Background
Trigeminal nerve injury is one of the most serious complications in clinical orofacial operations, with an incidence of 0.5% to 37% [
1]. About 50% of patients with trigeminal nerve injury have orofacial neuropathic pain (NP), which seriously affects their life quality [
2,
3]. Due to the lack of effective intervention targets, clinical therapy is often unsatisfactory [
4]. Therefore, it is of great importance to find new therapeutic targets and strategies for orofacial NP.
Long non-coding RNAs (lncRNAs) are involved in various physiological and pathological processes [
5,
6]. Dysregulated expression of lncRNAs in the dorsal root ganglion (DRG), trigeminal ganglion (TG), and spinal dorsal horn has been detected in the preclinical models of NP [
7,
8]. The imbalances of lncRNA transcription affect neuronal excitability and participate in the development of NP [
9,
10]. Antisense oligodeoxynucleotides of lncRNAs have been reported to relieve nerve injury-induced hyperalgesia, indicating that lncRNAs are potential therapeutic targets for NP [
11]. Our previous study have demonstrated the dysregulated IncRNAs in the TG of mice with orofacial neuropathic pain [
12]. However, the functions of the above differentially expressed lncRNAs (DE lncRNAs) and their mechanism underlying orofacial NP remain to be further determined.
Post-transcriptional regulation mediated by RNA-binding proteins (RBPs) is an important regulatory pathway of lncRNAs [
13]. DEAH box polypeptide 30 (DHX30) belongs to RNA helicases, which contribute to mRNA metabolism including ribosome biogenesis, global translation, and mitochondrial metabolism [
14]. As an RBP, DHX30 was believed to participate in RNA-protein interaction [
15]. The interaction between helicases and non-coding RNAs further expanded its biological functions [
16,
17]. The regulation of mRNAs mediated by RBPs and the role of non-coding RNAs in this process is a relatively nascent field [
18]. The interaction of DHX30 with non-coding RNA has not been reported yet, thus it is interesting how they contribute to NP.
Melanocortin receptor 1 (MC1R) is a G protein-coupled receptor originally found in melanocytes, which has been well-investigated in regulating pigmentation, UV responses, and melanoma risk [
19]. Recently, the new function of MC1R in nociception was observed [
20]. Mogil et al. [
21,
22] reported the role of MC1R in pain for the first time, that humans and mice with loss of MC1R function were less sensitive to pain and had increased sensitivity to opioid analgesics. In humans, MC1R variants rs3212361 and rs885479 contributed to decreased orofacial pain sensitivity [
23]. Besides, the intraventricular injections of α-MSH, which is the endogenous agonist of Mc1r, caused hyperalgesia, and injection of Mc1r antagonism also led to a high nociceptive threshold in wild-type mice similar to that of Mc1r
e/e mice [
24,
25]. Therefore, MC1R may be a potential regulatory target in pain sensation. However, the underlying regulation mechanisms of MC1R remain limited.
In this study, the responsive expression of lncRNA Anxa10-203 in the TG neurons in mice with orofacial NP was reported. We focused on the RNA-protein interaction mechanism mediated by RBPs and further found that Anxa10-203 regulated the stability of Mc1r mRNA at the post-transcriptional level via recruitment of DHX30, which contributed to orofacial NP.
Materials and methods
Animals
The animal study was approved by the Ethics Committee of West China Hospital of Stomatology Sichuan University (Number: WCHSIRB-D-2022-021) and complies with the ARRIVE 2.0 guidelines. A total of 273 wild-type male C57BL/6 mice and 89 female C57BL/6 mice (6-8 weeks, 20-25g) were used for this study. Every single animal was defined as an experimental unit. All animals were kept in a specific pathogen-free experimental animal center (West China Hospital Experimental Animal Center) on a 12:12 light-dark cycle at 22 ± 1 °C. Food and water were available at liberty. In all assays, the animals were randomly allocated to the experimental groups using a random number table. The experimenters were blinded for the treatment groups during the analysis of the data in each assay.
Cell culture and transfection
Bilateral TG was dissociated from connective tissue and minced. Then the tissue was enzymatically digested with 8 U/ml papain and incubated at 37°C for 20 minutes. An equal volume of complete medium was added to stop digestion and gently blow the digested tissue fluid several times with a sterile Pasteur pipette to mechanically dissociate neurons. Cell precipitation was obtained by centrifugation and resuspended in the neurobasal medium (Thermo Fischer, USA) containing 2% B27 (Invitrogen, USA) supplements and 1% GlutaMAX (Invitrogen, USA), and then plated in a twelve-well plate coated by poly-D-lysine (Invitrogen, USA) in 37℃ in humidified incubators with 5% CO2 and 95% air. The LV-Anxa10-203 (MOI = 5) and DHX30 siRNA or negative control siRNA (10 nM) were transfected into TG neurons (TGNs) on the second day. The Anxa10-203 oe+siDHX30 was the experimental group, and the Anxa10-203 oe+siNC (negative control siRNA) served as the control group. The LV-Anxa10-203 was purchased from Sangon (Shanghai, China). The siRNA and siNC were synthesized by GenePharma (Shanghai, China) and were transfected with HieffTrans
in vitro siRNA/miRNA Transfection Reagent (Yeasen, China) following the manufacturer’s protocol. The sequences of siRNA are listed in Table
1.
Table 1
The sequences of siRNA/shRNA in this study
siAnxa10-203 | GCCAAUUACUGUACUGAAUTT |
siDHX30-1 | GCUGGAAGGUGAUUCACGATT |
siDHX30-2 | CAAUGAGUACAGCGAGGAATT |
siNC | UUCUCCGAACGUGUCACGUTT |
AAV2/9-CMV-GFP-shDHX30 | CAATGAGTACAGCGAGGAA |
AAV2/9-CMV-GFP-shNC | CCTAAGGTTAAGTCGCCCTCG |
Chronic constriction injury of the infraorbital nerve (CCI-ION) surgery
Mice were anesthetized with isoflurane. For the CCI-ION group, two chronic gut ligatures (5-0) were placed loosely around the infraorbital nerve (ION) [
26]. For the Sham group, the same surgical procedures were operated without ligation of the ION. The incision was sutured with 5-0 silk. The mice were placed on a heat recovery pad until they awoke from the anesthesia. Animals were monitored at least once daily after surgery.
TG microinjection
The TG microinjection of mice was performed according to our previous study [
27]. Briefly, after anesthesia, the siRNA Anxa10-203 (0.5 ug/μl), LV-Anxa10-203 (MOI = 5) or AAV2/9-CMV-GFP-shDHX30 (2E+9 vg/μl) were injected into the TG (coordinates: AP + 1 mm, ML + 4 mm, and DV -6.5 mm relative to bregma) under the guidance of a stereotaxic apparatus, and the maximum injection volume was 2 μl. A negative control siRNA or AAV2/9-CMV-GFP-shNC was used as control. The AAVs were synthesized by Xuanzun Bioscience (Chongqing, China). The siRNA was synthesized by GenePharma (Shanghai, China) and was transfected with Entranster
TM-
in vivo (Engreen Biosystem, China) following the manufacturer’s protocol.
Behavioral tests
The Von Frey test was used to measure the 50% head withdrawal threshold (HWT) in response to mechanical stimuli according to our previous studies [
27]. In brief, a series of Von Frey filaments were applied to the whisker pad area providing a force ranging from 0.04 g to 4 g. A positive response was recognized as sharp head withdrawal. The test was performed blinded.
Reverse transcription and quantitative PCR
RNAiso regent (Takara, Japan) was used to obtain total RNA. cDNA was synthesized using PrimeScript™ RT reagent Kit (Takara, Japan). The RT-qPCR was performed by QuantStudio 7 Flex System (Applied Biosystems, USA). The primer sequences used are listed in Table
2. The relative expression of the target gene was normalized to GAPDH and calculated with the 2
-ΔΔCT method.
Table 2
The primer sequences used in this study
Anxa10-203 | CCCACAACTTTGGCTGGGTA | TTCTGGGTGACATTTCCTCTTT |
Mc1r | TCCTCGTGCCTCTATGGTGA | CTGGCCAAGGTTACGGATGT |
DHX30 | CTGGAGACTGTGTGGGTGTC | AGGTTCTCAAGAGGTGTGCG |
GAPDH | AACAGCAACTCCCACTCTTC | CCTCTCTTGCTCAGTGTCCT |
U6 | GGAACGATACAGAGAAGATTAGC | TGGAACGCTTCACGAATTTGCG |
Anxa11-204 | TGGGAGGTTTAGTTGGTGTAAG | TGAAGAGCGTTGGAGATGATAG |
Zbtb20-213 | TGCCTGAACTTTGAAGCTGT | TGGGAAGACACCATCACCTCA |
Tmem87a-204 | TCGTTTCTTGGTGCAGGTCC | CTCTCCATCAACGACGGCAT |
A630023A22Rik-202 | AGAAACAAGCTCCTACATACACCA | TCCTGTCAAAGATCAGGCGG |
Slc44a1-207 | TCCAAACGAGAATGGAAGCCA | AAAGAACACATACCATCCCAATGC |
Fez2-207 | GCATTAGGGCTTCAGCAATGG | CCATGCCTCCTCGCATGAAT |
Zbtb20-211 | CCCGTCTCTGTGGTTTGTAAGG | TGACTGCCTGCCTCCCTAAT |
TCONS_00110517 | AGAGGTGTTCCAACATGCCA | AGGAAGGATGGTTTCGAGCA |
TCONS_00090863 | CAGAGGCTCTTTACTGGAACCT | AAGTTAGAGCTAATTGCAGCCC |
Exosc10-206 | TGCTGTAACCCAGTACCACC | ACACTGTACCTCGGCGCTA |
TCONS_00081846 | GGACCTTTCAGGCCAAGCTAA | CAACACTGGGATGTGTAGCTCT |
Farp1-204 | GAAGGTTCTGTTTGACGCCG | TGCTTCGGTCCACGATCTTC |
Cars2-211 | TCCACATTCTGCACAAGGGAC | CAGACCTGGAGTAACCTGCAA |
TCONS_00261817 | TGCAGAACACATTTGCCACAG | CCACTGCAGGATGCGATCT |
Subcellular cell fraction
The cytoplasmic and nuclear fractions of the TG were collected using a Nuclear and Cytoplasmic Extraction Reagents Kit (Beyotime, China) following the manufacturer’s protocol. RNA from cytoplasmic and nuclear fractions was extracted with RNAiso regent and analyzed by RT-qPCR. U6 and Gapdh were defined as nuclear and cytoplasmic control respectively.
Immunofluorescence (IF) staining
The frozen sections were washed and permeabilized. The slices were blocked with 10% goat serum and then incubated with primary antibody overnight at 4℃. After washing with PBS, the sections were then incubated with a secondary antibody for 1 h. The images were captured with a laser scanning confocal microscope (LSCM, Olympus FV3000, Japan). The antibodies used are listed in Table
3.
Table 3
The antibodies used in this study
anti-NeuN | Abcam, ab279296 | 1:1000 |
anti-MAP2 | Abcam, ab254264 | 1:2000 |
anti-glutamine synthetase | Abcam, ab176562 | 1:1000 |
anti-CGRP | Cell signaling technology, 14959T | 1:1000 |
IB4 | Sigma, L214 | 1:100 |
Streptavidin-FITC | Sigma, S3762 | 1:100 |
anti-MC1R | Genetex, GTX108190 | 1:500 |
anti-DHX30 | Abcam, ab85687 | 1:2000 |
anti-α-TUBB | Proteintech, 11224-1-AP | 1:2000 |
peroxidase-conjugated secondary antibody | Signalway antibody, L3012 | 1: 5000 |
RNA fluorescent in situ hybridization (RNA-FISH)
The fluorescence-conjugated probe for Anxa10-203 and Mc1r RNA was synthesized from GenePharma (Shanghai, China). After permeabilizing with 0.5% Triton, the tissue was incubated in a prehybridization solution then followed by a hybridization solution containing a 20 uM probe overnight at 37℃. the slides were finally washed with SSC solution. A LSCM (Olympus FV3000, Japan) was used to acquire the images.
Western blot (WB) analysis
The samples were homogenized in a lysis buffer with protease inhibitors. The proteins were separated on 10% SDS/PAGE gel and then transferred to PVDF membranes. The membranes were blocked by 10% non-fat milk and incubated with the primary antibodies at 4℃ overnight, and further incubated with a secondary antibody. The antibodies used are listed in Table
3. Quantification of immunoblots was measured by ImageJ. The relative expression level of the target protein in all groups were normalized to α-Tubulin.
RNA pull-down
The RNAs of the Anxa10-203, Mc1r, and four Anxa10-203 sequence segments were in vitro transcribed (Vazyme, China) and biotinylated (Thermo Scientific, USA). The Pierce magnetic RNA-protein pull-down kit (Thermo Scientific, USA) was used. Briefly, the biotinylated RNA was bonded to streptavidin magnetic beads (Thermo Scientific, USA). The TG lysates from CCI-ION mice were added into RNA-conjugated beads and incubated overnight at 4℃ with agitation. The RNA-interacting proteins were eluted and then analyzed by liquid chromatography-mass spectrometry (LCMS) and/or Western Blot. The input of the antisense RNA was defined as positive control and negative control separately.
RNA immunoprecipitation (RIP)
Magna RIP Kit (Millipore, USA) was used to conduct the RNA-binding protein immunoprecipitation assay according to the manufacturer’s instructions. Briefly, the TG of CCI-ION mice was lysed by RIP lysis buffer. The magnetic beads conjugated with anti-DHX30 antibody were incubated with the tissue lysates on a rotator at 4℃ overnight. The magnetic beads conjugated with anti-IgG served as a negative control. The RNA was eluted from the beads, and the expression of Anxa10-203 and Mc1r was analyzed by RT-qPCR.
Nascent protein synthesis assay
Click-iT Plus OPP Protein Synthesis Assay Kit (Invitrogen, USA) was applied. The Anxa10-203 oe+siDHX30 was the experimental group, and the Anxa10-203 oe+siNC served as the control group. The OPP working solution was added to the culture medium and incubated for 30 minutes. Then the cells were fixed and permeabilized. After washing, the OPP reaction cocktail was added and incubated for 30 minutes at room temperature. Images were acquired by LSCM (Olympus FV3000, Japan) and the relative fluorescence unit was assessed by a microplate reader (SpectraMax iD3, Molecular Devices, USA).
Whole-cell patch-clamp recording
The electrophysiology was recorded by an Axopatch-700B amplifier and a Digidata 1440 digitizer (Molecular Devices, USA). The MC1R agonist BMS-470539 (BMS, 100 nM, MedChemExpress, China) was used, and the extracellular solution without BMS was defined as control [
28]. The extracellular solution consisted of (in mM) NaCl 150, KCI 5, CaCl
2 2.5, MgCl
2 2, HEPES 10, and D-glucose 10 (pH = 7.4 by NaOH, 330 mOsm/L). The intracellular pipette solution contained (in mM) KCl 140, CaCl
2 1, MgCl
2 2.5, HEPES 10 and D-glucose 10, EGTA 11, Mg-ATP 5 (pH = 7.2 by NaOH, 310 mOsm/L). The resting membrane potential (RMP) was recorded for 3 min. The currents from -120 pA to 170 pA with an increment of 10 pA were injected into TGNs to evoke action potential (AP) [
29]. The rheobase current was defined as the minimum current required to evoke the first AP. The AP threshold was obtained at d
V/d
t= 10 mV/ms. The action potential-related parameters including AP latency, the AP amplitude, AP half-width, afterhyperpolarization (AHP) time, and AHP amplitude are measured.
Statistical analysis
Data were expressed as mean ± standard deviation. A two-tailed student’s t-test was conducted to compare the differences between the two groups. A repeated-measures ANOVA was used to detect the effect on HWT from both treatment effect and time effect, followed by one-way ANOVA for the difference between groups at each time point. Two-way ANOVA was applied to detect the expression level of genes from both treatment and time effect, followed by one-way ANOVA for differences between groups at each time point. And one-way ANOVA with the least significant difference (LSD) test was applied to analyze the differences among multiple groups. Statistical analyses were performed using GraphPad Prism software (v8.0.1, United States). P < 0.05 was considered as a statistical significance.
Discussion
In this study, we focused on the function of lncRNAs in the TG of mice with orofacial pain. CCI and nerve transection provide stable and repeatable models for preclinical studies of NP [
32,
33]. Considering entrapment, compression, and stretching are common causes of NP in the clinic, CCI-ION is an appropriate model for orofacial NP research [
34]. Based on the preclinical models, our study confirmed that Anxa10-203 was up-regulated in the TG of CCI-ION mice and the knockdown of Anxa10-203 relieved pain, suggesting that Anxa10-203 in the TG played a vital role in orofacial NP. Further investigation indicated that Anxa10-203 interacted with DHX30 and enhanced
Mc1r mRNA stability, resulting in the up-regulated expression of MC1R that promoted the TGNs excitability and orofacial NP. These findings provided primary data for novel potential targets of NP intervention.
As a molecular scaffold, lncRNAs interact with macro-molecules and form functional complexes, so it is easy to speculate the interaction between lncRNAs and RNA helicase [
13,
16]. Our study confirmed the interaction between DHX30 and lncRNA Anxa10-203 and revealed its function in
Mc1r mRNA decay. We further verified the Anxa10-203/DHX30 complex and preliminarily showed that Exon 8 of Anxa10-203 may be the main sequence interacting with DHX30 using RNA pull-down. However, the RNA synthesized
in vitro and the RNA
in vivo may be different in secondary and tertiary structures, and most RNA helicases lack inherent sequence or structural specificity [
35,
36]. Therefore, a multidisciplinary method was needed to characterize the exact binding site of DHX30 and Anxa10-203. The combination of X-ray crystallography and high-resolution cryo-electron microscopy should be an appropriate strategy [
37].
DHX30 belongs to RNA helicases, which are generally believed to unwind secondary, tertiary structures of RNA, and participate in RNA-RNA, and RNA-protein interaction [
38]. The role of DHX30 in the metabolism of RNA and protein has been reported in different cells [
39]. In this study, we explored the role of DHX30 in post-transcriptional regulation in TGNs. It was found that the half-life of
Mc1r mRNA decreased after DHX30 knockdown with Anxa10-203 over-expression, but no obvious impact on the synthesis of nascent proteins was observed. Therefore, DHX30 was involved in maintaining the stability of
Mc1r mRNA under the experimental conditions. However, previous studies have found that over-expression of DHX30 mutants in HEK293T and human U2OS cells reduced global translation [
14,
40]. The same result was also confirmed in cancer cell line models of HCT116, SJSA1, and MCF7 [
41,
42]. As observed in other helicase families, the interaction between DDX3 and eIF4G acted as both inhibitor and activator of translation [
43]. Thus the ultimate function of DHX30 may depend on the interaction between different RNA-binding proteins or complexes [
38]. In addition, although RNA helicase had some cross-species functions, it was worth noting that these experimental data came from different species, cells, and conditions, therefore, the contradictory results are not unexplainable.
Like most G protein-coupled receptors (GPCRs), MC1R is cascaded and coupled with several intracellular signals [
44]. It was reported that activation of MC1R led to increased cAMP expression in CATH.a cell line and rat primary hypothalamic neurons [
20,
45]. The increase of cAMP in neurons is usually related to increased pain, and drugs that reduce cAMP synthesis have an analgesic effect [
46,
47]. Based on the results of the above studies, MC1R seems to promote neuropathic pain by activating cAMP, but there is no direct evidence that MC1R-induced cAMP is involved in the occurrence of neuropathic pain, and the derivation based on the conclusions of different studies needs to be cautious. In addition, some studies suggested that MC1R-mediated cAMP signal cascade and the transcription of Mc1r mRNA, each appeared to primarily affect hair color and pain sensitivity respectively [
23]. Therefore, whether MC1R-induced cAMP/AKT pathway activation is involved in neuropathic pain is an interesting question, and complete research is needed to explore this issue.
Recently, several studies showed that MC1R was located in the DRG, dorsal horn, periaqueductal gray matter (PAG), hypothalamus, dorsal hippocampus, and cerebral cortex, among which DRG, dorsal horn, and PAG are important nociceptive relays [
48,
49]. These results indicated the physiological basis of the involvement of MC1R in pain. Mechanically, it was reported that MC1R participated in nociceptive sensory by affecting melanocortin/opioid signaling balance [
20]. α-MSH, the main endogenous agonist of MC1R, is produced by the decomposition of pro-opiomelanocortin (POMC), while POMC decomposition also yields β-endorphin, an endogenous opioid agonist [
23,
50]. Thus, it is plausible that reduced levels of MC1R may signal for an upregulation of POMC, which increases the availability of the opioid agonist and its analgesic activity [
23]. However, whether this mechanism is also applicable in the peripheral nervous system needs further research, because the source of endogenous POMC in the peripheral nervous system is not clear [
51]. This study confirmed that MC1R activation enhanced the intrinsic excitability of neurons in the peripheral ganglion and contributed to nociceptive sensory. Since the pigment function of MC1R seems less important in the TG, MC1R may be a specific target for pain intervention with little effect on physiological function.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.