Introduction
Interstitial lung diseases (ILDs), diffuse parenchymal lung disorders, have high morbidity and mortality, which are characterized by progressive and irreversible lung destruction including inflammation, fibrosis, and architectural distortion [
1,
2]. The molecular mechanisms involved in the ILDs are poorly understood.
MicroRNAs (miRNAs) are ~ 20
nt small noncoding RNAs and have significant regulatory functions in interstitial lung disease development. For instance, in ILDs associated with polymyositis/dermatomyositis, miR-1 in serum was a promising novel biomarker [
3]. In systemic sclerosis-associated ILDs, miR-320a mediated the collagen expression levels to regulate the fibrotic process [
4]. MiR-140 overexpression downregulated osteoglycin, a potential and therapeutic target for ILDs, to suppress ILDs development via the Wnt signaling pathway [
5]. MiR-7 participated in activating lung fibroblast in polymyositis-related interstitial lung diseases [
6]. It was reported that miR-200c could be a biomarker of the severity of ILD because the expression levels of miR-200c had a positive correlation with the severity of ILDs [
7]. MicroRNA-155 antagomir was a therapeutic miRNA to relieve the pulmonary fibrosis induced by bleomycin [
8]. The inhibition of miR-34a effectively prevented pulmonary fibrosis [
9]. Here, miR-7 had a significant decrease in fibrotic lung tissues, and miR-7 overexpression relieved lung fibrosis in vivo [
10]. MiR-86-5p was proven to be an anti-fibrotic factor in pulmonary fibrosis [
11]. These results revealed that miRNAs had significant regulatory functions in interstitial lung disease development.
The exosomes are a kind of membrane vesicles with diameters ranging from 30 to 150 nm [
12]. The functional mRNAs, miRNAs, and proteins enclosed in exosomes, the effective and stable carriers, could be delivered to the microenvironment to participate in intercellular communication and exert numerous physiological functions. According to previous research, exosomes were reported to involve in the development of ILDs [
13,
14].
We have boldly hypothesized that a novel therapeutic miRNA contained in exosomes from A549 cells can be used in the occurrence of interstitial lung diseases, revealing the potential mechanism of this miRNA in qualitative lung diseases and possibly providing new target support for the diagnosis and treatment of ILDs.
Materials and methods
Cell purchase, culture, and transfection
A549 cells and NHLF were purchased from the Chinese Academy of Science cell bank. A549 cells were cultured in RPMI-1640 medium (31,870,082, Gibco, CA, USA). NHLF were grown in DMEM (11,995,065, Gibco, CA, USA). All cultures were supplemented with 10% fetal bovine serum (FBS, 10100147C, Gibco, CA, USA) and 1% penicillin–streptomycin (15,140,122, Gibco, CA, USA). After the confluence of NHLF reached 70–80%, miR-NC, miR-132-3p mimic, and miR-132-3p inhibitor were synthesized by Ningbo Kangbeibio Biotech Ltd. and were transfected into NHLF using Lipo6000™ Transfection Reagent (C0526, Beyotime Biotechnology, Shanghai, China). The sequences such as miR-132-3p inhibitor/mimics in this study were listed: miR-132-3p inhibitor (5′-CGACCAUGGCUGUAGACUGUUA-3′), miR-132-3p mimics (sense: 5′-UAACAGUCUACAGCCAUGGUCG-3,′ and antisense: 5′-CGACCAUGGCUGUAGACUGUUA-3′).
The isolation and purification for exosomes from A549 cells
The exosomes were isolated using Exosome Isolation Kit (UR52121; Umibio Science and Technology Group, Shanghai, China). Briefly, 20-ml supernatant of A549 cells culture was centrifuged for 20 min at 3000 g to remove the cell debris. Then, 5 ml of the exosome concentration solution was resuspended from the supernatant and incubated for 2.5 h at 4 °C. The mixture was centrifuged at 12,000 g for 60 min, resuspended in 100-μl PBS, and subsequently loaded into the exosomes purification filter to obtain the purified exosomes.
TEM identification and NTA for the exosomes from A549 cells
TEM was used for the morphology identification of the exosomes from A549 cells. Specifically, the exosome pellets were fixed by 2.5% glutaraldehyde, dehydrated with increasing alcohol concentrations, and observed under transmission electron microscopy (JEM-1400Flash, JEOL, Tokyo, Japan). A total of 100-μl exosomes were applied to ZetaView (Malvern Panalytical) to analyze the particle size.
PKH67 staining assay
To observe the exosome uptake for NHLF, the exosomes from A549 cells were labeled with PKH67-by-PKH67 Green Fluorescent Cell Linker Mini Kit (MINI67, Sigma, MO, USA) and were co-cultured with NHLF for 30 min. NHLF were incubated with Hoechst 33,342 staining solution (C1029, Beyotime Biotechnology, Shanghai, China) at 37 °C to obverse the nuclei. The fluorescence images were captured by the confocal microscope (Leica, Wetzlar, Germany).
MTT assay
MTT Cell Proliferation and Cytotoxicity Assay Kit (C0009S, Beyotime Biotechnology, Shanghai, China) were applied to determine the cell viability of NHLF. In brief, NHLF were plated into 96-well plates at the density of 1 × 103 cells/well. Subsequently, each well of the plate was added with 10-μl MTT reagent for 4-h incubation, treated with the formazan solvent, and measured at the wavelength of 570 nm.
A total of 100-μl NHLF suspensions (1 × 104 cells/ml) in different groups were seeded into a 6-well plate, and the NHLF were cultured in DMEM containing 10% FBS for 14 days. After culture for 14 days, the cells were rinsed with PBS, fixed, and stained. The cell clusters containing > 50 cells were counted and imaged by a CX41 light microscope (Olympus, Tokyo, Japan).
Flow cytometry assay
Flow cytometry was employed to examine the apoptosis of NHLF [
15]. NHLF in different groups were stained with Annexin V-FITC/PI Cell Apoptosis Detection Kit (AC12L033; Shanghai Life iLab Biotech Ltd., Shanghai, China). NHLF were digested, centrifuged, collected, and stained with 5 μl of FITC-Annexin V and 5-μl PI for 10 min incubation under dark. Countstar Rigel S3 flow cytometer was used for analysis.
Western blotting assay
As previous study [
16], the proteins were extracted from NHLF and the exosomes from A549 cells using RIPA buffer (high) (R0010, Solarbio, Shanghai, China) on ice for 20 min and quantified by BCA Kit (PC0020; Shanghai Acmec Biochemical Co., Ltd., Shanghai, China). All antibodies were purchased from Finetest Biotech Ltd. (Wuhan, China) or Abcam (Shanghai, China): anti-CD81 (1:500; FNab10448), anti-TSG101 (1:1000; FNab10812), anti-Alix (1:1000; ab275377), anti-tubulin (1:5000; ab6160), anti-Ki67 (1:200; FNab09788), anti-PCNA (1:5000; FNab06217), anti-Bcl-2 (1:1500, ab194583), anti-Bax (1:1500, ab32503), anti-Caspase-3 (1:2000, ab2302), anti-SPRY1 (1:1000; ab111523), and anti-β-actin (1:5000; ab8226). β-actin was used to normalize protein expression levels. Afterward, the horseradish peroxidase-labeled goat anti-rabbit HRP antibody (1:5000, ab97051) and goat anti-mouse HRP antibody (1:5000, ab205719) were purchased as the secondary antibody. Finally, protein bands were developed using ECL Plus Ultra-Sensitive Kit (PH0353, Phygene Life Sciences Company, Fuzhou, China).
Mouse models of bleomycin (BLM)-induced interstitial lung disease
Six-week-old male C57BL/6 J (B6) mice were purchased from Cavens Biogel (Suzhou, China), raised in a clean animal cabinet at 26 ℃, 12-h light/12-h dark period, and free to obtain water and full nutrition food. For the BLM group, the mice were treated with an intratracheal injection of 1 mg/ml BLM. After 10 days, the mice were treated with 100 μg exo, exo + miR-NC, or exo-miR-132-3p inhibitor via tail vein every 3 days for three times. After 25 days, mice were sacrificed, and lung tissues were separated to observe the histological changes.
Real-time quantitative polymerase chain reaction (RT-qPCR) assay
The total RNA from NHLF and lung tissues were extracted by TsingZol Total RNA Extraction Reagent (TSP401, Tsingke, Nanjing, China) according to previous reports [
15]. HiScript II 1st-Strand cDNA Synthesis Kit (+ gDNA wiper) and miRNA 1st-Strand cDNA Synthesis Kit (R212-01 and MR101-01, correspondingly) were utilized to achieve the mRNA and miRNA expressions by ChamQ Universal or miRNA SYBR Mix (Q711-02/03 and MQ101-01/02, correspondingly). These products were purchased from Vazyme (Nanjing, China). All primers were synthesized by MBL Beijing Biotech Co., Ltd., and GAPDH or U6 was used as the internal reference. The sequences of the primers were displayed in Table
1.
Table 1
Primers were used in this work
miR-132-3p | GCGCGTAACAGTCTACAGCCA | AGTGCAGGGTCCGAGGTATT |
SPRY1 | TGGATGACTTGAAGGGTT | CAAACAGGATGGTAGGGT |
COL1A1 | AAGGTGTTGTGCGATGACG | TGGTCGGTGGGTGACTCTG |
COL3A1 | GAGCTGGCTACTTCTCGC | TCTATCCGCATAGGACTGAC |
α-SMA | GGGGTGATGGTGGGAATG | GCAGGGTGGGATGCTCTT |
FN | TGTTATGGAGGAAGCCGAGGTT | GCAGCGGTTTGCGATGGT |
CXCL12 | CTGTGCCCTTCAGATTGTA | GCTTTCTCCAGGTACTCCT |
IL-1β | ACAGTGGCAATGAGGATG | TGTAGTGGTGGTCGGAGA |
IL-6 | GGAGACTTGCCTGGTGAA | GCATTTGTGGTTGGGTCA |
IL-8 | CTCCAAACCTTTCCACCCC | GATTCTTGGATACCACAGAGAATG |
TGF-β1 | CTCGGGGGCTGCGGCTACTG | GGCGTATCAGTGGGGGTCA |
GAPDH | GAAGGTGAAGGTCGGAGTC | GAAGATGGTGATGGGATTTC |
U6 | CTCGCTTCGGCAGCACATATA | AACGCTTCACGAATTTGCGT |
Luciferase reporter assays
To validate further whether sprouty1 (SPRY1) was a direct target of miR-132-3p, the binding sites of wild-type (WT) and mutant (MUT) sequences of SPRY1 3′UTR with miR-132-3p were cloned into the pmirGLO vector to generate SPRY1-WT or SPRY1-MUT [
17]. These reporter plasmids were co-transfected with miR-132-3p mimic or mimic NC into NHLF for 48 h. The luciferase activity was assessed by the Luciferase Reporter Gene Assay Kit (RG027, Beyotime Biotechnology, Shanghai, China).
Statistical analysis
Statistical analysis was performed using GraphPad Prism 7.0 software. Data were demonstrated as means ± standard deviation (SD). Two-tailed Student’s t-test and one-way ANOVA with Turkey’s test were performed to compare the difference between two or multiple groups, respectively. Data with P-values smaller than 0.05 was considered a significant difference.
Discussion
Exosomes have become an important factor to affect the progression of fibrotic diseases by transferring anti-fibrotic or pro-fibrotic miRNAs to target cells and influencing the occurrence of pathological fibrosis. The potential functions of exosomal miRNAs on the development of interstitial lung disease laid the groundwork for understanding the molecular mechanism of ILDs [
19,
20]. It was reported that the exosomes effectively promoted lung repair in pulmonary fibrosis because the treatment of exosomes decreased collagen accumulation and myofibroblast proliferation [
21]. Furthermore, overwhelming studies have revealed that the anti-fibrotic miR-142-3p from macrophage-derived exosomes attenuated the pulmonary fibrosis progression [
19]. The exosomal let-7d and miR-16 from serum have important roles in the pathogenesis of idiopathic pulmonary fibrosis [
22]. In our work, the exosomes derived from A549 cells were demonstrated to exhibit a promotive role in normal human lung fibroblast activation and pulmonary fibrosis. Based on the results of a high-throughput sequencing, unregulated miR-132-3p was screened out, and miR-132-3p overexpression aggravated the fibrotic process of normal human lung fibroblast by activating the fibrosis/pro-inflammatory-associated gene mRNA levels. This is consistent with the study of Pellegrini Kathryn L. et al., in which miR-132-3p levels are upregulated in the entire renal cortex of mice and humans in the presence of severe fibrosis [
23]. In vivo, the exosomes with inhibition of miR-132-3p significantly inhibited the pulmonary fibrosis induced by BLM.
Apart from the interstitial lung disease, miR-132-3p overexpression resulted in a size enlargement of cardiac fibroblasts to mediate cardiac fibrosis [
24]. In addition, miR-132 inhibitor markedly inhibited the Ang II-induced activation of cardiac fibroblasts and cardiomyocyte hypertrophy [
25]. Inhibition of miR-132 reduced renal fibrosis by weakening myofibroblast proliferation [
26]. MiR-132 was downregulated to inhibit the JAK-STAT signaling pathway to alleviate detrusor fibrosis [
27]. The increase of miR-132 attenuated liver fibrosis by inducing the degradation of connective tissue growth factor (CTGF) mRNA [
28]. In general, it implied that miR-132 served as an effector molecule in multiple fibrotic diseases.
In numerous fibrosis diseases, miR-132 was reported to have multiple targets. In atrial fibrosis, miR‑132 targeted CTGF [
29]. And CTGF was a major pro‑fibrotic factor, which promotes the synthesis of extracellular matrix to accelerate the generation of fibrosis [
30]. MiR-132 also targeted and inhibited the phosphatase and tensin homolog (PTEN) expression to attenuate cardiac fibrosis [
31]. In our work, miR-132-3p targeted and inhibited sprouty1 (SPRY1) to promote the development of interstitial lung disease. And the knockdown of SPRY1 significantly reversed the inhibition effect of miR-132-3p inhibitor on the ILDs progress. In liver fibrosis disease, miR-21 had a positive correlation with liver fibrosis, and overexpression of miR-21 promoted collagen production and inflammasome activation when the expression of SPRY1 was inhibited [
32]. In cardiac fibroblasts, the degradation of Spry1 contributed to fibrosis [
33]. For atrial fibrosis, the proliferation abilities of cardiac fibroblasts and the expression of TGF-β1 were significantly promoted when Spry1 was knock down [
34]. These reports suggested that the degradation of Spry1 contributed to accelerating the process of fibrosis in multiple fibrotic diseases.
Conclusions
To sum up, exosomal miR‑132-3p from A549 cells promoted fibrosis in NHLF by downregulating the expression of Spry1. Our study took insight into the underlying mechanism of the interstitial lung disease, and proved miR‑132-3p as a potent target for ILDs, which provided a novel aspect for the treatment of ILDs.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.