Introduction
Throughout the world, diabetes is a growing health burden. Largely unknown in the early twentieth century, type 2 diabetes (T2D) is now the 7th leading cause of death in the USA mainly due to increased cardiovascular mortality in T2D [
1,
2]. One mechanism linking diabetes to increased cardiovascular risk is accelerated arterial stiffening that is frequently observed in diabetic patients [
3]. Stiffening of large arteries leads to various adverse hemodynamic consequences, rendering arterial stiffness an independent risk factor of cardiovascular disease [
4,
5]. In that respect, the Hoorn study clearly demonstrated that T2D is especially associated with increased central arterial stiffness [
6].
The aorta is the biggest vessel of the body and channels the blood flow from the heart to the periphery. Its elastic nature offers a buffering capacity (Windkessel function) to equalize blood flow during systole and diastole. As such, the aortic wall is an important responder to the biomechanical forces induced by the cyclic nature of blood flow.
Elevated arterial stiffness may result from increased collagen built-up in the arterial wall [
7]. However, little is known about the underlying molecular mechanisms.
T2D is a chronic state characterized by hyperglycemic stimuli and low-grade inflammation [
8]. Endothelial cells are early targets of these destructive conditions and hold a critical role in the production of extracellular matrix (ECM) proteins in diabetic complications [
9‐
11]. Endothelial-to-mesenchymal transition (EndMT) is a biologic process that forces endothelial cells to undergo dynamic phenotypic switching (transition) in the context of sustained injury. Such changes in endothelial cells are manifested by a loss of endothelial markers and gain of mesenchymal markers [
12‐
15]. EndMT has been shown to be a main source of fibroblasts triggering an increased production of ECM proteins in organ fibrosis [
16‐
18].
New evidence suggests that EndMT is epigenetically regulated by a class of small non-coding RNAs called microRNA (miRs) [
12,
19‐
22]. MiRs are short single stranded RNAs, that repress the expression of messenger RNAs (mRNAs) by binding to 3′UTR regions that are (partially) complimentary to their own code [
23]. The number of mRNAs that may be affected by a single miR is estimated to be in the hundreds [
24‐
27].
Here, we demonstrate that EndMT contributes to aortic stiffening in T2D and identify miR-132-3p and KLF7 as novel regulators in EndMT-triggered arterial stiffening.
Methods
Pressure myography
Pressure myography was performed to directly assess the passive aortic mechanics ex vivo as previously described (PubmedID 26208651). In brief, murine aortae were explanted, placed on specially designed stainless-steel cannulas and secured with silk surgical suture (10-0). The vessel was mounted in the heated chamber of a pressure arteriograph system (Model 110P, Danish Myotechnology, Copenhagen, Denmark) and stretched to in vivo length. Physiological saline solution (PSS) at 37 °C, aerated with 5% CO2/95% O2 was used to fill the vessel chamber and for aortic perfusion. After 3 preconditioning cycles, the aortic passive pressure-diameter relationship was determined by an automated protocol. The artery was pressurized from 0 to 180 mmHg in 18 mmHg increments, and the vessel’s outer diameter was simultaneously tracked by continuous computer video analysis (MyoVIEW software, Danish Myotechnology, Copenhagen, Denmark). The resting diameter d0 was quantified under 0 mmHg intraluminal (transmural) pressure and was not significantly different between the experimental groups tested (d0~1000 µm).
Immunofluorescence staining of aortic sections of db/db mice
Male db/db mice (BKS.Cg-Dock7m+/+Leprdb/J) and their age-matched heterozygous non-diabetic controls (+/db) were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). After 20 weeks, mice were exposed to inhalation of a lethal dose of isoflurane (concentration of 5%, Vet One, Meridian, ID, USA) in a closed chamber. Isoflurane was delivered from a vaporizer-system with O2 as a carrier. Thoracic aortas were harvested and snap-frozen in liquid nitrogen. All animal studies were reviewed and approved by the responsible local animal ethics review boards and procedures were conform to the guidelines from Directive 2010/63/EU of the European Parliament on the protection of animals used for scientific purposes. The cryo-sections were fixed with methanol at − 20 °C for 10 min and air-dried before washing three times with PBS. The sections were blocked using SEA BLOCK Blocking Buffer (Thermo Fisher Scientific, Waltham, MA, USA) and incubated at RT for 1.5 h. The primary antibody was added to the sections and incubated at 4 °C overnight. The next day, the slides were three times washed with PBS before adding the secondary antibody and incubating in the dark at RT for 45 min. The slides were washed three times with PBS and incubated with DAPI (1:1000 in PBS) at RT for 5 min. A final washing with PBS was performed before mounting the slides. The following primary antibodies and dilutions (in SEA BLOCK) were used: mouse anti-human CD31 (1:100, M0823, Dako, Carpinteria, CA, USA), rabbit anti-human S100A4 (1:50, A5114, Dako, Carpinteria, CA, USA), rabbit anti-mouse α-SMA (1:100, ab5694, Abcam, Cambridge, MA, USA) and rabbit anti-KLF7 (1:50, ab197690, Abcam, Cambridge, MA, USA). The secondary antibodies Alexa Fluor 647 goat-anti mouse (A21235, Invitrogen, Carlsbad, CA, USA) and Alexa Fluor 568 donkey anti-rabbit (A10042, Invitrogen, Carlsbad, CA, USA) were used in a 1:200 dilution. The stained slides were analysed using the Inverted Zeiss LSM 780 multiphoton laser scanning confocal microscope (Zeiss, Oberkochen, Germany).
Human tissue sample acquisition and preparation
Human thoracic aortic samples from patients with diabetes (n = 5) and without diabetes (n = 5) who underwent open aortic surgery were collected during the procedure, snap-frozen and stored at − 80 °C. Groups were matched for age (patients with diabetes: 67.20 ± 2.059 years; patients without diabetes 65.60 ± 2.379 years; p = ns) and smoking status (patients with diabetes 40% smoker; patients without diabetes: 60% smoker; p = ns). Approval for studies on human tissue samples was obtained under informed consent and conducted in accordance with the Declaration of Helsinki.
RNA extraction and quantitative real-time PCR for aortic sections of db/db mice and human tissue
Total RNA was extracted using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) and the PureLink RNA Mini Kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The RNA was treated with Dnase I (Sigma-Aldrich, St. Louis, MO, USA) and the SuperScript II Reverse Transcriptase system (Invitrogen, Carlsbad, CA, USA) was used to synthesize cDNA according to the manufacturer’s protocol. For qRT-PCR, Fast SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA) was used in combination with the StepOne Plus Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). The primers used for qRT-PCR are listed in Table
1. The relative expression levels were standardized to GAPDH using the ΔΔCt method.
Table 1
qRT-PCR primer sequences
GAPDH | F: GTGGACCTGACCTGCCGTCT R: GGAGGAGTGGGTGTCGCTGT | Gapdh | F: TGTAGACCATGTAGTTGAGGTCA R: AGGTCGGTGTGAACGGATTTG |
SNAIL | F: GGCAATTTAACAATGTCTGAAAAGG R: GAATAGTTCTGGGAGACACATCG | Snail | F: GTGCCCACCTCCAAACCC R: AAGGACATGCGGGAGAAGG |
SLUG | F: ACTCCGAAGCCAAATGACAA R: CTCTCTCTGTGGGTGTGTGT | Slug | F: CGCTCCTTCCTGGTCAAGA R: AGGTATAGGGTAACTTTCATAGAGATA |
TWIST | F: GTCCGCAGTCTTACGAGGAG R: TGAATCTTGCTCAGCTTGTCC | Twist | F: TGATAGAAGTCTGAACACTCGTTTG R: GGCTGATTGGCAAGACCTCT |
SMAD2 | F: GGGTTTTGAAGCCGTCTATCAGC R: CCAACCACTGTAGAGGTCCATTC | Klf7 | F: GGAAGGATGCGAGTGGCGTTTT R: CGCAAGATGGTCAGACCTGGAG |
ZEB2 | F: AATGCACAGAGTGTGGCAAGGC R: CTGCTGATGTGCGAACTGTAGG | | |
KLF7 | F: CTCACGAGGCACTACAGGAAAC R: TGGCAACTCTGGCCTTTCGGTT | | |
PTEN | F: TGAGTTCCCTCAGCCGTTACCT R: GAGGTTTCCTCTGGTCCTGGTA | | |
ZBTB20 | F: CTCTGCAACAAGACTTTCACCGC R: AGGAGAAGGAGCGCCAACAGAT | | |
DNMT3a | F: CCTCTTCGTTGGAGGAATGTGC R: GTTTCCGCACATGAGCACCTCA | | |
Micronome data
The micronome of glucose-treated HUVECs and the micronome of aortic vascular smooth muscle cells from db/db mice and db/+controls are available at Gene Expression Omnibus (GEO), NCBI (GSE74296 and GSE74521).
RNA quantification and qRT-PCR miR-132-3p in human subjects
Total microRNA was isolated using a TRIzol-based (Invitrogen, Carlsbad, CA, USA) RNA isolation protocol. Reverse transcription was performed by using the TaqMan microRNA Reverse Transcription kit (Applied Biosystems, Foster Biosystems, Foster City, USA) according to the manufacturer’s instructions. MicroRNA TaqMan assays (Applied Biosystems, Foster City, USA) for hsa-miR-132-3p was used. Amplification took place on a Fast-Real-Time PCR System (Applied Biosystems, Foster City, USA). All fold changes were calculated by the method of ΔΔCt.
Cloning
A fragment of the human 3′UTR of KLF7 which contains two miR-132-3p binding sites was amplified using Phusion High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA) and the primers KLF7-3′UTR-F: 5′ AATTACTAGTACCATCCCTTCAAGACACGT; KLF7-3′UTR-R: 5′ AATTGTTTAAACCCCAGATCTTGAAGGTTGCTG. Both the amplified PCR product and the pMiR-REPORT miRNA expression vector (Invitrogen, Carlsbad, CA, USA) were digested using SpeI and PmeI restriction enzymes (New England Biolabs, Ipswich, MA, USA). Ligation was performed using the LigaFast Rapid DNA Ligation System (Promega, Madison, WI, USA) and transformed into One Shot TOP10 Chemically Competent E. coli (Invitrogen, Carlsbad, CA, USA). Miniprep was performed using the Zyppy Plasmid Miniprep Kit and the sequence of the insert was confirmed using sequencing. The generated pMiR-REPORT-KLF7-3′UTR plasmid was amplified using the HiSpeed Plasmid Midi Kit (Qiagen, Hilden, Germany).
Cell culture and glucose treatment
Human embryonic kidney (HEK293) cells were cultured in DMEM medium (Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Gibco, Carlsbad, CA, USA) and 1% penicillin–streptomycin (Gibco, Carlsbad, CA, USA). Human umbilical vein endothelial cells (HUVECs; Lonza, Basel, Switzerland) were cultured in Endothelial Cell Growth Medium (EGM-2MV, Lonza, Basel, Switzerland). For glucose treatment, 0.2 × 10
6 cells were plated and cultured as previously described [
29] to induce EndMT. 60 mM
d-glucose was supplemented for 4 days and the medium was changed every 2 days. 5.5 mM
d-glucose plus 54.5 mM
d-mannitol was used as control.
Transfection of HEK293 cells
0.5 × 106 HEK293 cells were plated on a 6-well plate and incubated overnight. The next day, the HEK293 cells were transfected by using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA). In short, 2 ug of pMiR-REPORT-KLF7-3′UTR and 1 ug of pGL4.73[hRluc/SV40] (renilla) vector (Promega, Madison, WI, USA) together with 5 nM of hsa-miR-132-3p miRCURY LNA miRNA mimic (YM00472088, Qiagen, Hilden, Germany) or negative control miRCURY LNA miRNA mimic (YM00479902, Qiagen, Hilden, Germany) was added in a tube containing 250 µL Opti-MEM Reduced Serum Medium (Gibco, Carlsbad, CA, USA). Another tube was prepared containing a mastermix of 250 µL Opti-MEM and 5 µL of Lipofectamine 2000 per transfection. The tubes were mixed at RT for 5 min before combining the Lipofectamine 2000 mixture with the DNA mixture. The tubes were mixed again before incubating at RT for 20 min. The transfection complexes were added drop-wise to the cells and incubated overnight. The next day, the medium was changed. The cells were collected 72 h after transfection.
Luciferase reporter assay
The luciferase assay was performed using the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA). In short, the cells were lysed with 1:5 diluted passive lysis buffer by shaking at RT for 30 min. Centrifugation at 13,000 rpm for 10 min was performed to collect the supernatant (containing the cell lysate). The cell lysate was added in triplicates to a 96 well plate before adding Luciferase Assay Reagent II (for Firefly luciferase activity) and Sto&Glo Reagent (for Renilla luciferase activity) to detect the luminescence with the help of a luminescence plate reader.
Transfection of HUVECs
0.2 × 106 HUVECs were plated on a 6-well plate and incubated overnight. The next day, the HUVECs were transfected by using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA). In short, for miR-132-3p overexpression, 10 pmol of hsa-miR-132-3p miRCURY LNA miRNA mimic (YM00472088, Qiagen, Hilden, Germany) or Silencer Negative Control No.1 siRNA (AM4635, Ambion, Austin, TX, USA) was added in a tube containing 250 µL Opti-MEM (Gibco, Carlsbad, CA, USA). For KLF7 KO, 50 pmol of KLF7 Silencer Select siRNA (Ambion, Austin, TX, USA) or Silencer Negative Control No.1 siRNA (AM4635, Ambion, Austin, TX, USA) was added in a tube containing 250 µL Opti-MEM (Gibco, Carlsbad, CA, USA). Another tube was prepared containing a mix of 250 µL Opti-MEM and 5 µL of Lipofectamine 2000 per transfection. The tubes were incubated at RT for 5 min. before combining the Lipofectamine 2000 mixture with the siRNA/miRNA mixture. The Lipofectamine 2000 mix was combined with the siRNA/miRNA mix and incubated at RT for 20 min. The transfection complexes were added drop-wise to the cells and incubated for 4 h. After 4 h the medium was changed. The next day d-glucose and d-Mannitol treatment was started. The cells were collected 72 h after transfection.
RNA extraction and qRT-PCR in HUVECs
Total RNA was extracted using TRIzol Reagent (Ambion, Austin, TX, USA) according to the manufacturer’s protocol. The RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA) was used to synthesize cDNA according to the manufacturer’s protocol. For qRT-PCR, Fast SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA) was used in combination with the Viia7 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). The primers used for qRT-PCR are listed in Table
1. The relative expression levels were standardized to GAPDH using the ΔΔCt method.
RNA quantification and qRT-PCR miR-132-3p in HUVECs
Total microRNA was isolated using a TRIzol Reagent (Ambion, Austin, TX, USA) according to the manufacturer’s protocol. Reverse transcription was performed by using the TaqMan microRNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA) and microRNA-specific stemloop primers (Table
2). For miR-qRT-PCR, analysis was performed on a mixture containing 5 ng cDNA equivalent, 0.1 µM sense primer, 0.1 µM antisense primer (Table
3) and Fast SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA). Analysis was performed on the Viia7 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). The relative expression levels were standardized to U6 using the ΔΔCt method.
Table 2
miRNA-specific CDNA synthesis primer sequences
miR-132-3p-SL primer | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGACCATG |
RNU6-SL primer | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAAATATGG |
Table 3
miR-132-3p qRT-PCR primer sequences
miR-132-3p | F: TGCGGTAACAGTCTACAGC |
RNU6 | F: TGCGGCTGCGCAAGGATGA |
miR-Reverse | R: GTGCAGGGTCCGAGGT |
Immunofluorescence staining of HUVECs
Cells were two times washed with PBS before being fixed with 2% PFA at RT for 30 min. After another two washes with PBS, cells were permeabilized with 0.5% Triton in PBS for 15 min. Cells were washed again 3× in PBS and blocked with blocking buffer (5% donkey or goat serum in PBS) for 10 min. Cells were incubated with primary antibody (1:100 in blocking buffer) overnight at 4 °C. The next day, cells were washed with PBS, PBS + 0.05% Tween-20 and again with PBS before incubation with secondary antibody (1:500) in DAPI (1:5000) and 2% Human Serum for 60 min at RT in the dark. Cells were washed with PBS, PBS + 0.05% Tween-20 and PBS and stored in PBS at 4 °C until analysis. The following primary antibodies were used: mouse anti-human CD31 (M0823, Dako, Santa Clara, CA, USA), rabbit anti-human SM22α (ab14106, Abcam, Cambridge, MA, USA). Alexa Fluor 647 donkey anti-mouse (A31571, Invitrogen, Carlsbad, CA, USA) and Alexa Fluor 568 goat anti-rabbit (A21069, Invitrogen, Carlsbad, CA, USA) were used as secondary antibodies. The cells were analyzed using the EVOS FL cell imaging system (Life Technologies, Carlsbad, CA, USA).
Statistics
For pressure myography analysis, 2-way repeated measures ANOVA was used. Normality and homoscedasticity were tested to ensure that parametric testing was appropriate. The co-localization data is presented as the mean ± SEM. Co-localization was assessed in 3 aortic sections per mouse and average values of each mouse were calculated. The average values for each mouse (n = 4) was then used to calculate average per group. Statistical analysis was performed using a Student’s t test (two-tailed). For qPCR analysis, the data is presented as the mean ± SD. Statistical analysis was performed using 1-way ANOVA with Turkey multiple comparisons test. A value of p < 0.05 was considered statistically significant.
Discussion
In this study, we demonstrate that aortas of db/db mice (a murine model of type 2 diabetes) and diabetes patients but not of control mice and subjects display robust signs of EndMT. We identified that miR-132-3p is downregulated in aortas of both db/db mice and diabetic patients as well as in an in vitro model of glucose-induced EndMT. Moreover, we demonstrate that miR-132-3p targets KLF7, which is upregulated in an in vitro model of diabetes-associated EndMT, during EndMT-triggered aortic stiffening in db/db mice as well as in aortas of diabetes patients. Finally, we show that miR-132-3p overexpression as well as KLF7 downregulation ameliorates EndMT in an in vitro model of diabetes-associated EndMT, thereby identifying both miR-132-3p and KLF7 as novel regulators of aortic stiffening-associated EndMT in type 2 diabetes mellitus. A summary of the proposed mechanism is provided in Fig.
6.
Accelerated aortic stiffening is an independent predictor of cardiovascular disease and mortality in diabetes patients. We previously showed that aortic stiffness precedes hypertension in db/db mice, making aortic stiffness an early contributor to cardiovascular disease development [
7]. Elucidating how aortic stiffening develops is therefore a pressing need in order to halt the pathophysiological process at an early time point. We now identify EndMT as a novel contributor to aortic stiffness in T2D. This is consistent with the literature in which high glucose-induced EndMT has been demonstrated in vitro before [
28,
29], and has also been reported to be associated with diabetic cardiomyopathy [
30‐
33].
MicroRNAs have been shown to regulate EndMT in the context of diabetes [
20,
34,
35]. We are the first to identify miR-132-3p as a possible regulator of EndMT and its association with both cardiovascular disease and T2D. Other studies have shown that downregulation of miR-132-3p promotes migration and proliferation in the context of carcinoma, which suggests a role for miR-132-3p in epithelial-to-mesenchymal transition (EMT), a cellular transition process similar to EndMT [
36‐
40].
We demonstrate that miR-132-3p regulates KLF7 and thereby identify KLF7 as a novel regulator of EndMT. KLF7 is a member of the KLF7 family of zinc finger transcription factors which are known to play an important role in development and cellular differentiation processes such as EMT [
41‐
44]. Moreover, KLF7 has been identified as one of the core transcription factors that regulate coronary artery disease-associated pathways [
45]. This supports our data, as it has been shown that EndMT drives the progression of coronary artery disease [
14,
46]. This confirms that KLF7 might be an important player in EndMT-triggered arterial stiffness in T2D.
To conclude, we demonstrate that EndMT contributes to aortic stiffening in T2D. We also identified miR-132-3p and KLF7 as potential regulators of EndMT in this context. Altogether, this provides new insights in the development of aortic stiffening in T2D.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.