Background
Hepatocellular carcinoma (HCC) is the sixth most common cancer worldwide and the second leading cause of cancer death in men [
1]. The progression of HCC is characterized by abnormal cell differentiation, fast infiltrating growth, early metastasis, high-grade malignancy, and poor prognosis [
2]. Abnormal metabolism, including abnormal lipid metabolism, is a hallmark of cancer cells. Large amounts of FAs are required to accommodate high rates of proliferation in cancer cells [
3]. Cancer cells can acquire FAs through lipogenic and lipolytic pathways [
4].
Currently, it is believe that adipose triglyceride lipase (ATGL), hormone-sensitive lipase (HSL) and monoacyglycerol lipase (MAGL) are the main enzymes involved in lipolysis [
5]. ATGL initiates the process of triglyceride (TAG) metabolism by hydrolyzing TAG into diacylglycerol (DAG) and FFA. The subsequent step requires HSL, which breaks down DAG into monoacylglycerol (MAG). Finally, MAG is further broken down into FFA and glycerol by MAGL. Daniel et al. revealed that the lipolytic enzyme, MAGL promotes migration, survival, and in vivo tumor growth through the MAGL- free fatty acid (FFA) pathway [
6]. However, other studies indicated that MAGL acts as a tumor suppressor role [
7]. These studies indicate that the role of lipolytic enzymes in tumor progression requires further study. Although, recent studies have revealed that the inhibition of ATGL via RNAi or a small molecule inhibitor attenuated the growth and motility of tumor cells (colorectal cancer cells and non-small cell lung carcinomas cells) [
8], However, whether it contributes to tumor growth, or other functions in HCC remains unclear.
Nuclear paraspeckle assembly transcript 1 (
NEAT1) is a nuclear-enriched lncRNA and is a scaffolding factor that is necessary for the formation of nuclear paraspeckles [
9].
NEAT1 is up-regulated in various types of cancers and has been reported to be associated with unfavorable prognosis in cancer patients [
10].
NEAT1 was demonstrated to function as a competing endogenous RNA (ceRNA) by competitively binding common microRNAs [
11,
12]. Although recent studies have demonstrated that
NEAT1 is overexpressed specifically in HCC [
13], the mechanism through which
NEAT1 affects tumor progression requires further study.
We hereby report that the lncRNA-NEAT1 disrupts HCC cell lipolysis through ATGL. Our results explain the high levels of DAG and FFA present in HCC tissues. ATGL and its products, DAG and FFA, are responsible for NEAT1-mediated HCC cell growth. Additionally, NEAT1 mediates HCC cell growth through the miR-124-3p/ATGL/DAG+FFA/PPARα pathway. Thus, we demonstrate that NEAT1-mediated abnormal lipolysis promotes HCC cell growth.
Methods
Patients and tissue samples
From 2008 to 2012, archival HCC tissues were obtained from patients at the First Affiliated Hospital of Harbin Medical University. Informed consent was obtained from each patient prior to biopsy or surgery, and ethical approval for the use of human subjects was obtained from the Research Ethics Committee of the First Affiliated Hospital of Harbin Medical University. Detailed characteristics of patients were summarized in Additional file
1: Table S1 and Table S2.
Cell lines and culture conditions
The L02 immortalized liver cell line and 293 T was purchased from the Institute of Biochemistry and Cell Biology, Chinese Academy of Science, China. HepG2, Huh7, SK-Hep-1, and HCCLM3 were purchased from the American Type Culture Collection (Manassas, VA, USA). Huh7-luciferase-transfected and HCCLM3-luciferase-transfected cells were purchased from Berthold Technologies. All cell lines were cultured in DMEM supplemented with 10% FBS, 100 units/mL penicillin, and 100 μg/mL streptomycin.
Lentiviral infection
Human Lenti-sh
NEAT1-GFP, Lenti-shPNPLA2-GFP, Lenti-PNPLA2-GFP, Lenti-vector-GFP control and Lenti-sh-control-GFP were designed and purchased from GeneChem Technologies (Shanghai, China). Transfection was performed according to standard procedures. The shRNA sequences used in this study are listed as follow:
-
NEAT1-shRNA#1:GTGAGAAGTTGCTTAGAAA;
-
NEAT1-shRNA#2:TGGTAATGGTGGAGGAAGA;
-
ATGL(PNPLA2)-shRNA#1:AAGTTCATTGAGGTATCTA;ATGL(PNPLA2)-shRNA#2:CTTTACTCCTGAGAACTTT.
Transient transfection
Small interfering RNA (siRNA), si-control, miR-124-3p mimic, miR-124-3p miR-124-3p inhibitor, negative control were purchased from Ribobio (Guangzhou, China). For transfection, miR-124-3p mimic, miR-124-3p inhibitor, negative control, siRNA or si-control in Lipofectamine 2000 (Invitrogen) was transfected into cells according to the manufacturer’s instructions. The siRNA sequences are listed in Additional file
2: Table S3.
Cell proliferation assay
For the Cell Counting Kit-8 assay (CCK-8), cells were seeded at a density of 2500–4000 cells/well in 96-well plates. In vitro cell proliferation was assessed by Cell Counting Kit-8 (Dojindo) according to the manufacturer’s instructions. For the cell growth assays, HCC cells were seeded at a density of 0.5 × 104 per well. The number of viable cells was determined at different timepoints. For the Colony formation assay, cells were seeded in 6-well plates at a density of 500–800 cells/well and cultured for 14 days. Colonies were stained with 0.5% Crystal Violet for 10 min and counted.
Measurement of DAG and FFA contents
DAG and FFA contents were determined with a DAG ELISA Kit (BlueGene Biotech, E01D0010) and Free Fatty Acid Quantitation Kit (Sigma, MAK044) respectively, following the manufacturers’ protocols.
Western blot
Western blot analysis was performed as previously described [
14]. In brief, whole cell or tissue extracts were prepared using RIPA buffer. After electrophoresis, proteins were electroeluted at 120 Volts onto a polyvinylidenedifluoride (PVDF) membrane (Invitrogen). Indicated primary antibodies were used. Protein bands were visualized by an enhanced chemiluminescence assay kit (Super Signal Pierce Bio-technology). The following antibodies against ATGL/PNPLA2(Cayman, 10006409), PPARα(Abcam, ab8934), MAGL(Abcam, ab24701), HSL(Abcam,ab45422), p53(Santa Cruz, SC126) and p21(Abcam, ab109520), Bax (Abcam, ab32503), β-Actin (Cell Signaling Technology) were used. Western blot analyses were repeated at least three times.
Immunohistochemical analysis
Expression of Ki-67 and ATGL was evaluated using an immunohistochemical (IHC) method described previously [
14].
Reagents
1,3-Dilinoleoyl-rac-glycerol (Sigma, D9508) was dissolved in fresh dimethyl sulfoxide (DMSO) for stock solution at 50 mM (or 50 mg/ml for the in vivo study). Similarly, oleic acid (Sigma, O1008) was dissolved in fresh DMSO to 50 mM (or 50 mg/ml for the in vivo study). 1,3-Dilinoleoyl-rac-glycerol and oleic acid were mixed at a 1:1 ratio to prepare the DAG+FFA mixture. Working solution was added with pre-set DAG and FFA concentrations by mixing common serum-free medium proportionately. Final concentrations were set at 8 μM, 16 μM and 32 μM. Atglistatin (Sigma, SML1075) was dissolved in DMSO for stock solution at 10 mM. Final working concentrations of 40 μM Atglistatin was used in all experiments. Nutlin-3a(Sigma, SML0580) was dissolved in DMSO for stock solution at 5 mg/ml. Final working concentrations of 10 μM Nutlin-3a was used in experiments.
Real time PCR analysis
Total RNA was extracted from cultured cells using the RNAeasy Mini kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. Reverse transcription was performed using the High Capacity Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA) after RNA quantification. Real-time PCR was performed using the Power SYBR Green PCR Master Mix (Life Technologies, Carlsbad, CA, USA) on an ABI Prism 7900HT instrument (Applied Biosystems). Real-time PCR was performed in triplicate. The expression of lncRNA and protein coding genes were normalized to that of β-Actin gene. Specifically, stem-loop reverse transcriptase polymerase chain reaction was used in the analysis of mature miRNA expression. The stem-loop RT primer was CCTGTTGTCTCCAGCCACAAAAGAGCACAATATTTCAGGAGACAACAGGGGCATTC. The reverse transcriptase reactions was performed as described previously [
15]. Reverse transcriptase reactions contained 2 μg total RNA, 50 nM stem–loop RT primer, 1× RT buffer (Applied Biosystems, Foster City, CA, USA), 0.25 mM dNTPs, 3.33 U/μl MultiScribe reverse transcriptase (Applied Biosystems, Foster City, CA, USA) and 0.25 U/μl RNase inhibitor (Applied Biosystems, Foster City, CA, USA). The reaction parameters were as follows: 30 min at 16 °C, 30 min at 42 °C, 5 min at 85 °C and then held at 4 °C. Quantitative RT-PCR reaction parameters were as follows: 2 min at 50 °C, 2 min at 95 °C, 40 cycles of denaturation at 95 °C for 30 s, Annealing at 60 °C for 1 min. The expression of miRNA was normalized to that of U6 gene. Expression levels of target genes were determined according to the 2
−ΔΔCt method. Primers used are listed in Additional file
2: Table S4.
Fluorescent In Situ Hybridization (FISH)
Fluorescent In situ hybridization (FISH) was performed with a Fluorescent In Situ Hybridization Kit (RiboBio, Guangzhou, China), following the manufacturers’ protocols. The CY3 labeled miR-124-3p probe were designed and purchased from GenePharma Technologies (Shanghai, China). The sequence was: 5’-GGCAUUCACCGCGUGCCUUA-3′.
P53 mutational analysis by PCR and direct sequencing
The mutation detection of the p53 gene was carried out by amplification of exons 2–11 from genomic DNA with 7 pairs of primers. Primer sequences are listed in Additional file
2: Table S5. Ex TaqDNA Polymerase used in PCR amplification was purchased from Takara, Japan. Amplification was done following the manufacturers’ protocols. PCR products were sequenced using an ABI3730XL DNA sequencer (Applied Biosystems). Profiles of p53 mutation were showed in Additional file
2: Table S6.
Animal studies
Male BALB/c nude mice (4–6 weeks old) were obtained from the experimental animal center of the Shanghai Institute for Biological Sciences (SIBS) and housed under standard conditions and care according to the institutional guidelines for animal care. All animal experiments were approved by the Institutional Animal Care and Use Committee of Harbin Medical University. To establish an orthotopic HCC mouse model, 4 × 106 cells in 100 μL of phosphate-buffered saline were subcutaneously injected into the flanks of nude mice. After 1–2 weeks, the subcutaneous tumors were resected and diced into 1 mm3 cubes, which were then implanted into the left lobes of the livers of the nude mice. A DAG and FFA mixture was used in vivo experiment. DAG and FFA solution was prepared in 20% DMSO and 15% Tween 80 in 0.9% saline. After 1 week of implantation mice were injected 20 mg/kg DAG+FFA intraperitoneally for 5 weeks (5 days per week). Mice were imaged by the bioluminescence IVIS Imaging System weekly and mice were then sacrificed.
Luciferase reporter assay
The luciferase reporter assay was performed according to the method described previously [
16].
Statistical analysis
Statistical analysis was performed with the GraphPad Prism software package (v. 4.02; San Diego, CA, USA) or SPSS 16.0 software (Chicago, IL, USA). Student’s t-test or one-way ANOVA was applied to determine the significance between groups. Statistical analyses between different treatments, in different cell cohorts or at different time points were performed using two-way ANOVA with the Bonferroni’s correction. Overall survival (OS) was compared with the Kaplan-Meier method, and the significance was determined by the log-rank test. Correlations were calculated using Spearman rank-order coefficients. Values were expressed as mean ± SD values. Statistically significant was concluded at *P < 0.05, **P < 0.01, ***P < 0.001; NS represents no statistically significant.
Discussion
In this study, we demonstrated that the NEAT1/miR-124-3p/ATGL pathway plays an important role in regulating abnormal lipolysis in HCC. In addition, NEAT1-mediated abnormal lipolysis facilitates HCC cell growth in vivo and in vitro.
Recent studies have demonstrated that fatty acids(FAs) may contribute to cancer progression through multiple mechanisms. Given that cancer cells can acquire FAs for their growth and proliferation through lipogenesis and lipolysis [
4], we speculated that lipolysis may play a vital role in HCC development. Our results indicated that the lipolytic enzyme ATGL is highly expressed in HCC tissues and predicts poor prognosis. Although present studies have revealed that inhibition of ATGL attenuated the growth and motility of tumor cells [
8], our study answered an important question: whether ATGL mediates lipolytic metabolic are responsible for this process. Our experimental results indicate that the pro-tumorigenic effects of ATGL were mediated by its DAG and FFA products. In addition, our results serve to explain, at least in part, high levels of DAG and FFA present in HCC tissues.
Recent publications outline a regulatory role for LncRNA in lipid metabolism [
32], however, whether IncRNAs can influence the development of cancer through participating in lilpolytic metabolic, and the biochemical pathways involved in this process are both unknown. For this, we identified lncRNAs that are co-expressed with ATGL through the online tool Co-lncRNA. Based on this analysis, our results demonstrated that the down-regulation of
NEAT1 expression attenuates ATGL expression in HCC cells. In addition, we showed that
NEAT1 expression was positively correlated with ATGL levels in HCC tissues. These results indicated that
NEAT1 modulates ATGL expression in HCC. Further, reductions in intracellular FFA and DAG levels were observed following
NEAT1 knockdown. Our results demonstrated that
NEAT1 disrupts the lipolysis of hepatoma cells via ATGL. Notably, we determined that ATGL and its products, DAG and FFA, are responsible for
NEAT1 mediated HCC cell growth. These results demonstrated that
NEAT1-modulated abnormal lipolysis promotes HCC cell growth in vivo and in vitro, providing new insight into the mechanism of HCC development.
Recent studies have been demonstrated that
NEAT1 is important in Adipogenesis [
33]. Our results indicated that
NEAT1 also mediates lipolysis in HCC cells, indicating that
NEAT1 may be a central regulator in lipid metabolism. Other genes play similar central roles in lipid metabolism, including those encoding mTOR, PPARs (peroxisome proliferator-activated receptors), TNF-alpha and SIRT1 [
34‐
37]. Further studies are needed to identify the effect of crosstalk between
NEAT1 and these genes.
NEAT1 is up-regulated in various types of cancers and several studies have indicated multiple mechanisms of
NEAT1 up-regulation. First, the activation of hypoxia pathways is a feature of HCC. Previous studies indicated that
NEAT1 expression is upregulated by hypoxia through HIF-2α [
38]. Second,
NEAT1 is also regulated by microRNAs. The findings suggest that the microRNA-
NEAT1 regulatory network plays significant cellular and physiological roles, and that its dysregulation contributes to tumorigenesis [
39]. Third, Some transcription factors such as Oct4 and estrogen receptor alpha have been reported to regulate
NEAT1 expression by directly binding
NEAT1 promoters [
40,
41]. However,
NEAT1 is down-regulated and plays a tumor-suppressor role in specific cancer types, because NEAT1 is a target gene of wild type p53 [
22,
42‐
44].. These seemingly contradictory results may reflect cell type-specific roles for
NEAT1 in tumorigenesis. An important mechanism that can explain this discrepancy is that
NEAT1 can in turn prevent accumulation of TP53 [
21]. Our result confirmed this phenomenon in HCC cell lines. NEAT1 inhibits wild type p53 tumor suppressive functions through this negative feedback loop. However, whether this negative feedback loop is a universal phenomenon in human cancers needs further study. Additionally, P53 is the most commonly mutated gene in human cancers. According to the literature, NEAT1 is also highly expressed in the mutant p53 cell lines, such as lung cancer cell line: H1299; breast cancer cell line: MDA-MB-231; pancreatic cancer cell line PACN-1, colon cancer cell line: SW480 [
12,
45‐
47]. This indicated some other NEAT1 regulator may play an important role in NEAT1 expression. Studies have revealed that some tumor-promoters, such as HIF-2, Oct4, and estrogen receptor alpha, can strongly enhance
NEAT1 expression [
38,
40,
41]. NEAT1 could participate in the related gene pathway mentioned above to strongly promote tumor development.
Several studies have indicated that microRNAs can be important targets of lncRNAs [
23,
24]. In this study, our results indicated that the interaction of
NEAT1 with ATGL might occupy the binding site of miRNAs so that suppression of ATGL by miR-124-3p would be significantly retarded. Meanwhile, dual-luciferase reporter assays demonstrated that both
NEAT1 and ATGL directly bind to miR-124-3p. We speculate that there may be a novel regulatory transcript-mediated release of ATGL from miRNA repression which would add to the known crosstalk within the established pathway.
To elucidate the mechanism of
NEAT1-modulated abnormal lipolysis in hepatocarcinogenesis, we examined the expression of PPARα, the downstream target of ATGL [
48]. PPARα is expressed mainly in the liver, heart, and muscles. It is a major regulator of fatty acid transport, catabolism, and energy homeostasis [
49]. PPARα plays an important role in HCC proliferation [
26]. Our results showed that ATGL expression enhances PPARα levels in HCC cells. Interestingly, our results also showed that treatment with DAG + FFA up-regulates the expression of PPARα in Huh7 and HCCLM3 cells in a dose dependent manner. Importantly, the knockdown of
NEAT1 down-regulated PPARα expression, but this process could be blocked by treatment with miR-124-3p inhibitor (or overexpression of ATGL/treatment with DAG+FFA). Therefore, we conclude that
NEAT1 promotes HCC cell growth through miR-124-3p/ATGL/DAG+FFA/PPARα signaling.