Skip to main content
Erschienen in: BMC Cancer 1/2023

Open Access 01.12.2023 | Research

Lovastatin inhibits erythroleukemia progression through KLF2-mediated suppression of MAPK/ERK signaling

verfasst von: Jian Gao, Jifen Hu, Fang Yu, Chunlin Wang, Danmei Sheng, Wuling Liu, Anling Hu, Kunling Yu, Xiao Xiao, Yi Kuang, Eldad Zacksenhaus, Babu Gajendran, Yaacov Ben-David

Erschienen in: BMC Cancer | Ausgabe 1/2023

Abstract

Background

Lovastatin, an HMG-CoA inhibitor and an effective cholesterol lowering drug, exhibits anti-neoplastic activity towards several types of cancer, although the underlying mechanism is still not fully understood. Herein, we investigated mechanism of growth inhibition of leukemic cells by lovastatin.

Methods

RNAseq analysis was used to explore the effect of lovastatin on gene expression in leukemic cells. An animal model of leukemia was used to test the effect of this statin in vivo. FAM83A and DDIT4 expression was knocked-downed in leukemia cells via lentivirus-shRNA. Western blotting, RT-qPCR, cell cycle analysis and apoptosis assays were used to determine the effect of lovastatin-induced growth suppression in leukemic cells in vitro.

Results

Lovastatin treatment strongly inhibited cancer progression in a mouse model of erythroleukemia induced by Friend virus. In tissue culture, lovastatin inhibited cell proliferation through induction of G1 phase cell cycle arrest and apoptosis. Interestingly, lovastatin induced most known genes associated with cholesterol biosynthesis in leukemic cells. Moreover, it suppressed ERK1/2 phosphorylation by downregulating FAM83A and DDIT4, two mediators of MAP-Kinase signaling. RNAseq analysis of lovastatin treated leukemic cells revealed a strong induction of the tumor suppressor gene KLF2. Accordingly, lentivirus-mediated knockdown of KLF2 antagonized leukemia cell suppression induced by lovastatin, associated with higher ERK1/2 phosphorylation compared to control. We further show that KLF2 induction by lovastatin is responsible for lower expression of the FAM83A and DDIT4 oncogenes, involved in the activation of ERK1/2. KLF2 activation by lovastatin also activated a subset of cholesterol biosynthesis genes that may further contribute to leukemia suppression.

Conclusions

These results implicate KLF2-mediated FAM83A/DDIT4/MAPK suppression and activation of cholesterol biosynthesis as the mechanism of leukemia cell growth inhibition by lovastatin.
Hinweise

Supplementary Information

The online version contains supplementary material available at https://​doi.​org/​10.​1186/​s12885-023-10742-4.
Jian Gao and Jifen Hu contributed equally to this work as co-first authors.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Introduction

Statins act as inhibitors of hydroxymethyl glutaryl coenzyme A reductase (HMG-CoA) to reduce blood cholesterol, and are commonly used to diminish the risk of cardiovascular diseases [1]. Lovastatin (Lova) was the first statin to be approved by the US FDA in 1987 as a cholesterol-lowering drug. It blocks the conversion of HMG-CoA to mevalonate by inhibiting the function of HMG-CoA reductase (HMGCR) enzyme [2]. In addition to reducing cholesterol activity, anti-cancer effects of lovastatin have been reported in some cancer types [3, 4], including breast cancer [5], ovarian cancer [6] and multiple myeloma [7]. However, the role of cholesterol in cancer progression is controversial and the mechanism of statins in this context are not yet fully established.
While many studies implicated high serum cholesterol in cancer initiation and progression [813], other studies found no association [14] or even tumor inhibition [15, 16]. Indeed, we previously identified limonoid compounds exhibiting potent anti-leukemia activity [17]. Mechanistically, we have shown that these compounds act as agonists of ERK1/2. Overt and uncontrol activation of the MAPK pathway induced by limonoid in leukemia cell lines strongly induces upregulation of cholesterol biosynthesis and other pathways, leading to a block in leukemia progression [18]. This is consistent with reports that MAPK is upstream of cholesterol biosynthesis [19]. Accordingly, inhibition of cholesterol pathway by statin partially prevented growth suppression induced by these limonoid compounds [18].
The family with sequence similarity 83 member A (FAM83A) oncogene is associated with the development of many malignant tumors [2025]. FAM83A interacts with the RAS pathway to drive the activation of PI3K and MAPK signaling [20, 21]. High level of FAM83A expression maintains critical levels of MEK/ERK survival signaling and blocks cell death in pancreatic cancer cells [21]. FAM83A is thus proposed as a major driver of cancer progression through its direct interaction with MAPK signaling. DNA damage inducible transcript 4 (DDIT4), expressed under stress situation, also acts as a mediator of cell growth in cancer cells through inhibition of mTORC1 [26]. Similar to FAM83A, DDIT4 activates the MAPKinase pathway to accelerate gastric cell proliferation, although the underlying mechanism still unknown [27]. Both FAM83A and DDIT4 are potential target for drug development.
Although lovastatin lowers serum cholesterol, its effect on tumor cell cholesterol level is unclear. Since lovastatin is known to block MAPK, blocking this signaling pathway may be in part responsible for its tumor growth inhibition [19]. Here, we show that high doses of lovastatin while inhibiting MAPK signaling, surprisingly also induce high expression of genes associated with cholesterol biosynthesis. RNAseq analysis identified robust upregulation of the transcription factor KLF2 by lovastatin, previously known for its tumor suppressor activity [28]. We have shown for the first time that KLF2 upregulation by lovastatin causing downregulation of both growth promoting genes FAM83A and DDIT4, leading to suppression of its downstream MAPK/ERK pathway. Inhibition of MAPK/ERK and higher cholesterol activity by KLF2 are likely mechanisms by which lovastatin suppressed leukemia progression in culture and in vivo.

Materials and methods

Cells and culture conditions

The human erythroleukemia cell lines HEL and K562 was previously obtained from ATCC (HEL 92.1.7, K562 CLL-243), and maintained mycoplasma free, as previously described [29]. The generation of mouse erythroleukemia cell line CB3 was previously described [30]. HEK293T cells were originally obtained from ATCC (CRL-3216). Cells were cultured and maintained in Dulbecco’s Modified Eagle Medium supplemented with HyClone 5% fetal bovine serum (GE Healthcare).
Cells were treated with lovastatin with indicated concentrations/times and used for cell counting or MTT assay (to determine the proliferation index) and for protein/mRNA extraction (for western blotting and RT-qPCR). Lovastatin compound was purchased from Solarbio, China.

shRNA expression

The shRNA lentiviruses used was constructed, as previously described [31]. Briefly, shKLF2 and scrambled control vectors were generated by inserting the KLF2 shRNA and scrambled DNAs into the restriction enzyme sites BcuI within the PLent-GFP expression vector (obtained from Vigene Bioscience, Rockville, MD, USA). The lentivirus particles were generated by co-transfecting shKLF2 DNAs (10 µg) with packaging plasmids psPAX2 (5 µg) and pMD2.G (10 µg) (Addgene plasmid #12,259 & #12,260) into HEK293T cells, using Lipofectamine 2000 [30, 31]. Similar strategy is used to generate shDDIT4 lentivirus. Two days after transfection, the supernatants were collected and used to transduce HEL cells [31]. The positive expressing cells were then selected after incubation with medium containing puromycin (2 µg/ml; Solarbio). The sequences of the shKLF2s and shDDIT4 are shown in Table 1.
Table 1
shKLF2 gene sequences
Gene
Sequence
shKLF2/1
5’CGGCACCGACGACGACCTCAATTCAAGAGATTGAGGTCGTCGT
CGGTGCCGTTTTTT3’
shKLF2/2
5’AGTTCGCATCTGAAGGCGCATTTCAAGAGAATGCGCCTTCAGAT
GCGAACTTTTTTT3’
shKLF2/3
5’CACCGGCCATTCCAGTGCCATTTCAAGAGAATGGCACTGGAATG
GCCGGTGTTTTTT3’
shDDIT4/1
5’GATGCCTAGCCAGTTGGTAAGTTCAAGAGACTTACCAACTGGCT
AGGCATCTTTTTT3’
shDDIT4/2
5’GTCAGTGACCCTGAGGATGAACTTCAAGAGAGTTCATCCTCAGG
GTCACTGATTTTTT3’
shDDIT4/3
5’GCACTGGCTTCCGAGTCATCAATTCAAGAGATTGATGACTCGGAA
GCCAGTGTTTTTT 3’

RNA preparation and RT-qPCR

For RT-qPCR, total RNA is extracted using TRIzol reagent (Life Technologies; Thermo Fisher Scientific, USA). CDNA was synthesized by using the PrimeScript RT Reagent kit (Takara Bio, Beijin, China). RT-qPCR analysis was done using the FastStart Universal SYBR Green Master Mix (Roche, Shanghai, China) and the Step One Plus Real time PCR system (Applied Biosystems/Thermo Fisher Scientific, US). The expression of the test genes was given as relative values to the expression of GAPDH. Three biological replicates were used for all the RT-qPCRs, each in triplicate (n = 3). Primers sequence list in the Table 2.

Western blotting

Western blotting was performed as previously described [30, 31]. The antibodies used are as follows: Polyclonal rabbit antibodies for FLI1 (ab133485), DDIT4 (AB191871) and total ERK (ab184699) were purchased from Abcam; KLF2 (#46,591) and GAPDH (G9545) antibodies were obtained from Sigma Aldrich; β actin (20,536 1 AP) and FAM83A (20618-1-AP) antibodies were obtained from Proto Technology (Proteintech, Bucuresti, Romania); Phospho-ERK (Thr202/Tyr204; Cat. no. 9101s), goat anti mouse and goat anti rabbit HRP conjugated antibodies were obtained from Cell Signaling Technology (Cat. no. 5470s and 5151s, respectively). Antibody dilution was conducted according to the manufacturer’s instructions. The Odyssey system (LI COR Biosciences) and Bio was used to image proteins in western blot analysis.
Table 2
RT-qPCR gene primers sequence
Gene
Forward
Reverse
GAPDH
GGAGCGAGATCCCTCCAAAAT
GGCTGTTGTCATACTTCTCATGG
KLF2
TTCGGTCTCTTCGACGACG
TGCGAACTCTTGGTGTAGGTC
APOA1
CCCTGGGATCGAGTGAAGGA
CTGGGACACATAGTCTCTGCC
FAM83A
GGCCCTAAGGGACTGGACT
CACAGTGGCGCTGGATTTTT
HMGCS1
GATGTGGGAATTGTTGCCCTT
ATTGTCTCTGTTCCAACTTCCAG
HMGCR
TGATTGACCTTTCCAGAGCAAG
CTAAAATTGCCATTCCACGAGC
MVK
CATGGCAAGGTAGCACTGG
GATACCAATGTTGGGTAAGCTGA
MVD
CTCCCTGAGCGTCACTCTG
GGTCCTCGGTGAAGTCCTTG
IDI1
AACACTAACCACCTCGACAAGC
AGACACTAAAAGCTCGATGCAA
FDPS
TGTGACCGGCAAAATTGGC
GCCCGTTGCAGACACTGAA
TM7SF2
GTCGCCTGCGCTATCCTATTA
TGCGCCTTCATGTAGAGAAAGA
DDIT4
TGAGGATGAACACTTGTGTGC
CCAACTGGCTAGGCATCAGC
FDFT1
CCACCCCGAAGAGTTCTACAA
TGCGACTGGTCTGATTGAGATA
DHCR7
GCTGCAAAATCGCAACCCAA
GCTCGCCAGTGAAAACCAGT
DHCR24
GCCGCTCTCGCTTATCTTCG
GTCTTGCTACCCTGCTCCTT
SC5D
ACCATACGTGTATCCAGCCAC
GCTCAGTGTTGCACAGAAGAAA
EBP
CTCAGCACCTAAGACTGGACA
ACGACTAAGACCCCTGTGACA
HSD17B7
GTGCTGGTGTGTAACGCAG
GTCCCTACTACATTCACGTCCA
MSMO1
TGCTTTGGTTGTGCAGTCATT
GGATGTGCATATTCAGCTTCCA
CYP51A
GAAACGCAGACAGTCTCAAGA
ACGCCCATCCTTGTATGTAGC
NSDHL
CAAGTCGCACGGACTCATTTG
ACTGTGCATCTCTTGGCCTG
SQLE
GGCATTGCCACTTTCACCTAT
GGCCTGAGAGAATATCCGAGAAG
LSS
GCACTGGACGGGTGATTATGG
TCTCTTCTCTGTATCCGGCTG

RNAseq analysis

The RNAseq data presented in Supplementary Table 1 was generated using RNA isolated from HEL cells treated with DMSO or 20 µM of lovastatin for 24 h, as previously described [31]. Differentially expressed genes (DEGs) with at least 2.5 higher or lower were identified and shown in Supplementary Table 1.

Leukemia induction in mice and drug therapy

In our mouse model of erythroleukemia, one day old BALB/c mice were inoculated intraperitoneally (i.p.) with Friend Murine Leukemia Virus (F-MuLV), as previously described [30]. Five weeks post viral infection, mice were injected intraperitoneally every other day for a total of seven inoculations with 3 mg/kg bodyweight of lovastatin (Cat. no. SL8750) or control DMSO. Mice were then monitored for the development of leukemia. Mice displaying signs of final stage of disease were sacrificed humanly using cervical dislocation, blood and spleens were removed, and the percentage of survival, hematocrit and spleen weight was calculated, as previously described [30].

Statistical analysis

A statistical analysis was measured using a two tailed Student t test or a one-way ANOVA with Tukey’s post hoc test, using Prism9 GraphPad software. The P values were indicated within the figures using a standard scheme, P = < 0.05 (*), P = < 0.01 (**),P = < 0.001 (***) and P = < 0.0001 (****). Where appropriate, the data were displayed using the mean ± the SEM from at least 3 independent experiments.

Results

Lovastatin inhibits leukemia progression in a mouse model of erythroleukemia induced by Friend virus

Statins suppresses several types of cancers [32], yet the underlying mechanism remains unknown. Using a mouse model of erythroleukemia induced by Friend Murine Leukemia virus (F-MuLV), we investigated the effect of lovastatin on leukemia progression. Erythroleukemia is indeed an aggressive form of leukemia as medium survival is 3–9 month from the time of diagnosis and new drugs desperately needed for treatment of this cancer [29, 30]. Leukemias induced by F-MuLV usually appears in the spleen of infected mice around 3–5 weeks post-viral infection [30]. At 5 weeks post-viral infection, leukemic mice were treated with lovastatin (3 mg/kg), every other day for 2 weeks. Lovastatin strongly inhibited leukemia progression in these mice (Fig. 1a). At the time of death, no difference in the size of tumorigenic spleens was detected between lovastatin treated and control mice (Fig. 1b). The hematocrit values were much higher in the lovastatin treated compared to control mice, but slightly below significance (Fig. 1c), suggesting a positive effect of lovastatin on red blood cell suppression during leukemia progression, which extended survival.
As Fli-1 activation is critical for murine leukemia induction by F-MuLV [33], we tested for Fli-1 levels. Lovastatin had marginal effect on Fli-1 expression (Fig. 1d) on murine erythroleukemia cell line CB3 induced by this retrovirus [29], suggesting that lovastatin inhibits leukemia progression independently of Fli-1.

Lovastatin-mediated inhibition of leukemia cell proliferation in vitro is associated with cell cycle arrest and apoptosis

As lovastatin inhibits erythroleukemia progression in vivo (Fig. 1a), we examined the effect of this statin on erythroleukemia cell survival in culture. Lovastatin strongly inhibited the growth of human erythroleukemia cell line HEL in culture in a dose dependent manner (Fig. 2a), with an IC50 of 18.2 µM [18]. Similar growth inhibition is also seen in the erythroleukemia cell lines K562 and CB3, with IC50 of 30.2 and 35.3 µM, respectively. At 20 µM, lovastatin induced a G1 cell cycle arrest of HEL cells at both 24 and 48 h post-drug treatment (Fig. 2b). At this concentration, lovastatin also significantly induced apoptosis of HEL cells in culture (Fig. 2c). The above results demonstrate anti-leukemic effects of lovastatin in both tissue culture and mice.

Lovastatin induces cholesterol biosynthesis genes in leukemic cells

While lovastatin is known to reduce serum cholesterol by inhibiting the HMGCR (3-hydroxy-3-methylglutaryl-Coenzyme A reductase) enzyme in liver [2], the mechanism of its anti-leukemia activity is unknown. Interestingly, treatment of the human erythroleukemia cell line HEL with lovastatin (20 µM) resulted in significant transcriptional upregulation of 16 of 18 cholesterol biosynthesis genes including HMGCR (Fig. 3). Induction of HMGCR and LSS by lovastatin is also tested by western blot (Supplementary Fig. 1a,b; The full-length blots/gels are presented in Supplementary Fig. 8). Expression of FDFT1 and IDI1 was not induced by lovastatin. Interestingly, we previously demonstrated that upregulation of cholesterol biosynthesis genes by liminoid compound A1542 responsible for some of its growth inhibition activity in HEL cells line [18]. As lovastatin also inhibits cell proliferation in culture (Fig. 2a) and in vivo (Fig. 1a), higher cholesterol gene expression by this statin may be in part responsible for leukemia suppression.
Cholesterol biosynthesis gene transcription is regulated by the transcription factors SREBP1 and SREBP2 [34]. Interestingly, lovastatin significantly upregulated SREBP2 (Supplementary Fig. 2a,b). Lovastatin also upregulated expression of apolipoprotein A1 (APOA1), A component of high-density lipoprotein (HDL) involved in cholesterol biosynthesis (Supplementary Fig. 2c) [35].

Lovastatin suppresses expression FAM83A and DDIT4 to block the MAPK/ERK pathway

To further understand the mechanism of lovastatin growth inhibition, HEL cells were treated with lovastatin (20 µM) for 24 h and subjected to RNAseq analysis. Among genes whose expression was significantly up- or down-regulated at least 2.5 fold by lovastatin (Supplementary Table 1), we detected FAM83A, a known regulator of the RAS pathway, whose level was reduced by 2 folds in lovastatin-treated cells [20, 21]. Reduced expression of FAM83A by lovastatin was confirmed by RT-qPCR and western blot (Fig. 4a,b). As FAM83A regulates MAPK activity, we tested for ERK1/2 phosphorylation on Thr202/Tyr204 in lovastatin (20 µM)-treated HEL cells, and observed a strong suppression of P-ERK (Fig. 4c). Interestingly, RNAseq data also revealed strong reduction in the level of DNA damage-inducible transcript 4 (DDIT4), also known as DNA damage response 1 (REDD1). DDIT4 was shown to accelerate growth of gastric cancer cells through upregulation of MAPK [27]. Herein, we showed that lovastatin strongly suppressed DDIT4 transcription in HEL cells (Fig. 4d). To further confirm this observation, we knockdown DDIT4 using lentivirus shRNA. Two cell lines shDDIT4/2 and shDDIT4/3 were successfully generated, in which shDDIT4/3 revealed significant downregulation (Fig. 4e). By western blot, while the level of DDIT4 reduced following lovastatin (20 µM) treatment, this downregulation was further increased in shDDIT4/3 cells (Fig. 4f). Cell proliferation was significantly reduced in shDDIT4/3 cells versus control, while this level further decreased when treated with lovastatin (Fig. 4g). Moreover, as the level of phosphor-ERK is significantly reduced in shDDIT4/3 cells, this level further decreased after treatment with lovastatin (Fig. 4h). These results suggest that lovastatin may suppress cell proliferation by inhibiting MAPK activity through FAM83A and DDIT4.

Lovastatin upregulates the transcription of KLF2 that suppresses cell proliferation

RNAseq analysis also identified higher expression (above 400 times) of Kruppel Like Factor 2 (KLF2) in lovastatin treated HEL cells (Supplementary Table 1). This upregulation by lovastatin was confirmed by RT-qPCR (Fig. 5a) and Western blotting (Fig. 5b). Interestingly, KLF2 expression was significantly higher in enlarged spleens isolated from three leukemic mice treated with lovastatin versus three DMSO treated controls (Supplementary Fig. 3; The full-length blots/gels are presented in Supplementary Fig. 9). Since lovastatin suppresses cell proliferation (Fig. 2a), we examined whether this inhibition is mediated through KLF2 upregulation, as this transcription factor acts as a tumor suppressor gene [28]. Three lentivirus shRNA KLF2s (shKLF2-1, shKLF2-2 or shKLF2-3) were introduced into HEL cells. While knockdown with shKLF2-1 was not effective (data not shown), significant downregulation of KLF2 transcription was seen with shKLF2-2 and shKLF2-3 lentiviruses (Fig. 5c). As expected, KLF2 induction was significantly lower following lovastatin (20 µM) treatment in shKLF2-2 and shKLF2-3 cells by both RT-qPCR (Fig. 5c) and western blot (Fig. 5d), relative to control scrambled cells.
To detect if knockdown of KLF2 influenced cell proliferation in culture, the growth of shKLF2-2 and scrambled control cells was compared by MTT assay. Knockdown of KLF2 marginally affected the proliferation of shKLF2-2 cells compared to control cells (Fig. 5e). However, when these cells were treated with lovastatin, the growth suppression was lower in shKLF2-2 than in scrambled control cells (Fig. 5e). These results suggests that KLF2 in part is involved in growth suppression by lovastatin. Interestingly, while the level of FAM83A and DDIT4 are significantly downregulated by lovastatin in scrambled control cells, in shKLF2-2 cells this level slightly increased, although not statistically significant (Fig. 5f,g). In addition, the level of phospho-ERK is much higher in KLF2-2 than in scrambled control cells after treatment with lovastatin (Fig. 5h). These results suggest that KLF2 may suppress cell proliferation through the FAM83A/DDIT4/ERK pathway.

KLF2 affects a subset of lovastatin induced cholesterol biosynthesis genes in leukemia cells

Since cholesterol biosynthesis genes were regulated by lovastatin in leukemia cells, we examined whether this regulation is mediated through KLF2. Indeed, by examining 12 cholesterol biosynthesis genes, we showed that induction of MSMO1, MVD, HMGCR, MVK, TM7SF2 and HMGCS1 gene expression by lovastatin is much lower in shKLF2-2 cells compared to control (Fig. 6a-f). However, this induction is similar for CYP51A1, LSS, EBP, DHCR24, DHCR7 and even higher for SQLE in shKLF2-2 cells (Fig. 6g-l). In shKLF2-2 cells, while the level of SREBP1 was constant, higher expression of SREBP2 was observed, further demonstrating a partial role for KLF2 in cholesterol biosynthesis (Supplementary Fig. 4). In the proposed model depicted in Fig. 7a, FAM83A and DDIT4 expression promotes leukemia cell proliferation through activation of ERK. Lovastatin inhibits leukemia cell survival and proliferation in part through suppression of the FAM83A/DDIT4/ERK1/2 pathway, mediated by the induction of the tumor suppressor gene KLF2, as well as cholesterol biosynthesis genes (Fig. 7b).

Discussion

Lovastatin, a powerful HMGCR inhibitor, is commonly used in patients to lower HDL (high-density lipoprotein). This statin compound is also associated with anti-neoplastic proliferation [19], although the mechanism is not fully understood. In this study, we show that lovastatin strongly inhibits leukemia proliferation in culture and delays erythroleukemia development in vivo. Mechanistically, Lovastatin induced the expression of cholesterol biosynthesis genes, previously shown to inhibit leukemia proliferation [18]. Moreover, lovastatin strongly induced the expression of KLF2, known to function as a tumor suppressor gene. Here we show for the first time that KLF2 exerts its inhibitory activity in part through activation of FAM83A and DDIT4, which activate the MAPK/ERK pathway [21, 27]. Overall, these results suggest that lovastatin inhibits leukemogenesis in part through KLF2 mediated FAM38A/DDIT4/ERK1/2 suppression and induction of cholesterol biosynthesis (Fig. 7).
The role of cholesterol in cancer is controversial as both high and low levels of this fat-like substance affects neoplastic progression [36]. In breast cancer, long term use of statins could promote invasive breast cancer [37]. In our previous studies, we discovered novel liminoid compounds (A1541-43) capable of inducing apoptosis in part through robust activation of cholesterol biosynthesis [18]. Here we show that lovastatin also induced expression of cholesterol biosynthesis genes in cancer cells, which may contribute as least in part to growth suppression of leukemia cells in culture and in an animal model of leukemia. As lovastatin blocks enzymatic activity of HMGCR that is critical for cholesterol biosynthesis, higher cholesterol biosynthesis may activate a compensatory mechanism by this statin. Indeed, previous studies showed that in rats with diminished basal expression of hepatic HMG-CoA reductase, animals exhibited increased sensitivity to dietary cholesterol, resulting in higher serum cholesterol [38]. In our analysis, lovastatin also induced higher levels of key cholesterol genes, Mevalonate diphosphate decarboxylast (MVD), Lanosterol synthase (LSS) and 7-dehydrocholesterol reductase (DHCR7; Fig. 3) that could compensate for cholesterol biosynthesis in the absence of HMGCR enzymatic activity. This compensatory mechanism is an interesting area of research that will require further investigation in future studies.
FAM38A is a transmembrane protein that acts as a proto-oncogene in breast cancer, downstream of the EGFR pathway [39]. FAM38A expression is critical for activation of the RAS pathway downstream of EGFR (See Fig. 7). Since lovastatin inhibits the MAPK pathway [17, 18], suppression of FAM83A, which is associated with lower ERK1/2 phosphorylation could be responsible in part for inhibition of proliferation and leukemogenicity by this statin. Moreover, the expression of another mediator of MAPK [27], DDIT4, is strongly inhibited by lovastatin. Together, these results implicate both FAM83A and DDIT4 as mediators of leukemia suppression by lovastatin.
Statins were previously reported to induce KLF2 expression, leading to activation of its downstream effectors and regulation of several pathophysiologically relevant genes [40]. Suppression of leukemia cell proliferation is indeed consistent with previously reported tumor suppressor function of KLF2, although the mechanism is still unknown [28]. Here, we showed that the induction of KLF2 by lovastatin suppressed FAM83A and DDIT4 expression, leading to lower pospho-ERK1/2 expression that likely mediates growth suppressing activity of this statin. KLF2 regulates the expression of a subset of cholesterol biosynthesis genes, that may further contribute to leukemia suppressing activity of lovastatin.
In conclusion, we show that lovastatin blocks leukemia proliferation in part through activation of cholesterol biosynthesis and induction of the transcription factor KLF2, capable of suppression the MAPKinase pathway, likely through downregulation of FAM83A and DDIT4. This study provides new insights into the mechanism of leukemia inhibition by lovastatin that could also be examined for other statins. Targeting, FAM83A and DDIT4 using small molecule drugs alone or in combination with lovastatin could be useful in treating leukemias and other cancers.

Acknowledgements

Not applicable.

Declarations

For patients: This study does not include any human data.
For animals: The animal experiment was approved by the accredited animal ethics committee of Guizhou Medical University and the Council of Animal Care (Approval No. #SYXKQIAN-2018-0001, May 01. 2021). All experiments in this study were performed in accordance with the guidelines in the Basel Declaration, International Council for Laboratory Animal Science (ICLAS) published ethical guidelines, and American Veterinary Medical Association (AVMA) Guidelines for the Euthanasia of Animals (2020). In addition, our animal experiments were performed in accordance with ARRIVE guidelines.
Not applicable.

Competing interests

The authors have declared that no competing interest exists.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creativecommons.​org/​licenses/​by/​4.​0/​. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Anhänge

Electronic supplementary material

Below is the link to the electronic supplementary material.
Literatur
1.
Zurück zum Zitat Smith MB, Lee NJ, Haney E, Carson S. Drug class review: HMG-CoA reductase inhibitors (statins) and fixed-dose combination products containing a statin: final report update 5. Portland (OR): Oregon Health & Science University; 2009. Smith MB, Lee NJ, Haney E, Carson S. Drug class review: HMG-CoA reductase inhibitors (statins) and fixed-dose combination products containing a statin: final report update 5. Portland (OR): Oregon Health & Science University; 2009.
2.
Zurück zum Zitat Tobert JA. Lovastatin and beyond: the history of the HMG-CoA reductase inhibitors. Nat Rev Drug Discov. 2003;2(7):517–26.CrossRefPubMed Tobert JA. Lovastatin and beyond: the history of the HMG-CoA reductase inhibitors. Nat Rev Drug Discov. 2003;2(7):517–26.CrossRefPubMed
3.
Zurück zum Zitat Mullen PJ, Yu R, Longo J, Archer MC, Penn LZ. The interplay between cell signalling and the mevalonate pathway in cancer. Nat Rev Cancer. 2016;16(11):718–31.CrossRefPubMed Mullen PJ, Yu R, Longo J, Archer MC, Penn LZ. The interplay between cell signalling and the mevalonate pathway in cancer. Nat Rev Cancer. 2016;16(11):718–31.CrossRefPubMed
4.
Zurück zum Zitat Longo J, van Leeuwen JE, Elbaz M, Branchard E, Penn LZ. Statins as anticancer agents in the era of precision medicine. Clin Cancer Res Off J Am Assoc Cancer Res. 2020;26(22):5791–800.CrossRef Longo J, van Leeuwen JE, Elbaz M, Branchard E, Penn LZ. Statins as anticancer agents in the era of precision medicine. Clin Cancer Res Off J Am Assoc Cancer Res. 2020;26(22):5791–800.CrossRef
5.
Zurück zum Zitat Klawitter J, Shokati T, Moll V, Christians U, Klawitter J. Effects of lovastatin on breast cancer cells: a proteo-metabonomic study. Breast Cancer Res BCR. 2010;12(2):R16.CrossRefPubMed Klawitter J, Shokati T, Moll V, Christians U, Klawitter J. Effects of lovastatin on breast cancer cells: a proteo-metabonomic study. Breast Cancer Res BCR. 2010;12(2):R16.CrossRefPubMed
6.
Zurück zum Zitat Martirosyan A, Clendening JW, Goard CA, Penn LZ. Lovastatin induces apoptosis of ovarian cancer cells and synergizes with doxorubicin: potential therapeutic relevance. BMC Cancer. 2010;10:103.CrossRefPubMedPubMedCentral Martirosyan A, Clendening JW, Goard CA, Penn LZ. Lovastatin induces apoptosis of ovarian cancer cells and synergizes with doxorubicin: potential therapeutic relevance. BMC Cancer. 2010;10:103.CrossRefPubMedPubMedCentral
7.
Zurück zum Zitat Wong WW-L, Clendening JW, Martirosyan A, Boutros PC, Bros C, Khosravi F, et al. Determinants of sensitivity to lovastatin-induced apoptosis in multiple myeloma. Mol Cancer Ther. 2007;6(6):1886–97.CrossRefPubMed Wong WW-L, Clendening JW, Martirosyan A, Boutros PC, Bros C, Khosravi F, et al. Determinants of sensitivity to lovastatin-induced apoptosis in multiple myeloma. Mol Cancer Ther. 2007;6(6):1886–97.CrossRefPubMed
9.
Zurück zum Zitat Ikonen E. Cellular cholesterol trafficking and compartmentalization. Nat Rev Mol Cell Biol. 2008;9(2):125–38.CrossRefPubMed Ikonen E. Cellular cholesterol trafficking and compartmentalization. Nat Rev Mol Cell Biol. 2008;9(2):125–38.CrossRefPubMed
10.
Zurück zum Zitat Shafique K, McLoone P, Qureshi K, Leung H, Hart C, Morrison DS. Cholesterol and the risk of grade-specific prostate cancer incidence: evidence from two large prospective cohort studies with up to 37 years’ follow up. BMC Cancer. 2012;12:25.CrossRefPubMedPubMedCentral Shafique K, McLoone P, Qureshi K, Leung H, Hart C, Morrison DS. Cholesterol and the risk of grade-specific prostate cancer incidence: evidence from two large prospective cohort studies with up to 37 years’ follow up. BMC Cancer. 2012;12:25.CrossRefPubMedPubMedCentral
12.
Zurück zum Zitat Allott EH, Howard LE, Cooperberg MR, Kane CJ, Aronson WJ, Terris MK, et al. Serum lipid profile and risk of prostate cancer recurrence: results from the SEARCH database. Cancer Epidemiol Biomark Prev Publ Am Assoc Cancer Res Cosponsored Am Soc Prev Oncol. 2014;23(11):2349–56.CrossRef Allott EH, Howard LE, Cooperberg MR, Kane CJ, Aronson WJ, Terris MK, et al. Serum lipid profile and risk of prostate cancer recurrence: results from the SEARCH database. Cancer Epidemiol Biomark Prev Publ Am Assoc Cancer Res Cosponsored Am Soc Prev Oncol. 2014;23(11):2349–56.CrossRef
13.
Zurück zum Zitat Rosch PJ, McCully K. Statin use and reduced cancer-related mortality. N Engl J Med. 2013;368(6):576.PubMed Rosch PJ, McCully K. Statin use and reduced cancer-related mortality. N Engl J Med. 2013;368(6):576.PubMed
14.
Zurück zum Zitat Bjerre LM, LeLorier J. Do statins cause cancer? A meta-analysis of large randomized clinical trials. Am J Med. 2001;110(9):716–23.CrossRefPubMed Bjerre LM, LeLorier J. Do statins cause cancer? A meta-analysis of large randomized clinical trials. Am J Med. 2001;110(9):716–23.CrossRefPubMed
15.
Zurück zum Zitat Parsa N, Taravatmanesh S, Trevisan M. Is low cholesterol a risk factor for cancer mortality? Eur J Cancer Prev Off J Eur Cancer Prev Organ ECP. 2018;27(6):570–6.CrossRef Parsa N, Taravatmanesh S, Trevisan M. Is low cholesterol a risk factor for cancer mortality? Eur J Cancer Prev Off J Eur Cancer Prev Organ ECP. 2018;27(6):570–6.CrossRef
16.
Zurück zum Zitat Ravnskov U, Rosch PJ, McCully KS. Statins do not protect against cancer: quite the opposite. J Clin Oncol Off J Am Soc Clin Oncol. 2015;33(7):810–1.CrossRef Ravnskov U, Rosch PJ, McCully KS. Statins do not protect against cancer: quite the opposite. J Clin Oncol Off J Am Soc Clin Oncol. 2015;33(7):810–1.CrossRef
17.
Zurück zum Zitat Wang N, Fan Y, Yuan C-M, Song J, Yao Y, Liu W, et al. Selective ERK1/2 agonists isolated from Melia azedarach with potent anti-leukemic activity. BMC Cancer. 2019;19(1):764.CrossRefPubMedPubMedCentral Wang N, Fan Y, Yuan C-M, Song J, Yao Y, Liu W, et al. Selective ERK1/2 agonists isolated from Melia azedarach with potent anti-leukemic activity. BMC Cancer. 2019;19(1):764.CrossRefPubMedPubMedCentral
18.
Zurück zum Zitat Yu F, Gajendran B, Wang N, Sample KM, Liu W, Wang C, et al. ERK activation via A1542/3 limonoids attenuates erythroleukemia through transcriptional stimulation of cholesterol biosynthesis genes. BMC Cancer. 2021;21(1):680.CrossRefPubMedPubMedCentral Yu F, Gajendran B, Wang N, Sample KM, Liu W, Wang C, et al. ERK activation via A1542/3 limonoids attenuates erythroleukemia through transcriptional stimulation of cholesterol biosynthesis genes. BMC Cancer. 2021;21(1):680.CrossRefPubMedPubMedCentral
19.
Zurück zum Zitat Liu PC, Lu G, Deng Y, Wang CD, Su XW, Zhou JY, et al. Inhibition of NF-κB pathway and modulation of MAPK signaling pathways in glioblastoma and implications for lovastatin and tumor necrosis factor-related apoptosis inducing ligand (TRAIL) combination therapy. PLoS ONE. 2017;12(1):e0171157.CrossRefPubMedPubMedCentral Liu PC, Lu G, Deng Y, Wang CD, Su XW, Zhou JY, et al. Inhibition of NF-κB pathway and modulation of MAPK signaling pathways in glioblastoma and implications for lovastatin and tumor necrosis factor-related apoptosis inducing ligand (TRAIL) combination therapy. PLoS ONE. 2017;12(1):e0171157.CrossRefPubMedPubMedCentral
20.
Zurück zum Zitat Hu H, Wang F, Wang M, Liu Y, Wu H, Chen X, et al. FAM83A is amplified and promotes tumorigenicity in non-small cell lung cancer via ERK and PI3K/Akt/mTOR pathways. Int J Med Sci. 2020;17(6):807–14.CrossRefPubMedPubMedCentral Hu H, Wang F, Wang M, Liu Y, Wu H, Chen X, et al. FAM83A is amplified and promotes tumorigenicity in non-small cell lung cancer via ERK and PI3K/Akt/mTOR pathways. Int J Med Sci. 2020;17(6):807–14.CrossRefPubMedPubMedCentral
21.
Zurück zum Zitat Parameswaran N, Bartel CA, Hernandez-Sanchez W, Miskimen KL, Smigiel JM, Khalil AM, et al. A FAM83A positive feed-back loop drives survival and tumorigenicity of pancreatic ductal adenocarcinomas. Sci Rep. 2019;9(1):13396.CrossRefPubMedPubMedCentral Parameswaran N, Bartel CA, Hernandez-Sanchez W, Miskimen KL, Smigiel JM, Khalil AM, et al. A FAM83A positive feed-back loop drives survival and tumorigenicity of pancreatic ductal adenocarcinomas. Sci Rep. 2019;9(1):13396.CrossRefPubMedPubMedCentral
22.
Zurück zum Zitat Zheng Y-W, Li Z-H, Lei L, Liu C-C, Wang Z, Fei L-R, et al. FAM83A promotes lung cancer progression by regulating the WNT and HIPPO signaling pathways and indicates poor prognosis. Front Oncol. 2020;10:180.CrossRefPubMedPubMedCentral Zheng Y-W, Li Z-H, Lei L, Liu C-C, Wang Z, Fei L-R, et al. FAM83A promotes lung cancer progression by regulating the WNT and HIPPO signaling pathways and indicates poor prognosis. Front Oncol. 2020;10:180.CrossRefPubMedPubMedCentral
23.
Zurück zum Zitat Lan C, Liu C-C, Nie X-C, Lei L, Xiao Z-X, Li M-X, et al. FAM83A promotes the proliferative and invasive abilities of cervical cancer cells via epithelial-mesenchymal transition and the WNT signaling pathway. J Cancer. 2021;12(21):6320–9.CrossRefPubMedPubMedCentral Lan C, Liu C-C, Nie X-C, Lei L, Xiao Z-X, Li M-X, et al. FAM83A promotes the proliferative and invasive abilities of cervical cancer cells via epithelial-mesenchymal transition and the WNT signaling pathway. J Cancer. 2021;12(21):6320–9.CrossRefPubMedPubMedCentral
24.
Zurück zum Zitat Liu C, Jiang Y, Han B. miR-613 suppresses chemoresistance and stemness in Triple-Negative breast cancer by targeting FAM83A. Cancer Manag Res. 2020;12:12623–33.CrossRefPubMedPubMedCentral Liu C, Jiang Y, Han B. miR-613 suppresses chemoresistance and stemness in Triple-Negative breast cancer by targeting FAM83A. Cancer Manag Res. 2020;12:12623–33.CrossRefPubMedPubMedCentral
25.
Zurück zum Zitat Zhou C, Liang Y, Zhou L, Yan Y, Liu N, Zhang R, et al. TSPAN1 promotes autophagy flux and mediates cooperation between WNT-CTNNB1 signaling and autophagy via the MIR454-FAM83A-TSPAN1 axis in pancreatic cancer. Autophagy. 2021;17(10):3175–95.CrossRefPubMed Zhou C, Liang Y, Zhou L, Yan Y, Liu N, Zhang R, et al. TSPAN1 promotes autophagy flux and mediates cooperation between WNT-CTNNB1 signaling and autophagy via the MIR454-FAM83A-TSPAN1 axis in pancreatic cancer. Autophagy. 2021;17(10):3175–95.CrossRefPubMed
26.
Zurück zum Zitat Tirado-Hurtado I, Fajardo W, Pinto JA. DNA damage inducible transcript 4 gene: the switch of the metabolism as potential target in Cancer. Front Oncol. 2018;8:106.CrossRefPubMedPubMedCentral Tirado-Hurtado I, Fajardo W, Pinto JA. DNA damage inducible transcript 4 gene: the switch of the metabolism as potential target in Cancer. Front Oncol. 2018;8:106.CrossRefPubMedPubMedCentral
27.
Zurück zum Zitat Du F, Sun L, Chu Y, Li T, Lei C, Wang X, et al. DDIT4 promotes gastric cancer proliferation and tumorigenesis through the p53 and MAPK pathways. Cancer Commun Lond Engl. 2018;38(1):45.CrossRef Du F, Sun L, Chu Y, Li T, Lei C, Wang X, et al. DDIT4 promotes gastric cancer proliferation and tumorigenesis through the p53 and MAPK pathways. Cancer Commun Lond Engl. 2018;38(1):45.CrossRef
28.
Zurück zum Zitat Yamada T, Park CS, Mamonkin M, Lacorazza HD. Transcription factor ELF4 controls the proliferation and homing of CD8 + T cells via the Krüppel-like factors KLF4 and KLF2. Nat Immunol. 2009;10(6):618–26.CrossRefPubMedPubMedCentral Yamada T, Park CS, Mamonkin M, Lacorazza HD. Transcription factor ELF4 controls the proliferation and homing of CD8 + T cells via the Krüppel-like factors KLF4 and KLF2. Nat Immunol. 2009;10(6):618–26.CrossRefPubMedPubMedCentral
29.
Zurück zum Zitat Liu T, Yao Y, Zhang G, Wang Y, Deng B, Song J, et al. A screen for Fli-1 transcriptional modulators identifies PKC agonists that induce erythroid to megakaryocytic differentiation and suppress leukemogenesis. Oncotarget. 2017;8(10):16728–43.CrossRefPubMed Liu T, Yao Y, Zhang G, Wang Y, Deng B, Song J, et al. A screen for Fli-1 transcriptional modulators identifies PKC agonists that induce erythroid to megakaryocytic differentiation and suppress leukemogenesis. Oncotarget. 2017;8(10):16728–43.CrossRefPubMed
30.
Zurück zum Zitat Howard JC, Yousefi S, Cheong G, Bernstein A, Ben-David Y. Temporal order and functional analysis of mutations within the Fli-1 and p53 genes during the erythroleukemias induced by F-MuLV. Oncogene. 1993;8(10):2721–9.PubMed Howard JC, Yousefi S, Cheong G, Bernstein A, Ben-David Y. Temporal order and functional analysis of mutations within the Fli-1 and p53 genes during the erythroleukemias induced by F-MuLV. Oncogene. 1993;8(10):2721–9.PubMed
31.
Zurück zum Zitat Wang C, Sample KM, Gajendran B, Kapranov P, Liu W, Hu A, et al. FLI1 induces megakaryopoiesis gene expression through WAS/WIP-dependent and independent mechanisms; implications for Wiskott-Aldrich Syndrome. Front Immunol. 2021;12:607836.CrossRefPubMedPubMedCentral Wang C, Sample KM, Gajendran B, Kapranov P, Liu W, Hu A, et al. FLI1 induces megakaryopoiesis gene expression through WAS/WIP-dependent and independent mechanisms; implications for Wiskott-Aldrich Syndrome. Front Immunol. 2021;12:607836.CrossRefPubMedPubMedCentral
32.
33.
Zurück zum Zitat Ben-David Y, Giddens EB, Letwin K, Bernstein A. Erythroleukemia induction by friend murine leukemia virus: insertional activation of a new member of the ets gene family, Fli-1, closely linked to c-ets-1. Genes Dev. 1991;5(6):908–18.CrossRefPubMed Ben-David Y, Giddens EB, Letwin K, Bernstein A. Erythroleukemia induction by friend murine leukemia virus: insertional activation of a new member of the ets gene family, Fli-1, closely linked to c-ets-1. Genes Dev. 1991;5(6):908–18.CrossRefPubMed
34.
Zurück zum Zitat Horton JD, Goldstein JL, Brown MS. SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J Clin invest. 2002;109(9):1125–31.CrossRefPubMedPubMedCentral Horton JD, Goldstein JL, Brown MS. SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J Clin invest. 2002;109(9):1125–31.CrossRefPubMedPubMedCentral
35.
Zurück zum Zitat Phillips MC. New insights into the determination of HDL structure by apolipoproteins: thematic review series: high density lipoprotein structure, function, and metabolism. J Lipid Res. 2013;54(8):2034–48.CrossRefPubMedPubMedCentral Phillips MC. New insights into the determination of HDL structure by apolipoproteins: thematic review series: high density lipoprotein structure, function, and metabolism. J Lipid Res. 2013;54(8):2034–48.CrossRefPubMedPubMedCentral
36.
Zurück zum Zitat Broitman SA. Dietary cholesterol, serum cholesterol, and colon cancer: a review. Adv Exp Med Biol. 1986;206:137–52.PubMed Broitman SA. Dietary cholesterol, serum cholesterol, and colon cancer: a review. Adv Exp Med Biol. 1986;206:137–52.PubMed
37.
Zurück zum Zitat Van Wyhe RD, Rahal OM, Woodward WA. Effect of statins on breast cancer recurrence and mortality: a review. Breast Cancer Dove Med Press. 2017;9:559–65.PubMedPubMedCentral Van Wyhe RD, Rahal OM, Woodward WA. Effect of statins on breast cancer recurrence and mortality: a review. Breast Cancer Dove Med Press. 2017;9:559–65.PubMedPubMedCentral
38.
Zurück zum Zitat Ness GC, Gertz KR. Increased sensitivity to dietary cholesterol in diabetic and hypothyroid rats associated with low levels of hepatic HMG-CoA reductase expression. Exp Biol Med Maywood NJ. 2004;229(5):407–11.CrossRef Ness GC, Gertz KR. Increased sensitivity to dietary cholesterol in diabetic and hypothyroid rats associated with low levels of hepatic HMG-CoA reductase expression. Exp Biol Med Maywood NJ. 2004;229(5):407–11.CrossRef
39.
Zurück zum Zitat Cipriano R, Graham J, Miskimen KLS, Bryson BL, Bruntz RC, Scott SA, et al. FAM83B mediates EGFR- and RAS-driven oncogenic transformation. J Clin Invest. 2012;122(9):3197–210.CrossRefPubMedPubMedCentral Cipriano R, Graham J, Miskimen KLS, Bryson BL, Bruntz RC, Scott SA, et al. FAM83B mediates EGFR- and RAS-driven oncogenic transformation. J Clin Invest. 2012;122(9):3197–210.CrossRefPubMedPubMedCentral
40.
Zurück zum Zitat Parmar KM, Nambudiri V, Dai G, Larman HB, Gimbrone MA, García-Cardeña G. Statins exert endothelial atheroprotective effects via the KLF2 transcription factor. J Biol Chem. 2005;280(29):26714–9.CrossRefPubMed Parmar KM, Nambudiri V, Dai G, Larman HB, Gimbrone MA, García-Cardeña G. Statins exert endothelial atheroprotective effects via the KLF2 transcription factor. J Biol Chem. 2005;280(29):26714–9.CrossRefPubMed
Metadaten
Titel
Lovastatin inhibits erythroleukemia progression through KLF2-mediated suppression of MAPK/ERK signaling
verfasst von
Jian Gao
Jifen Hu
Fang Yu
Chunlin Wang
Danmei Sheng
Wuling Liu
Anling Hu
Kunling Yu
Xiao Xiao
Yi Kuang
Eldad Zacksenhaus
Babu Gajendran
Yaacov Ben-David
Publikationsdatum
01.12.2023
Verlag
BioMed Central
Erschienen in
BMC Cancer / Ausgabe 1/2023
Elektronische ISSN: 1471-2407
DOI
https://doi.org/10.1186/s12885-023-10742-4

Weitere Artikel der Ausgabe 1/2023

BMC Cancer 1/2023 Zur Ausgabe

Labor, CT-Anthropometrie zeigen Risiko für Pankreaskrebs

13.05.2024 Pankreaskarzinom Nachrichten

Gerade bei aggressiven Malignomen wie dem duktalen Adenokarzinom des Pankreas könnte Früherkennung die Therapiechancen verbessern. Noch jedoch klafft hier eine Lücke. Ein Studienteam hat einen Weg gesucht, sie zu schließen.

Viel pflanzliche Nahrung, seltener Prostata-Ca.-Progression

12.05.2024 Prostatakarzinom Nachrichten

Ein hoher Anteil pflanzlicher Nahrung trägt möglicherweise dazu bei, das Progressionsrisiko von Männern mit Prostatakarzinomen zu senken. In einer US-Studie war das Risiko bei ausgeprägter pflanzlicher Ernährung in etwa halbiert.

Alter verschlechtert Prognose bei Endometriumkarzinom

11.05.2024 Endometriumkarzinom Nachrichten

Ein höheres Alter bei der Diagnose eines Endometriumkarzinoms ist mit aggressiveren Tumorcharakteristika assoziiert, scheint aber auch unabhängig von bekannten Risikofaktoren die Prognose der Erkrankung zu verschlimmern.

Darf man die Behandlung eines Neonazis ablehnen?

08.05.2024 Gesellschaft Nachrichten

In einer Leseranfrage in der Zeitschrift Journal of the American Academy of Dermatology möchte ein anonymer Dermatologe bzw. eine anonyme Dermatologin wissen, ob er oder sie einen Patienten behandeln muss, der eine rassistische Tätowierung trägt.

Update Onkologie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.