 × 105) were seeded into 6-well plates, cultured for 24 h, serum-starved for 24 h to synchronize cells at the G1/S checkpoint, trypsinized, washed with ice-cold PBS, fixed in 70% ethanol, and stored at −20 °C until analysis. Before staining, cells were gently resuspended in cold PBS and RNase A was added into cell suspension tube incubated at 37 °C for 30 min, followed by incubation with propidium iodide (PI) (Beyotime) for 20 min at room temperature. The fluorescence intensity of the cells was analyzed by flow cytometry (Gallios; Beckman-Coulter, Germany).
Animal experiments
BALB/c-nu mice (4–6 weeks old) were purchased from Charles River Laboratories (Beijing, China), and CNE2-vector or CNE2-ZNF671 cells (1 × 106) were subcutaneously inoculated into the dorsal flank. Tumor size was measured every 3 days and tumor volumes were calculated using the equation: volume = D × d2 × π/6, where D and d represent the longest and shortest diameters, respectively. All animal research was conducted in accordance with the detailed rules approved by the Animal Care and Use Ethnic Committee of Sun Yat-sen University Cancer Center and all efforts were made to minimize animal suffering.
Gene set enrichment analysis (GSEA)
The GSEA software tool (version 2.0.13,
www.broadinstitute.org/gsea/) was used to identify KEGG pathways (MSigDB, version 4.0) that show an overrepresentation of up- or downregulated genes between
ZNF671 high expression (
n = 15) and
ZNF671 low expression (
n = 16) in GSE12452. Briefly, an enrichment score was calculated for each gene set (i.e., KEGG pathway) by ranking each gene by their expression difference using Kolmogorov-Smirnov statistic, computing a cumulative sum of each ranked in each gene set, and recording the maximum deviation from zero as the enrichment score.
Statistical analysis
Statistical analyses were performed using SPSS 17.0 (SPSS Inc., Chicago, IL, USA). All data shown are representative of at least three independent experiments, and values are expressed as the mean ± SD. Differences between two groups were analyzed using the two-tailed unpaired Student’s t-test; p < 0.05 was considered significant. All data from this study has been deposited at Sun Yat-sen University Cancer Center for future reference (number RDDB2017000075).
Discussion
This study demonstrates
ZNF671 is downregulated in NPC, consistent with our previous analysis of publicly available NPC datasets [
13], due to promoter hypermethylation. Moreover, overexpressing
ZNF671 reduced NPC cell viability and colony formation in vitro, enhanced tumorigenicity in vivo
, and induced cell cycle arrest. These results provide new mechanistic understanding of the ability of
ZNF671 to regulate cell proliferation in NPC.
Local recurrence and distant metastasis are the major patterns of treatment failure in NPC. Most cancers are caused by accumulation of genomic or epigenetic alterations [
19‐
24], and epigenetic alterations play an important role in the development of NPC [
9,
25]. Several studies have indicated that aberrantly methylated genes could serve as prognostic biomarkers for NPC [
26‐
28]. Thus, exploration of the mechanisms by which gene methylation contributes to progression and recurrence are important strategies for improving prognosis and designing targeted therapies for NPC.
ZNF671, a member of the KRAB-ZF family, is silenced by promoter methylation in renal cell, cervical carcinoma and urothelial carcinoma [
16,
18,
29]. A number of ZNF proteins function as tumor suppressors, and are epigenetically silenced by DNA methylation in multiple human cancers [
14,
30]. We demonstrated
ZNF671 mRNA and protein expression are downregulated in NPC cell lines and tissues. Furthermore, overexpression of
ZNF671 suppressed NPC cell viability and colony formation in vitro and reduced tumorigenicity in vivo. These findings indicate that
ZNF671 functions as a tumor suppressor in NPC, consistent with its role in urothelial carcinoma [
16].
Several individual components of the cell cycle machinery are subject to aberrant methylation, which contributes to malignancy in several cancers [
31‐
33]. The S phase cell cycle check point ensures synthesis of DNA and proteins and is a crucial regulator of cell cycle progression, while the G2/M checkpoint allows cells to enter mitosis [
34,
35]. Cyclin D1 and p21 cyclin-dependent kinases are major regulators of S phase progression [
36‐
38]. Recent studies showed the transcriptionally repressive ZNF-KRAB domain can recruit KRAB-associated protein-1 (KAP1) [
12,
13,
39] and other co-repressors, and KRAB-ZFP forms heterochromatin with chromobox 5 (CBX5), SET domain bifurcated 1 (SETDB1) and various histone deacetylases (HDACs) to epigenetically silence KRAB-ZNF target genes [
40‐
42]. Our bioinformatic analysis showed
ZNF671 affects NPC cell proliferation by regulating the mitotic spindle and G2/M checkpoint pathways. Flow cytometry and western blotting confirmed overexpression of
ZNF671 induced S phase cell cycle arrest and blocked G2/M phase progression by downregulating cyclin D1 and c-myc and upregulating p21.
Acknowledgments
This work was supported by grants from the National Nature Science Foundation of China (81372409; 81572658); the Science and Technology Project of Guangzhou City, China (2014 J4100182); the National Science & Technology Pillar Program during the Twelfth Five-year Plan Period (2014BAI09B10); and the Program of Introducing Talents of Discipline to Universities (B14035).The funders had no role in the study design, data collection, analysis, decision to publish or the preparation of the manuscript.