MicroRNAs (miRNAs) are small-sized transcripts with about 22 nucleotide length. They have been shown to influence almost every aspect of cellular functions through regulation of expression of target genes. miR-1908 is a miRNA with diverse roles in human disorders. This miRNA is encoded by MIR1908 gene on chr11:61,815,161–61,815,240, minus strand. Expression assays have confirmed dysregulation of miR-1908 in cancer-derived cell lines in addition to biological samples obtained from patients affected with cancer. In most assessed cell lines, miR-1908 has an oncogenic role. However, this miRNA has been shown to act as a tumor suppressor in chordoma, lung cancer and ovarian cancer. In addition, several lines of evidence have shown involvement of this miRNA in the pathoetiology of bipolar disorder, myocardial infarction, obesity, renal fibrosis, rheumatoid arthritis and scar formation. In the current review, we elucidate the results of diverse studies which evaluated participation of miR-1908 in these conditions.
Hinweise
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Introduction
microRNAs (miRNAs) are a group of regulatory non-coding RNAs with sizes about 22 nucleotides [1]. In multicellular organisms, miRNAs affect both the stability and translation of mRNAs, thus participating in modulation of gene expression at post-transcriptional level. RNA polymerase II-mediated transcription of miRNAs leads to production of capped and polyadenylated primary transcripts, which are then, cleaved by a specific type of ribonuclease III enzymes. This enzymatic process results in production of stem-loop structures with approximate size of 70 nucleotides. These so-called precursor miRNAs are subjected to another round of cleavage by the cytoplasmic Dicer ribonuclease. The mature miRNA produced by these two rounds of processing is assimilated into a RNA-induced silencing complex (RISC). RISC identifies target mRNAs via a base pairing process resulting in suppression of mRNA translation or its destabilization [2]. miRNAs contribute in diverse biological processes for example cell proliferation, differentiation and apoptosis, thus contributing in the pathoetiology of diverse disorders [3, 4].
miR-1908 is encoded by MIR1908 gene on chr11:61,815,161-61,815,240, minus strand. The stem loop sequence of this miRNA is as follows: CGGGAAUGCCGCGGCGGGGACGGCGAUUGGUCCGUAUGUGUGGUGCCACCGGCCGCCGGCUCCGCCCCGGCCCCCGCCCC (https://www.mirbase.org/cgi-bin/mirna_entry.pl?acc=MI0008329).
Anzeige
This miRNA contains some single nucleotide polymorphisms (SNPs). Genome wide association studies (GWAS) and evaluation of human regulatory elements (enhancers and promoters) have indicated association between these SNPs and red blood cell distribution width, serum metabolite levels, neuroimaging measurement, brain volume measurement, asthma, bipolar disorder, and response to carboplatin (https://www.genecards.org/cgi-bin/carddisp.pl?gene=MIR1908). Thus, this miRNA is regarded as a candidate gene for several human phenotypes and disorders. Expression assays have also confirmed abnormal expression levels of miR-1908 in cancer-derived cell lines as well as biological samples obtained from patients affected with cancer. In addition, several lines of evidence have shown involvement of this miRNA in the pathoetiology of bipolar disorder, myocardial infarction, obesity, renal fibrosis, rheumatoid arthritis and scar formation. In the current review, we elucidate the results of diverse studies which evaluated participation of miR-1908 in these conditions. The reason of selection of this miRNA was its newly identified roles in diverse cancers, particularly its opposite roles in different contexts.
The impact of miR-1908 in the carcinogenesis based on cell line studies
Experiments in two breast cancer cells have indicated the role of miR-1908-3p in enhancement of cells proliferation, migration and invasion [5]. Further evaluations in these context have potentiated ID4, LTBP4, GPM6B, RGMA, EFCAB1, ALX4, OSR1 and PPARA as targets of this miRNA [5].
In cervical cancer cell lines, expression of miR-1908 has been found to be upregulated. Over-expression of miR-1908 has augmented growth and invasion of cervical carcinoma cells. Consistently, miR-1908 silencing has led to opposite effect. In silico and functional studies have validated interaction between miR-1908 and HDAC10. Besides, ectopic expression of HDAC10 in cervical cancer cells could reverse the effect of miR-1908 to some extent. Taken together, miR-1908 increases aggressive behavior of cervical cancer cells through targeting HDAC10 [6].
Up-regulation of miR-1908 in glioblastoma cells has enhanced anchorage-independent growth. This miRNA could suppress PTEN expression through binding with its 3’-UTR. Thus, miR-1908 has an oncogenic role in glioblastoma through inhibition of PTEN pathway [7]. Another study in glioma has shown that miR-1908 has a role in enhancement of proliferation and invasion, as well as suppression of apoptosis through regulation of SPRY4/RAF1 axis. In silico analyses has indicated involvement of miR-1908 in the regulation of pathways related with cell proliferation, invasion and apoptosis. Up-regulation of miR-1908 has induced anti-apoptotic effects in glioma cells via reducing expression levels of Bax. SPRY4 as one of validated miR-1908 targets has interactions with the pro-oncogene RAF1. Up-regulation of miR-1908 has led to down-regulation of SPRY4 expression and up-regulation of RAF1 [8]. Figure 1 shows the molecular axes mediating the oncogenic roles of miR-1908 in a number of cancers.
Fig. 1
Oncogenic role of miR-1980
×
Anzeige
Contrary to the bulk of evidence in the above-mentioned types of cancers, miR-1908 has been shown to induce tumor suppressor impacts in ovarian cancer and lung cancer (Fig. 2). An in vitro study in non-small cell lung cancer has indicated down-regulation of miR-1908. miR-1908 mimics could reduce proliferation of these cells. Furthermore, RP-p53 pathway has been shown to be activated by miR-1908 mimics. The suppressor of the RP-p53, AKT1S1 has been found to be targeted by miR-1908 [9].
Fig. 2
Tumor suppressor role of miR-1980
×
Table 1 summarizes the results of in vitro studies on the role of miR-1908 in the carcinogenesis.
Table 1
Function of miR-1908 in cancers based on studies in cell lines (∆: knock-down or deletion)
Tumor type
Interactions
Cell lines
Function
Exact role
References
Breast cancer
ID4, LTBP4, GPM6B, RGMA, EFCAB1, ALX4, OSR1 and PPARA
MCF-10A, MCF-7, MDA-MB-231
↑↑ miR-1908-3p: ↑ proliferation, migration and invasion
Function of miR-1908 in non-malignant disorders based on studies in cell lines
A single study in the context of bipolar disorder has stated that a number of validated targets of miR-1908-5p, namely DLGAP4, GRIN1, STX1A, CLSTN1 and GRM4 are involved in the regulation of glutamatergic synapses in neurons. Besides, in silico assessments have also confirmed inverse correlation between expression of miR-1908-5p and these synaptic targets in many regions of human brain. Expression levels of miR-1908-5p in normal human neural progenitor cells have been surged following chronic treatment with valproate. However, treatment of these cells with lithium has not affected expression of this miRNA. Most notably, valproate has reduced expression of this miRNA in neural progenitor cells originated from fibroblasts of a patient with bipolar disorder. Cumulatively, miR-1908-5p has been suggested to contribute in the pathogenesis of bipolar disorder [15].
Another study has indicated that over-expression of miR-1908 can improve cardiac function, decrease fibrosis of myocardial cells and decrease TGF-β1 and Smad2/3 levels. TGF-β1 has been shown to be targeted by miR-1908. In fact, miR-1908 inhibits expression of Smad2/3 via TGF-β1 [16].
Levels of miR-1908 have been shown to be elevated in the course of adipogenesis of human multipotent adipose-derived stem cells. Up-regulation of miR-1908 in these cells could inhibit adipogenic differentiation and enhanced proliferation of cells, demonstrating the effect of this miRNA in the differentiation and metabolism of adipocytes and pathoetiology of obesity [17]. Table 2 shows function of miR-1908 in non-malignant disorders based on studies in cell lines.
Table 2
Function of miR-1908 in non-malignant disorders based on studies in cell lines (∆: knock-down or deletion SD: Sprague–Dawley, RA: Rheumatoid arthritis, NPCs: neural progenitor cells)
Disease type
Interactions
Cell lines
Function
References
Bipolar disorder
DLGAP4, GRIN1, STX1A,
CLSTN1 and GRM4
control and bipolar patient iPS cell lines
Valproate: ↑ miR-1908-5p expression in normal NPCs and ↓ miR-1908-5p expression in NPCs of patients with bipolar disorder
Levels of miR-1908 expression were found to be increased during the differentiation of human preadipocytes into adipocytes, and be regulated by adipokines
Animal studies on the role of miR-1908 in cancers and non-malignant conditions
Few animal studies have assessed function of miR-1908 in animal models. Two studies have confirmed the oncogenic roles of miR-1908 in glioblastoma [7] and osteosarcoma [12] (Table 3).
Table 3
Function of miR-1908 in cancer based on studies in animal models
Tumor Type
Animal models
Results
References
Glioblastoma
4–6 week-old male BALB/c nude mice
↑↑ miR-1908: ↑ tumor volume, tumor weight and tumor growth
Moreover, contribution of miR-1908 in the pathogenesis of myocardial infarction, renal fibrosis and scar formation has been verified in animal models (Table 4).
Table 4
Function of miR-1908 in non-malignant conditions based on studies in animal models (SD: Sprague–Dawley)
Disease Type
Animal models
Results
References
Myocardial infarction
8–10-week-old male SD rats
miR-1908 expression was reduced at 4 weeks after myocardial infarction
↑↑ miR-1908: ↓ myocardial fibrosis, and TGF-β1 and Smad2/3 levels
Tumor suppressor versus oncogenic roles of miR-1908 based on studies in clinical samples
Expression of miR-1908-3p has been reported to be elevated in breast cancer tissues and sera of these patients compared with corresponding controls. Besides, its expression has been higher in tissue samples of young patients and HER2-positive samples compared with samples obtained from older patients and HER2-negative tumors, respectively. Similarly, serum level of miR-1908-3p has been higher in younger patients compared with elder ones. Most notably, higher levels of miR-1908-3p target genes have been correlated with better clinical outcomes in this type of cancer [5].
Anzeige
In cervical cancer samples, the expression of miR-1908 has been inversely correlated with transcript levels of HDAC10. Notably, over-expression of HDAC10 has been associated with better prognosis of cervical cancer [6].
In glioblastoma, miR-1908 expression has been significantly higher in the patients with high risk of tumor recurrence compared to those with lower risk of recurrence. Moreover, over-expression of miR-1908 has been correlated with poor survival of patients. Taken together, miR-1908 has been regarded as a putative biomarker for estimation of risk of recurrence in patients with glioblastoma [7]. Another study has shown down-regulation of SPRY4 as one of validated targets of miR-1908 in glioma samples. Markedly, down-regulation of SPRY4 has been correlated with short survival time in these patients [8].
In ovarian cancer, miR‐1908‐5p has been among miRNAs that predict progression free survival of patients [13].
In brief, dysregulation of miR-1908 has been associated with poor prognosis in cervical cancer, glioblastoma, osteosarcoma and ovarian cancer (Table 5).
Table 5
Results of studies that reported dysregulation of miR-1908 in clinical samples from cancers (ANCTs: adjacent non-cancerous tissues, OS: overall survival, DFS: disease-free survival, TNM: tumor node metastasis, PFS: progression-free survival, HGSOC: high‐grade serous ovarian carcinoma)
Tumors
Samples
Expression (Tumor vs. Normal)
Kaplan–Meier analysis (impact of miR-1908 up-regulation)
Univariate/ Multivariate cox regression
Association of miR-1908 expression with clinical characteristics
Reference
Breast cancer
TCGA dataset
50 pairs of tumor tissues and ANCTs
60 breast cancer patients compared to 60 healthy controls
Up
(Younger breast cancer patients and those with HER2-positive tumors had a higher levels of this miRNA)
Dysregulation of miR-1908 in clinical samples in non-malignant conditions
miR-1908 has been among miRNAs being under-expressed in depression episodes of the bipolar disorder compared with remission state. This study has suggested miR-1908 one of the most promising miRNAs for diagnosis of depression phase of this disorder [26]. Besides, miR-1908 has been among differentially expressed miRNAs between pre-stroke and post-stroke phases in diverse subtypes of ischemic stroke. Moreover, miR-1908 showed significant diagnostic values in both large artery atherosclerosis and lacunar infarct patients [27]. Table 6 shows the results of research projects that revealed dysregulation of miR-1908 in clinical samples from non-malignant conditions.
Table 6
Dysregulation of miR-1908 in clinical samples from non-malignant conditions (UP: unipolar disorder, BP: bipolar disorder)
Disease type
Samples
Expression (Disease vs. Normal)
References
Bipolar disorders
17 UP and 15 BP patients
Down in bipolar disorder patients in comparison to remission phase
13 normal control subjects (NCs), 23 cardioembolism (CARD), 26 cases of large artery atherosclerosis (LAA), 27 cases of lacunar infarct (LAC), and 11 cases of stroke of undetermined etiology (SUE)
20 NCs, 28 CARD, 23 LAA, 18 LAC, and 16 SUE
Down in LAA, LAC, and SUE patients but not in CARD patients
Wohlers et al. have analyzed miRNA expression quantitative trait loci among 115 GWAS regions linked with inflammatory disorders. Their comprehensive functional fine-mapping has demonstrated two independent GWAS regions associated with autoimmune diseases risk SNPs with important impacts on miRNA expression. These regions have been shown to influence expression of miR-1908-5p and have been related to SNPs associated with Crohn's disease (rs102275) and rheumatoid arthritis (rs968567) [28].
Discussion
miR-1908 has been shown to contribute in the pathoetiology of several disorders through targeting important signaling pathways, namely PTEN, AKT/FOXO3a and AKT/mTOR, SPRY4/ RAF1, RP-p53 and NF-κB pathways. The majority of studies have indicated an oncogenic role for miR-1908. However, this miRNA has been shown to act as a tumor suppressor in chordoma, lung cancer and ovarian cancer.
Notably, dysregulation of miR-1908 has been associated with poor prognosis in cervical cancer, glioblastoma, osteosarcoma and ovarian cancer. However, the diagnostic role of miR-1908 has not been fully investigated in the context of cancer.
Anzeige
miR-1908 has been among miRNAs that could be used as diagnostic markers in two neuropsychiatric conditions, i.e. bipolar disorder and ischemic stroke. This miRNA has a putative function in fibrotic conditions as well. This function is most probably exerted through modulation of TGF-β signaling.
Taken together, miR-1908 participates in the pathogenesis of different types of cancers, as well as a variety of non-malignant conditions such as bipolar disorder, myocardial infarction, obesity, renal fibrosis, rheumatoid arthritis and scar formation. However, data regarding its participation in each condition is based on few investigations. Thus, additional studies are required for verification of these results. Moreover, conduction of further association studies in different populations is necessary to validate the observed associations between miR-1908 SNPs and hematological indexes, serum metabolite levels, neuroimaging measurement, brain volume measurement, asthma and bipolar disorder.
Future perspectives
miR-1908 is a candidate for design of novel therapeutic approaches for a wide array of human disorders. Establishment of these kinds of therapies needs comprehensive assessment of its expression in diverse steps of pathogenic events, particularly in cancers. Safety issues and effective transport of miR-1908-modulating therapies into the target cells are the main issues in this regard. These issues should be solved through application of these methods in animal models.
Acknowledgements
This study was financially supported by Shahid Beheshti University of Medical Sciences.
Declarations
Ethics approval and consent to participant
Not applicable.
Consent of publication
Not applicable.
Competing interests
The authors declare they have no conflict of interest.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Nach einer Prostatabiopsie treten häufig Probleme beim Wasserlassen auf. Ob sich das durch den periinterventionellen Einsatz von Alphablockern verhindern lässt, haben australische Mediziner im Zuge einer Metaanalyse untersucht.
Gerade bei aggressiven Malignomen wie dem duktalen Adenokarzinom des Pankreas könnte Früherkennung die Therapiechancen verbessern. Noch jedoch klafft hier eine Lücke. Ein Studienteam hat einen Weg gesucht, sie zu schließen.
Ein hoher Anteil pflanzlicher Nahrung trägt möglicherweise dazu bei, das Progressionsrisiko von Männern mit Prostatakarzinomen zu senken. In einer US-Studie war das Risiko bei ausgeprägter pflanzlicher Ernährung in etwa halbiert.
Ein höheres Alter bei der Diagnose eines Endometriumkarzinoms ist mit aggressiveren Tumorcharakteristika assoziiert, scheint aber auch unabhängig von bekannten Risikofaktoren die Prognose der Erkrankung zu verschlimmern.
Update Onkologie
Bestellen Sie unseren Fach-Newsletterund bleiben Sie gut informiert.
