Background
Glioma is the most frequently diagnosed primary brain tumor with the most terrible clinical prognosis among all brain tumors [
1]. The advancement in diagnostic and surgical techniques improves the median survival and 2-year survival rate of glioma patients, however, the 5-year overall survival rate is only 9.8%, even with concomitant adjuvant temozolomide (TMZ) and radiotherapy [
2‐
4]. Extracellular vesicles (EVs), including exosomes, have been reported to participate in cancer progression through facilitating the intercellular transfer of exosomal contents which are responsible for cell proliferation, migration, invasion, angiogenesis, and chemoresistance [
5]. Fortunately, through analyzing the cargo loaded exosomes, the tumor growth could be tracked and predicted to allow early treatment for diseases [
6]. Exosomes could carry a significant amount of nucleic acids, including mitochondrial DNA, mRNA, long noncoding RNAs (lncRNA), small nuclear RNAs and microRNA (miRNAs) [
7]. Dysregulation of lncRNA is linked to cancer progression including apoptosis, metabolism, progression and metastasis [
8].
As non-coding RNAs at the length of over 200 nucleotides, lncRNAs are viewed as peripheral biomarkers in cancers [
9]. Recent study reported that many lncRNAs could regulate tumor progression through “lncRNA-miRNA-mRNA” mode [
10]. As a dominant regulator of glioma cell autophagy, LINC00470 promoted the expression of ELFN2 through sponge of miR-101 to distract glioma cell autophagy [
11]. Activation of autophagy might be a clinical objective that contributes to therapeutic efficiency of immunogenic chemotherapy and/or radiation therapy [
12]. Previous studies have demonstrated that discoidin domain receptor tyrosine kinase 1 (DDR1) could sensitize glioma cells to therapies through its efficient induction of autophagic cell death [
13,
14]. As an evolutionarily conserved process, autophagy is responsible for maintaining control of intracellular components through degradation mediated by lysosome, and in the processes of cellular and tissue repair, autophagy mainly protects against stresses and diverse pathologies including cancer [
15]. Nevertheless, how LINC00470 regulates cell autophagy in glioma remains to be determined. Furthermore, cell autophagy in glioma involves the activation of PI3K/AKT/mTOR signaling network [
16]. Inhibiting autophagy-related apoptosis by Cathepsin S has been proven as an effective therapeutic strategy for glioma through inhibition of PI3K/AKT/mTOR/p70S6K signaling pathway and activation of JNK signaling pathway [
17]. But how PI3K/AKT/mTOR signaling pathway was activated and whether LINC00470 can regulate PI3K/AKT/mTOR signaling pathway in glioma are potential uncertainties for a better understanding of glioma.
In this study, we aimed to explore the role and mechanism of exosomal LINC00470 from serum of glioma patient in both cellular and animal models. The results demonstrated that LINC00470 in serum exosomes from glioma patients, through competing with WEE1 to bind miR-580-3p, could augment proliferation and impair the autophagy of glioma cells via activating PI3K/AKT/mTOR signaling pathway.
Materials and methods
Ethical statement
The study was conducted in accordance with the Declaration of Helsinki. The study protocol was approved by the Ethic Committee of the Second Xiangya Hospital, Central South University. All the patients provided their written informed consents. This design of clinical and animal experiments was approved by local commitment of the Second Xiangya Hospital, Central South University and was strictly implemented according to institutional guidelines. Experiments were performed in a humanistic way.
Cell culture
Glioma cell lines (U251 and SWO-38) were obtained from the Cell Bank of Shanghai Institutes of Biochemistry and Cell Biology, Chinese Academy of Sciences. Cells were cultured in DMEM (Thermo Fisher Scientific, Wilmington, DE, USA) containing 10% FBS at 37 ℃ and 5% CO2 atmosphere.
Exosome extraction and identification
We examined the expression of LINC00470 in the serum from 45 glioma patients and 10 health checkers (HCs) in our hospital. According to the WHO classification of tumors of central nervous system (CNS) (2016), the included glioma patients were classified into grade I ~ II (n = 18) and grade III ~ IV (n = 27). Exosomes derived from serum of glioma patients (patients in grade IV) and HCs were isolated by an ExoQuick kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol, and named GBM-exo and HC-exo, respectively. Afterwards, the suspension was added onto the grid. After being placed for 1 min, the suspensions were negatively stained with 3% (w/v) sodium phosphotungstate solution for 5 min at room temperature and then washed and dried at room temperature for observation under a transmission electron microscope (TEM) (CM-120, Philips, Eindhoven, Netherlands).
Identification of exosomes: the expression levels of exosome markers (CD9, CD63 and CD81) were detected by Western blotting and flow cytometry (FCM) (primary antibodies for Western blotting were diluted at 1:1000). FCM: 100 μl of exosome suspension was incubated with primary antibodies against CD9 (ab2215, 1:200, Abcam), CD63 (ab59479, 1:200, Abcam) and CD81 (ab79559, 1:1000, Abcam) for 30 min and with corresponding secondary antibody (FITC-coupled goat anti mouse IgG, ab6785, 1:1000, Abcam) for 30 min before being detected by flow cytometry. Particle size distribution was analyzed by NanoSight NS300 instrument (Malvern, UK). After being labeled by PKH67 (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany), the exosomes were incubated with DAPI (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) labeled U251 cells for 24 h to observe the uptake of exosomes by U251 cells. Exosomes were treated with RNase or RNase + TritonX-100 and then the expression of LINC00470 was measured.
Animals
Specific pathogen free (SPF) BALB/c nude mice (n = 24, 4–6 weeks old, 16 ± 2 g) were purchased from Shanghai Laboratory Animal Science Center, Chinese Academy of Sciences. All materials including padding, water and pellet feed were sterilized by autoclave. All experimental mice were housed in a SPF laminar air flow room at constant temperature (22 ℃–26 ℃) and humidity (55 ± 5%).
Mouse glioma model
U251 cells were infected with lentivirus containing luciferase and green fluorescent protein (GFP). FCM was used to select cell lines with stable expression of GFP-Luc. Nude mice were randomly separated into three groups (HC-exo group, GBM-exo group and sh-LINC00470-GBM-exo group) and then anesthetized through intraperitoneal injection of pentobarbital Sodium (60 mg/kg). After anesthesia, skin of the mouse heads was sterilized with iodine before the mice were fixed by stereotaxic apparatus. An incision was conducted longitudinally 3 mm right to the midline of the head, moving towards the animal’s ears to expose skull. A drill hole was made and a sterilized microinjector with U251-GFP-Luc cell suspension (1 × 106) was fixed on the stereotaxic apparatus. The suspension was added through the stereotaxic apparatus after the syringe needle was inserted into a total depth of 2 mm below the surface of the brain. After injection, the drill holes were blocked with bone wax and the incisions were sutured before being sterilized. The mice were housed in their cage after anesthesia emergence. Mice in the GBM-exo group or HC-exo group were injected with 100 μl of U251-GFP-Luc cell suspension which had been cultured with serum exosome derived from glioma patients or HCs for 24 h, while mice in the sh-LINC00470-GBM-exo group were injected with U251-GFP-Luc cell suspension that had been incubated with serum exosomes derived from glioma patients for 24 h and transfected with sh-LINC00470.
In vivo imaging system
The reactions of mice were regularly monitored and 10 μl/g of D-luciferin (at the concentration of 15 mg/ml) was intraperitoneally injected in mouse at the 0, 7th, 14th, 21th and 28th d of U251-GFP-Luc cell inoculation. In vivo imager (IVIS Spectrum, Caliper, USA) was used for color development and to observe changes in luminescence signal to analyze tumor progression.
Hematoxylin eosin (H&E) staining and immunohistochemistry (IHC)
Tumor tissues were fixed with 4% of paraformaldehyde for 48 h before being sliced into paraffin sections (4 μm). The sections were subjected to H&E staining and IHC staining. After H&E staining, histopathological features of these sections were observed under an optical microscope. In brief, the sections were baked for 30 min and dewaxed with xylene before being washed with distilled water. Then, the sections were incubated with Ki-67 rabbit monoclonal antibody (ab16667, 1:200, Abcam, Cambridge, MA, USA) at 4 ℃ overnight after being washed with PBS for 1 min. The sections were cultured with corresponding secondary antibody for 1 h at room temperature after being washed with PBS three times. Following color development by DAB for 1 ~ 3 min, the nuclei was stained by hematoxylin for 1 ~ 3 min, and the sections were subjected to dehydration, permeabilization and mounting. Ki-67 is located in cell nucleus with yellow or brown granules within the cell nucleus. The percentage of Ki-67 positive cells was calculated in 5 high-power fields (× 400).
Cell transfection
PcDNA3.1-LINC00470, pcDNA3.1-WEE1, sh-LINC00470, miR-580-3p mimic, miR-580-3p inhibitor and their negative controls (pcDNA3.1, mimic NC or inhibitor NC) were obtained from Shanghai GenePharma Co., Ltd (Shanghai, China). Transfection was performed by using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instruction. Cells were divided and named according to the transfected plasmids, including pcDNA3.1-LINC00470 group, pcDNA3.1-WEE1 group, pcDNA3.1 group, sh-LINC00470 group, sh-NC group, miR-580-3p mimic group, mimic NC group, miR-580-3p inhibitor group, and inhibitor NC group.
qRT-PCR
TRIZOL (Invitrogen, Carlsbad, CA, USA) was used for RNA extraction and a reverse transcription kit (TaKaRa, Tokyo, Japan) for reverse transcription according to the instruction. The RNA expression levels of miR-580-3p, LINC00470 and WEE1 were detected by LightCycler 480 (Roche, Indianapolis, IN, USA) and the reaction conditions were prepared in accordance with the instruction of the fluorescent quantitative PCR kit (SYBR Green Mix, Roche Diagnostics, Indianapolis, IN). Parameters of thermal cycle were: 95 ℃ for 10 s, 45 cycles of 95 ℃ for 5 s, 60 ℃ for 10 s and 72 ℃ for 10 s, followed by extension at 72 ℃ for 5 min. Each quantitative PCR amplification was repeated for 3 times. U6 or GAPDH was taken as the internal reference. 2
−ΔΔCt method was used for statistical analysis. ΔΔCt = experiment group (Ct
target gene–Ct
internal reference)–control group (Ct
target gene−Ct
internal reference). The primers of the genes and its internal reference are quoted in Table
1.
Table 1
Primer sequences for quantitative reverse transcription polymerase chain reaction
miR-580-3p-F | GACTATCGGGACATGTTA |
miR-580-3p-R | GCAGGGTCCGAGGTATTC |
U6-F | CTCTCGCTTCGGCAGCACA |
U6-R | ACGCTTCACGAATTTGCGT |
LINC00470-F | TTGGCAGCTGCTCTACAGTC |
LINC00470-R | TGAAAATCCAGCCAGGGGTC |
WEE1-F | TAGGTAAGGAGGCCTGTCCC |
WEE1-R | TTTGAACACACGCAACGCAT |
GAPDH-F | GCAAGGATGCTGGCGTAATG |
GAPDH-R | TACGCGTAGGGGTTTGACAC |
Western blotting
Total proteins were obtained using ratio-immunoprecipitation assay (RIPA) lysis buffer (Beyotime). After protein concentration was measured by a bicinchoninic acid (BCA) protein assay kit (Beyotime), loading buffer and protein were mixed and denatured in boiling water bath for 3 min. Extracted protein samples were separated by electrophoresis at 80 V for 30 min, and then the electrophoresis was run to 120 V for 1–2 h when bromophenol blue migrated to the separation gel. Membrane transferring was conducted in an ice bath at 300 mA for 60 min. Afterwards, the membrane was rinsed with washing solution for 1– 2 min followed by incubation with 5% skimmed milk at room temperature for 60 min or at 4℃ overnight. Primary antibodies against GAPDH (5174S, 1:1000), WEE1 (13084S, 1:1000), LC3-I/LC3-II (12741S, 1:1000), Beclin1 (3495S, 1:1000), p62 (88588S, 1:1000), PI3K (4249S, 1:1000), p-PI3K (p85, Tyr458) (17366S, 1:1000), AKT (4685S, 1:1000), p-AKT (Ser473) (4060S, 1:2000), mTOR (2983S, 1:1000), p-mTOR (Ser2448) (5536S, 1:1000) (Cell Signaling, Boston, USA) were incubated with the membranes at a shaking bed for 1 h at room temperature before being washed with washing solution for 3 × 10 min. Corresponding secondary antibody (goat anti-rabbit-IgG labeled with horseradish peroxidase, 1:5000, Beijing ComWin Biotech Co. Ltd, China, Beijing) was added for incubation for 1 h at room temperature followed by washing for 3 × 10 min. After color developement, the membranes were detected by chemiluminescence imaging system (Bio-rad).
CCK-8
After cell transfection for 24 h, U251 cells in each group were inoculated onto 96 well plates and 100 μl of diluted suspension (1 × 106/ml) was added into each well (three repetitions for each group). After incubation for 24 h, 48 h, 72 h and 96 h, 10 μl of CCK-8 reagent (Tokyo, Dojindo, Japan) was added into each well and incubated with the cells for 2 h. Then, the absorbance was detected at 450 nm wavelength.
Twenty-four hours after cell transfection, cells were collected and digested using trypsin. The cells were centrifuged at 1500 rpm for 5 min at 25 ℃ and re-suspended with complete medium. Cells (500/well) were added onto 6 well plates containing 2 ml of pre-heated (37 ℃) complete medium and incubated at 37 ℃ with 5% CO2 for 2–3 weeks. Cells were ceased to culture after cell clones could be seen by naked eyes in the 6 well plates. Then, the culture medium was removed and the cells were washed with PBS twice carefully. Methanol (1.5 ml/well) was added to fix the cells for 15 min. After fixation, the methanol was discarded, and Giemsa stain (1 ml) was added along the well to stain cells for 20 min in dark. Cells were then washed in running water to remove the excessive dye. Turn the 6-well plate upside-down on absorbent paper. The number of clones was counted under a microscope (low power lens).
Detection of cell cycle by FCM
U251 cells, after the transfections for 24 h, were subjected to centrifugation at 1000 rpm for 10 min before being washed with 3 × PBS. Cell suspension was fixed using ethyl alcohol (70%) for 1 h and then centrifuged to discard the ethyl alcohol. After being rinsed with PBS, the cells were incubated with DNAzyme-free RNAase (final concentration at 100 μg/ml) and propidium iodide (PI) (final concentration at 20 μg/ml) in dark for 30 min. DNA content was measured using FCM (EPICS-XL, Beckerman Coulter, USA).
Monodansylcadaverin (MDC) staining
Transfected U251 cells were incubated in fresh culture medium containing MDC (50 μM) in a 37℃ incubator with 5% CO2 for 20 min in dark, followed by 2 × PBS washes. U251 cells were then stained by DAPI for 5 min away from light and washed in PBS twice. U251 cells were observed and photographed under an inverted microscope, and the fluorescence intensity was analyzed. Autophagy was activated in response to 12 h treatment of Rapamycin (200 nM) (Rapa, Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) treatment.
Dual luciferase report assay
The binding sites of LINC00470 and miR-580-3p were predicted by DIANA TOOLS LncBase Predicted v.2 (
http://carolina.imis.athena-innovation.gr/diana_tools/web/index.php?r=lncbasev2/index-predicted) and the binding sites of miR-580-3p and WEE1 by starBase (
http://starbase.sysu.edu.cn/). Wild type (wt-LINC00470 and wt-WEE1) and mutant type (mut-LINC00470 and mut-WEE1) of the binding sites were designed and synthesized. Luciferase report vectors (pGL3-Promoter) were inserted with the wild type or mutant type sequences, prior to co-transfection with miR-580-3p mimic (30 nM) or it negative controls (30 nM) into HEK239T cells (Shanghai Sixin Biotechnology Co. Ltd). Renilla luciferase activity was taken as the internal control. Ratio between firefly luciferase activity and renilla luciferase activity was the relative luciferase activity.
RNA immunoprecipitation (RIP)
Preparation of cells: collected cells were washed with ice-cold PBS twice and centrifuged at 1500 rpm for 5 min before being lysed with RIP lysis buffer. Preparation of magnetic beads: the 50 μl of resuspended beads were pipetted into a centrifuge tube. RIP wash buffer (500 μl) was added into the tube and then the tube was fully shaken. The tube was placed on the magnetic rack and moved left-to-right at 15 degree for bead absorption before the cell suspension was removed. The aforementioned procedures were repeated once more to wash beads. The beads were re-suspended with 100 μl of RIP wash buffer and then incubated with 5 μg of Ago2 antibody (2897S, 1:50, Cell Signaling, Boston, USA) at room temperature for 30 min. Afterwards, the tube was placed on the magnetic rack to remove the supernatant. RIP wash buffer (500 μl) was added, and the tube was shaken by vortexing to discard the supernatant, which was repeated once more. RIP wash buffer (500 μl) was added, and the tube was shaken by vortexing and then placed on ice. The tube containing the magnetic beads was placed on the magnetic rack to remove the supernatant. After that, 900 μl of RIP Immunoprecipitation Buffer was added into the tube. Prepared cell lysate was unfroze and centrifuged at 14,000 rpm and 4 ℃ for 10 min. Cell suspension (100 μl) was added into the tube containing bead-antibody complexes to make the final volume l ml. The mixture was incubated at 4 ℃ overnight and shortly centrifuged. After that, the tube was placed on the magnetic rack and the supernatant was removed. RIP wash buffer (500 μl) was added into the tube on the magnetic rack, after which the supernatant was removed and the complex was washed 6 times. RNA purification: each immunoprecipitate was resuspended in 150 μl of Proteinase K Buffer bead-antibody complex. All samples were incubated at 55 ℃ for 30 min. After incubation for 30 min, the tubes were placed in the magnetic rack and the supernatant was removed. After extraction of RNA, the expression levels of miR-580-3p, LINC00470 and WEE1were measured by qRT-PCR.
Statistical analysis
Statistical analysis was carried out using GraphPad 7.0. Measurement data are presented in the form of mean ± standard deviation. Comparison between two groups was analyzed using T test, while Dunnett’s multiple comparisons test was used for multiple comparisons after One-way analysis of variance. Survival analysis was conducted by Kaplan–Meier, and chi-square test or T test was used to analyze the relationship of LINC00470 with the clinicopathological characteristics of glioma patients. P < 0.05 was viewed as statistically significant.
Discussion
Glioma is a fatal disease featured by diffusive growth, high invasiveness and infiltration to adjacent brain tissue [
16]. Localized treatment for this disease has limited efficiency and therefore glioma demands novel therapeutic approaches [
23]. Herein, we identified that exosomal LINC00470 as an oncogene in glioma that promoted the proliferation of glioma cells by inhibiting glioma cell autophagy. More specifically, we identified LINC00470 can bind to miR-580-3p to regulate WEE1 and thereby regulate PI3K/AKT/mTOR pathway, ultimately mediating cell autophagy in glioma.
By detecting the LINC00470 expression in serum of glioma patients, we found that LINC00470 overexpressed in exosomes from serum of glioma patients. Also, the expression of exosomal LINC00470 positively correlated with the clinicopathological characteristics and negatively associated with postoperative survival of glioma patients, supporting its role as a prognosis biomarker for glioma patients. Thereby, we surmised that exosomal LINC00470 participated in glioma progression. To further validate our findings, we established primary glioma model in nude mouse. The results suggested that GBM-exo strengthened tumorigenic ability of U251. To understand its role in autophagy of glioma, we measured the autophagy related proteins in mouse models. Beclin is an initiation protein of autophagosome and LC3 a structural component of the autophagosomes [
24], and P62 is an adaptor protein, containing an ubiquition-binding association (UBA) domain and an LC3-interaction region (LIR), that targets ubiquitinated substrates to the autophagosome [
25]. LC3 (LC3-I and LC3-II) is essential for the elongation of autophagosomes. LC3-II, localized in both the inner and outer membranes of autophagosomes, increases resulted from LC3-I conversion during autophagy and is viewed as the most reliable marker for quantification of the level of autophagy in cells [
26]. In this study, we found that exosomes from serum of glioma patients can inhibit cell autophagy in nude mouse, evidenced by decreased expressions of LC3-II/LC3-I and Beclin1 and increased p62. As exosomes are carriers of multiple factors, it is necessary to ascertain how serum exosomes can regulate cell autophagy in glioma. As expected, sh-LINC00470 increased the number of acidic autophagosomes and the expression levels of LC3-II/LC3-I and Beclin1, while decreased the expression of p62, corroborating that it was LINC00470 that suppressed autophagy and potentiated proliferation in glioma cells.
Autophagy is a controversial program that promotes or inhibits cancer cell death, depending on the cellular context, however, reduced spontaneous autophagy activity is shown in glioma cells, with low expression and high cytoplasmic score of the autophagy-related marker Beclin-1 [
27]. Therefore, we hypothesized that exosomal LINC00470 modulated glioma cell proliferation through regulating glioma cell autophagy. Admittedly, Rapa is widely used to activate cell autophagy. After overexpression of LINC00470 and the intervention of Rapa, glioma cell autophagy was strengthened while proliferation was impeded, suggesting that LINC00470 mediated glioma cell proliferation through modulating glioma cell autophagy. Nevertheless, the molecule mechanism of LINC00470 regulating autophagy and proliferation was still unclear.
In the cellular experiments, we found a massive decrease in miR-580-3p expression and a significant increase in WEE1 expression in glioma cells. Through using online bioinformatics prediction and dual luciferase reporter assay, we validated that LINC00470 and WEE1 competitively bound to miR-580-3p and the binding of LINC00470 and miR-580-3p could increase the expression of WEE1. MiR-580 is reported to hinder cell migration in breast cancer [
28]. WEE1 activation is considered to be a vital driver of G
2-M transition through inhibiting phosphorylation of Cdc2, and WEE1 inhibition has been verified to suppress glioma progression in adult nude mouse models via advancing mitosis in cells with damaged DNA [
29]. Consistently, in our study, miR-580-3p was reported as a tumor suppressor gene that could impede glioma cell proliferation and augment glioma cell autophagy, while WEE1 could reverse those effects.
In addition, experiments in glioma mouse model unveiled that GBM-exo could activate PI3K/AKT/mTOR signaling pathway, validated by the increased expression levels of p-PI3K/PI3K, p-AKT/AKT and p-mTOR/mTOR. It had been reported that through inactivating PI3K/AKT/mTOR signaling pathway, FK228 sensitizes human glioma cells to TMZ [
30]. Upstream signals, including nutrient signaling, growth factors, energy status, oxidative or endoplasmic reticulum (ER) stress and pathogen infection, are integrated by the serine/threonine protein kinase mTOR (mechanistic or mammalian target of Rapa), which acts upstream of the ATG genes, thus controlling autophagy activation [
31]. LINC00470 positively regulates AKT activation and suppressed nuclear translocation of phosphorylated AKT [
18]. Consistently, GBM-exo, LINC00470 overexpression or miR-580-3p knockdown could activate PI3K/AKT/mTOR signaling pathway, supporting the regulatory role of LINC00470 on PI3K/AKT/mTOR signaling pathway in glioma cells.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.