Introduction
Neuron-to-neuron propagation of pathological forms of α-synuclein (α-syn) is a phenomenon of likely relevance for the development and progression of human α-synucleinopathies such as Parkinson’s disease (PD). Several lines of evidence support this assertion. Observations in post-mortem PD brain reveal a stereotypical accumulation of α-syn-containing Lewy bodies and Lewy neurites. Compatible with a mechanism of interneuronal α-syn spreading, these pathological lesions progressively affect interconnected brain regions, starting from the caudal brainstem and moving toward mesocortical and neocortical areas [
1,
2]. From the experimental standpoint, neuron-to-neuron α-syn transmission has been demonstrated
in vitro in a variety of cell culture systems as well as
in vivo in animal models [
3-
10]. Results of
in vivo studies also support a relationship between α-syn propagation and neurodegenerative processes. When mice were injected intrastriatally with fibrillar α-syn, protein spreading not only reached neuronal populations distant from the injection site but also caused dopaminergic cell death in the substantia nigra [
11]. In a separate model mimicking the spreading pattern of PD, interneuronal transmission of α-syn could be initiated by its overexpression in the rat medulla oblongata (MO); caudo-rostral spreading toward pons, midbrain and forebrain was accompanied by accumulation and aggregation of α-syn into swollen dystrophic axons [
12].
Elucidation of the mechanisms involved in the transfer of α-syn (and/or pathological forms of it) from donor to recipient cells bears significant pathogenetic implications and could provide clues for therapeutic intervention targeting protein spreading. Experimental evidence suggests that α-syn could initially be secreted
via membrane-bound vesicles, such as exosomes, and then taken up
via endocytotic pathways, such as adsorptive endocytosis and dynamin-dependent endocytosis [
3,
4,
13-
16]. While these mechanisms would involve intact healthy cells, a critical unaddressed question remains the role that neuronal injury/death may play in facilitating α-syn access into the extracellular space. Passive release of α-syn from damaged neurons would be of particular relevance during neurodegenerative processes. Indeed, a vicious cycle could be envisioned by which pathological α-syn accumulation causes neuronal damage, neurodegeneration results in α-syn release, and extracellular α-syn becomes available for internalization into nearby neurons. Injury of these neurons would ultimately perpetuate the cycle and cause further propagation of α-syn pathology.
Experiments in this study were designed to determine the role of neuronal damage or, vice versa, cell integrity in α-syn propagation in vivo. α-Syn spreading from the caudal brainstem toward more rostral brain regions was triggered by protein overexpression in the rat MO and compared under experimental conditions characterized by absence of neurodegeneration vs. a loss of α-syn-containing neurons. Results demonstrated that passive release from injured neurons is not essential for triggering α-syn transmission, nor does it exacerbate protein spreading. In fact, α-syn propagation was more pronounced in the absence than in the presence of neurodegeneration, underscoring the importance of neuron-to-neuron α-syn transfer between intact, relatively healthy cells.
Materials and methods
Vectors
Recombinant adeno-associated virus (serotype 2 genome and serotype 6 capsid, AAV) was used for transgene expression of human wild-type α-synuclein (hα-syn) or enhanced green fluorescent protein (GFP) under the control of the human Synapsin1 promoter. Gene expression was enhanced using a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) and a polyadenylation signal sequence (polyA) [
12,
17]. Experiments compared the effects of two AAV preparations: AAV prep 1 (Vector Biolabs, Philadelphia, PA, USA) and AAV prep 2 (Sirion Biotech, Martinsried, Germany). For both preparations, 293 HEK cells were transfected with the same reporter plasmid (Additional file
1: Figure S1). Crude cell lysates containing the viral particles were then purified by either (i) two consecutive CsCl gradient centrifugations (AAV prep 1), or (ii) centrifugation through a discontinuous iodixanol gradient followed by heparin affinity chromatography (AAV prep 2). AAV preparations were concentrated and resuspended in phosphate buffered saline. Titration of the concentrated vectors was performed using quantitative PCR with primers against WPRE. Injected titers were 1 × 10
13 genome copies/ml for hα-syn-AAV prep 1 and between 5 × 10
12 and 1 × 10
13 genome copies/ml for hα-syn-AAV prep 2. In experiments in which the effects of GFP overexpression were compared, GFP-AAV prep 1 or GFP-AAV prep 2 were injected at a titer of 1 ×10
13 genome copies/ml.
Animals and surgical procedure
Young adult female Sprague Dawley rats weighing 200–250 g were obtained from Charles River (Kisslegg, Germany). They were housed under a 12-h light/12-h dark cycle with free access to food and water. Experimental design and procedures were approved by the ethical committee of the State Agency for Nature, Environment and Consumer Protection in North Rhine Westphalia. Following anesthetization with 2% isoflurane mixed with O2 and N2O, a 2 cm-incision was made at the midline of the rat neck. The left vagus nerve was isolated from the surrounding tissue, and the vector solution (2 μl) was injected at a flow rate of 0.5 μl/min using a glass capillary (tip diameter = 60 μm) fitted onto a 5 μl Hamilton syringe. Control animals were injected with vehicle using the same volume and at the same flow rate. After injection, the capillary was kept in place for 3–4 minutes.
Tissue preparation
Animals were killed under pentobarbital anesthesia and perfused through the ascending aorta with saline, followed by ice-cold 4% (w/v) paraformaldehyde. Brains were removed, immersion-fixed in 4% paraformaldehyde (for 24 h) and cryopreserved in 25% (w/v) sucrose solution. Coronal sections (40 μm) throughout the brain were cut using a freezing microtome and stored at −20°C in phosphate buffer (pH 7.4) containing 30% glycerol and 30% ethylene glycol.
3,3′-Diaminobenzidine staining
Free-floating brain sections were rinsed with Tris-buffered saline (TBS, pH 7.6). Endogenous peroxidase activity was quenched by incubation in a mixture of 3% H2O2 and 10% methanol in TBS. Non-specific binding sites were blocked using 5% normal serum in TBS containing 0.25% Triton-X-100 (TBS-T). Samples were then incubated overnight at room temperature in TBS-T containing 1% bovine serum albumin and primary antibodies: mouse anti-hα-syn clone syn211 (36–008, Merck Millipore, Darmstadt, Germany; 1:10,000 dilution), chicken anti-GFP (ab13970, Abcam; 1:10,000 dilution), and goat anti-choline acetyltransferase (AB144P, Millipore; 1:200 dilution). Sections were rinsed and incubated (for 1 h at room temperature) in biotinylated secondary antibody solution (horse anti-mouse BA2001 or rabbit anti-goat BA5000; Vector Laboratories, Burlingame, CA, USA; 1:200 dilution). Following treatment with avidin-biotin-peroxidase (ABC Elite kit, Vector Laboratories), color reaction was developed using 3,3′-diaminobenzidine kit (Vector Laboratories). Sections were mounted on coated slides, dried, stained (if appropriate) with cresyl violet (FD Neurotechnologies, Columbia, MD, USA) and coverslipped with Depex (Sigma-Aldrich, St. Louis, MO, USA).
Brightfield microscopy images were obtained using an IX2 UCB microscope from Olympus (Hamburg, Germany) equipped with a motorized stage (MBF Mac6000 System stage, MBF Biosciences). For z-stacking analysis, stacks were collected at 1 μm intervals, and a single image was generated by deep focus post-processing. Low magnification images of entire brain sections were generated using an Axioscan Z1 (Carl Zeiss, Göttingen, Germany) slide scanner.
Fluorescence staining
Following blocking procedures (see above), tissue sections were incubated overnight with the following primary antibodies: mouse anti-hα-syn clone syn211 (36–008, Merck Millipore; 1:3,000 dilution), rabbit anti-poly ADP ribose polymerase (PARP) p85 fragment (G7341, Promega; 1:100 dilution), and mouse anti-hα-syn 5G4 (847–0102004001, Analytic Jena; 1:1000 dilution). Reactions with primary antibodies raised in mice were followed by incubations with biotinylated horse anti-mouse (BA2001, Vector Laboratories) secondary antibody. Streptavidin-conjugated DyLight fluorophore (DyLight 488, Vector Laboratories; 1:400 dilution) was then used for detection. Reactions with primary antibodies raised in rabbit were followed by incubations in the presence of DyLight 594-conjugated horse anti-rabbit secondary antibody (Vector Laboratories; 1:400 dilution). Sections were mounted on coated slides and coverslipped with PVA-DABCO (Sigma). Confocal fluorescence images were collected using a Zeiss LSM700 inverted laser scanning microscope.
Histological quantifications
All histological evaluations were performed by investigators blinded to sample treatment. The total number of Nissl-positive and hα-syn-immunoreactive neurons was estimated in the dorsal motor nucleus of the vagus nerve (DMnX) using unbiased stereology [
18]. Every sixth section throughout the entire DMnX was sampled. After delineation of the DMnX under a 10x objective (Additional file
2: Figure S2), counting was performed using a 60x Plan-Apo oil objective (Numerical aperture = 1.4). A guard zone thickness of 1 μm was set at the top and bottom of each section. Neurons were counted using the optical fractionator technique (Stereo Investigator software version 9, MBF Biosciences, Williston, VT, USA). The sampling interval in the X-Y coordinate axis was adjusted so that at least 100 cells were counted for each DMnX (sampling grid size: 125 × 125 mm; counting frame: 60 × 60 mm). Coefficient of error was calculated according to Gundersen and Jensen [
19]; values <0.10 were accepted.
Every sixth section throughout the entire DMnX was used for volume estimates of DMnX neurons immunoreactive for hα-syn or choline acetyltransferase (ChAT). Measurements were made on (i) all hα-syn-labeled cells present in these sections, or (ii) a population of ChAT-positive neurons selected
via stereological sampling. Volumes were calculated according to the isotropic nucleator method [
20]. For each neuron, a nucleator probe was set to generate 6 random isotropic linear rays that emerged from a user-defined center point. The points at which the 6 rays touched the profile of the neuron were manually defined and used for volumetric estimates. Analyses were carried out using the Stereo Investigator software version 9 (MBF Biosciences).
Fluorescence intensity measurements were carried out on all α-syn-positive neurons present in three MO sections at the level of obex (Bregma: −13.8, −13.56 and −13.32 mm). For each neuron, confocal images were collected using a 60x objective at a single focal plane where the nucleus was clearly visible. All image settings including laser power, exposure time, gain, offset and scanning speed were kept constant throughout the measurements. For each neuron, background readings were obtained on empty areas at the same focal depth. Image analyses were carried out using the Fiji software (version 2.0) [
21]. Corrected total cell fluorescence (CTCF) was calculated by the following formula: Integrated Density - (Area occupied by the selected cell x Mean fluorescence of background readings). CTCF values were averaged for each animal.
Quantification of hα-syn positive axons was made using sections at pre-defined Bregma coordinates [
22]: −9.48 mm in pons, −7.80 mm in caudal midbrain, −6.00 mm in rostral midbrain and −2.40 mm in forebrain. At each section, all immunostained axons were counted using an Axioscope microscope (Carl Zeiss) under a 20x Plan-Apo objective.
The length of hα-syn-containing axons was estimated using the Space Balls stereological probe (Stereo Investigator software version 9, MBF Biosciences) [
23]. Measurements were made on serial sections of the pons (Bregma: −9.7 to −9.22 mm) where an area encompassing the locus coeruleus and the parabrachialis nucleus was delineated. A virtual hemisphere (12 μm radius) was placed randomly within this area, and systematic sampling was performed at intervals of 100 μm in both X and Y axes. A guard zone of 1 μm was set at the top and bottom of each tissue section. While the microscope stage moved through the Z-axis, the circle diameter of the Space Balls hemisphere decreased concentrically at each 1 μm focal plane. The number of intersections between fibers and circles was counted and used to estimate a mean total fiber length. Volume of the reference region was estimated by the Cavalieri point-counting method applying a step length size of 200 μm [
24]. Fiber density was calculated by the ratio total fiber length/volume of reference region.
Reverse transcription PCR (RT-PCR)
Fixed tissue sections (40 μm) from rats injected with hα-syn-AAV preparations or vehicle were used for conventional or quantitative RT-PCR (qRT-PCR) analysis. Dorso-medial quadrants of the left (injected side) MO, which contained the DMnX, were dissected and pooled from equally spaced (2 sections every 160 μm) sections at Bregma −14.76 to −12.48 mm. Total RNA was extracted using the “RecoverAll Total Nucleic Acid Kit” (Ambion, Austin, TX, USA), and cDNA was synthesized by reverse transcription (SuperScript VILO Master Mix, Invitrogen, Carlsbad, CA, USA) using 100 ng of total RNA. The following primer sequences were used: (i) total (rat plus human) α-synuclein: 5'tggttttgtcaaaaaggaccag forward and 5'ccttcctcagaaggcatttc reverse; (ii) hypoxantine phosphoribosyltransferase 1 (housekeeping gene): 5'gaccggttctgtcatgtcg forward and 5'acctggttcatcatcactaatcac reverse, (iii) rat-only α-synuclein: 5'gagttctgcggaagcctagagagc forward and 5'gttttctcagcagcagccacaactcc reverse; and (iv) WPRE: 5'caattccgtggtgttgtcgg forward and 5'caaagggagatccgactcgt reverse. Analyses were performed in triplicates, using 1 μl of cDNA and Power SYBR Green Master Mix (Applied Biosystems Warrington, UK). For conventional RT-PCR the product was run on 1.5% agarose gel and visualized by EtBr staining. For qRT-PCR, measurements were performed using a StepOne plus real time PCR instrument with built-in software (Applied Biosystems). Relative quantities (fold changes) were calculated after normalization to housekeeping gene expression and calibration to a reference sample from vehicle-injected animals.
Statistical analyses
Analyses were performed using JMP Pro Statistical software (version 10.0.0; SAS Institute, Cary, NC, USA). Means between two groups were compared with two-tailed t-test. Comparisons between multiple groups were carried out with one-way ANOVA followed by Tukey post hoc test. Statistical significance was set at P < 0.05.
Discussion
Results of an earlier study demonstrated that propagation of hα-syn from the MO to more rostral regions of the rat brain could be triggered by AAV-mediated hα-syn transduction and was dependent on the levels of mRNA and protein overexpression. Very little spreading was observed when AAV transduction produced less than a one-fold increase in α-syn mRNA and a weak hα-syn immunostaining of MO neurons; this modest effect contrasted with the pronounced caudo-rostral propagation seen when mRNA levels were approximately three-fold higher than control values and labeling of histological MO sections revealed robust hα-syn immunoreactivity [
12]. The purpose of this present investigation was to determine if other factors, besides intraneuronal expression levels, affected hα-syn spreading in this model. In particular, we aimed at assessing the relationship between neuronal injury and inter-neuronal α-syn propagation.
The two hα-syn-AAV preparations used in this study were injected into the rat vagus nerve at concentrations capable of inducing comparable levels of hα-syn overexpression in the MO. Despite this similarity, hα-syn-AAV prep 1 and prep 2 differed significantly with regard to their toxic effects, with neuronal damage being evident only after treatment with hα-syn-AAV prep 1. Contamination with impurities (e.g., empty capsids) and/or reagents used for their preparation (e.g., CsCl) is known to underlie the toxic potential of viral vectors [
26-
28]. Production of AAV prep 1 and prep 2 involved different purification procedures, which can result in various degrees of contamination. It is quite likely therefore that greater injury caused by hα-syn-AAV prep 1 arose from a relatively less thorough purification and a higher concentration of toxic byproducts.
Stereological cell counting of DMnX neurons revealed a reduction of total Nissl-stained cells at 12 weeks after treatment with hα-syn-AAV prep 1 as well as GFP-AAV prep 1. These data are consistent with non-specific toxic effects due to AAV prep 1 contamination. It is noteworthy that in rats injected with hα-syn-AAV prep 1 (i) the count of DMnX neurons immunoreactive for hα-syn was also decreased at the 12-week time point, and (ii) this decrease in hα-syn-positive cells (−437 ± 59 cells as compared to values at 6 weeks) fully accounted for the reduction in total Nissl-stained neurons (−438 ± 23 cells). Thus, despite the involvement of non-specific factors in AAV prep 1 toxicity, neuronal damage caused by hα-syn-AAV prep 1 still targeted DMnX neurons containing hα-syn. It is quite likely that protein overexpression made these cells particularly vulnerable to injury; if so, neurodegeneration might have arisen from the combined effects of hα-syn burden and AAV prep 1 toxicity.
Taken together, findings on neuronal transduction and cell damage in animals injected with hα-syn-AAV prep 1 vs. prep 2 revealed: (i) induction of comparable hα-syn overexpression, (ii) neuronal injury caused by one but not the other AAV preparation, and (iii) selectivity of this injury that targeted hα-syn-containing neurons. These features justified the following two assumptions concerning protein transmission after AAV prep 1- or prep 2-induced hα-syn overexpression. First, any potential difference in propagation would be unlikely to reflect changes in hα-syn levels at the site of initial protein transfer, i.e. MO neurons. Second, a comparison of spreading triggered by hα-syn-AAV prep 1 vs. prep 2 would be expected to yield different results should hα-syn transmission be significantly affected by damage/death of neurons.
Spreading was assessed by counting the number of axonal projections immunoreactive for hα-syn in brain regions rostral to the MO. Axons forming the rat vagus nerve originate from or terminate in the MO [
29]; intravagal injections of hα-syn-carrying AAV vectors cause neuronal transduction and protein overexpression that are also confined to the MO [
12]. Therefore, presence of hα-syn within axons that project from the pons, midbrain or forebrain to the MO [
30-
34] is indicative of caudo-rostral propagation
via inter-neuronal protein transfer. Several lines of evidence from the present as well as earlier investigations support these assertions. Specific transduction is indicated by the pattern of AAV-induced overexpression that reproduces the anatomical brain distribution of efferent and afferent fibers forming the vagus nerve [
12,
29]. For example, because efferent vagal fibers originate from the DMnX and nucleus ambiguus [
29], these two MO nuclei represent the only sites where, following AAV transduction, neuronal cell bodies immunoreactive for hα-syn are observed [
12]. When markers of AAV transduction, such as hα-syn and WPRE mRNAs, were measured in the MO and pons, they could only be detected in specimens of the MO ipsilateral to vagal injections [
12]. It would be highly unlikely for the serotype of AVV used in our experiments, i.e. AAV6, to be transferred intact across cells
via mechanisms such as transcytosis [
35]. Lack of cell bodies immunoreactive for hα-syn and lack of transcriptional AAV markers in brain regions rostral to the MO not only indicate specific transduction but also rule out the possibility that translocation of viral vectors rather than neuron-to-neuron transfer of hα-syn may underlie caudo-rostral spreading of the exogenous protein. Strong evidence supporting lack of transmission of viral particles also came from experiments in which rats received vagal injections of GFP- rather than hα-syn-AAV; in contrast to results in animals transduced with hα-syn, protein spreading was not observed in GFP-AAV-treated rats [
12].
Overexpression of hα-syn caused by injections with either hα-syn-AAV prep 1 or prep 2 triggered caudo-rostral propagation as indicated by the finding that hα-syn-positive axons became progressively evident in the pons, midbrain and forebrain. Spreading after treatment with hα-syn-AAV prep 1 or prep 2 was consistently observed within areas such as the coeruleus–subcoeruleus complex (pons), dorsal raphae (midbrain) and amygdala (forebrain). Of note, the substantia nigra pars compacta (SNc) was not one of these predilection targets for hα-syn propagation. A likely explanation for these findings relates to anatomical brain connections since hα-syn-immunoreactive axons were primarily seen in regions with direct projections into the MO [
30-
34,
36]. At the two time points considered in this study (6 and 12 weeks post treatment), spreading and accumulation of hα-syn beyond the MO affected neuritic projections while apparently sparing neuronal cell bodies; pathological changes were also evident in the form of enlarged dystrophic axons. Interestingly, a preferential axonal burden, as seen in this model of protein spreading, appears to be a feature common to a variety of experimental paradigms involving α-syn toxicity [
9,
37,
38]. Greater vulnerability to neuritic accumulation/pathology could result, at least in part, from impaired degradation of axonal α-syn together with α-syn-induced disruption of axonal transport motor proteins [
38,
39]. Lack of cell body pathology and lack of hα-syn spreading to the SNc may be perceived as limitations of this experimental paradigm to reproduce PD features. On the other hand, findings are also consistent with the interpretation that this model of α-syn propagation triggered by protein overexpression in the MO mimics pathogenetic events that occur early in the disease process; early lesions may target axonal projections, involve a single trans-synaptic passage of α-syn and temporarily spare SNc neurons.
Conclusions
Our present finding that spreading of hα-syn occurred after transduction with either hα-syn-AAV prep 1 or prep 2, i.e. in the presence or absence of neuronal injury/death, bears significant implications. Similarly, it is noteworthy that (i) the count of hα-syn-positive axons was much lower in the pons, midbrain and forebrain of rats injected with hα-syn-AAV prep 1 as compared to prep 2, and (ii) propagation of the exogenous protein toward regions rostral to the MO was less advanced when, as a consequence of hα-syn-AAV prep 1 administration, protein overexpression was associated with enhanced toxicity. Taken together, these results support the conclusion that release from damaged cells is not essential for, neither it enhances interneuronal hα-syn propagation. Data in our model are also consistent with an inverse correlation between neuronal injury and hα-syn spreading. Mechanisms underlying this effect are unclear. It is conceivable that an enhanced stress response within dying cells (e.g., changes in protein degradation) may negatively modulate hα-syn transmission. An alternative and possibly complementary explanation is that neuron-to-neuron α-syn passage involves active mechanisms between relatively healthy cells and is therefore most efficient when neuronal integrity is maintained. Important corollaries to this latter interpretation include the facts that (i) neuronal activity in the form, for example, of synaptic transmission may modulate α-syn propagation [
6,
40], (ii) specific mechanisms, such as exocytosis, could play a role in protein release and subsequent α-syn transmission [
14-
16], and (iii) future work aimed at elucidating these mechanisms has the potential to identify new targets for therapeutic intervention against protein spreading in human synucleinopathies.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
AU designed experiments, performed surgeries and carried out histological analyses and axonal counts; REM and MH set up and performed other quantitative histological analyses (e.g., stereological cell counting and measurements of cell volume); RR and MK set up and performed molecular biology analyses; AS assisted with AAV preparations; DADM designed experiments, analyzed data and wrote the paper with input from the other authors. All authors read and approved the final manuscript.