Background
Respiratory syncytial virus (RSV) bronchiolitis in infants has long been a major public health and economic burden worldwide, particularly in low- and middle-income countries [
1,
2]. However, the development of efficient vaccines or antiviral medicines has been impeded by the as-yet contradictory pathogenic mechanisms [
3].
We have demonstrated that IFN-γ is critical to the pathogenesis of RSV infection. Reducing IFN-γ by anti-IFN-γ antibody or resveratrol treatment significantly alleviated RSV-associated airway inflammation and airway hyper-responsiveness (AHR) [
4,
5]. Both CD4
+ Th1 cells and CD8
+ Tc1 cells contribute to the aberrant release of IFN-γ triggered by RSV [
6-
8], while innate immune cells, including NK cells and macrophages, among other cell types, are also essential sources [
9,
10]. However, which cell type is the primary producer of IFN-γ remains to be determined. Nude mice are congenitally deficient in T cells, but their innate immunity is normal or compensatorily enhanced [
11]. Thus, we used this mouse model to investigate whether T cells or innate immune cells are the predominant producers of IFN-γ. RSV caused significant airway inflammation and AHR in nude mice, but unexpectedly, IFN-γ showed no perceivable changes throughout the disease in nude mice, which indicated that other non-T cells and non-IFN-γ proteins are involved.
In the absence of T cells, abundant macrophages were recruited into the airway of RSV-infected nude mice. It has been reported that macrophages can secrete MMP-12 in response to viral challenge [
12]. MMP-12, also known as macrophage elastase, is a member of the matrix metalloproteinases (MMPs) family. The role of MMP-12 in asthma and COPD has been well-recognized [
13,
14]. Moreover, in preparing this manuscript, Foronjy and colleagues recently demonstrated that excessive lung protease (including MMP-12) responses were induced by RSV, and airway disorders could be alleviated by protease inhibitors [
15]. When viewed in combination, it is reasonable to propose that MMP-12 might account for RSV-induced dysfunctions independent of T cells and IFN-γ.
Toll-like receptors (TLRs) and their down-stream adapter proteins are intimately associated with RSV infection. We demonstrated that sterile-α- and armadillo motif-containing protein (SARM), one of the adapter proteins, was suppressed by RSV [
4]. SARM is a negative regulator of Toll/IL-1R domain-containing adapter inducing IFN-β (TRIF)-signaling cascades [
16]. SARM suppression has consequently resulted in the over-expression of TRIF and IFN-γ and consequently resulted in RSV disease in BALB/c mice. Furthermore, resveratrol, a well-recognized antioxidant, could redress SARM-TRIF imbalance by up-regulating SARM, thereby reducing TRIF and IFN-γ, ultimately alleviating airway inflammation and AHR [
4]. TLR signaling pathways also mediated the over-production of MMPs [
17-
19]. However, the role of SARM-TRIF disturbance in the exacerbation of MMP-12 has yet to be examined.
In the present study, we hypothesized that following RSV challenge, MMP-12 can be mediated by SARM-TRIF-signaling pathways similar to IFN-γ, and can result in airway inflammation and AHR independent of IFN-γ and T cells. Such studies will enhance our understanding of SARM-TRIF-signaling cascades and may help to identify new efficient strategies for the control of RSV infection.
Methods
Mice
In this study, six- to eight-week-old female BALB/c and nude mice (on a BALB/c background), free of specific pathogens, were purchased from the Animal Laboratory of Chongqing Medical University. The mice were bred under accredited specific pathogen-free conditions in separate filter-top cages according to the experimental design and were acclimated for at least one week prior to treatment. All experiments involving animals were in accordance with the Guide for the Care and Use of Laboratory Animals and approved by the Institutional Animal Care and Committee (IACUC), which is accredited by the Association for Assessment and Accreditation of Laboratory Animal Care International, China and Experimental Animal Committee of the Chongqing Medical University (license numbers: SCXK(Yu) 2012–0001 and SYXK(Yu) 2012–0001.
RSV preparation and mice treatment
We utilized the A2 strain of human RSV (American Type Culture Collection). To inoculate RSV, the mice were held upright after sedation and inoculated intranasally with 1.5 × 10
7 PFU RSV in a 100-μl volume or sham-infected with 100-μl cell culture supernatant (mock group). To assess the effect of MMP-12 on the airway inflammation and AHR, both BALB/c mice and nude mice were treated with MMP408, a potent and specific MMP-12 inhibitor, (CALBIOCHEM, EMD Chemicals, Inc. San Diego, CA 92121) at 5 mg/kg or PBS intragastrically twice a day from day 0 to day 8 post infection. Disease parameters were assessed on day 9. To assess the role of SARM-TRIF signaling pathway on MMP-12 regulation, nude mice were injected intraperitoneally with either resveratrol (Sigma-Aldrich Corp., St. Louis, MO) at 30 mg/kg/day [
4] or PBS on day 0 (1 h post-RSV infection) and on days 1 to 4 consecutively. To assess the effects of IFN-γ on MMP-12 production, BALB/c mice were treated with IFN-γ neutralizing antibody (R4-6A2; BD PharMingen, San Diego, CA) and and nude mice were treated with recombinant murine IFN-γ (PeproTech, inc. Rocky Hill, NJ). IFN-γ neutralizing antibody (100 μg) and recombinant murine IFN-γ (10 μg) were injected intraperitoneally on day 0 (1 h post-RSV infection) and on days 1 and 3 post infection. Disease parameters were assessed on day 5. The corresponding isotype control antibodies were given similarly.
Analysis of infiltrated inflammatory cells in BALF
Bronchoalveolar lavage fluid (BALF) was collected for cytokine concentration measurement and inflammatory cell evaluation as previously described [
5]. Briefly, we lavaged the bronchial alveolar system of the mice with 0.5 ml ice-cold sterile PBS gently six times. The resultant BALF was centrifuged at 2500 rpm for 5 min at 4°C. Cell-free supernatant was aliquoted and stored at −80°C for subsequent cytokine detection. The remaining sediments were resuspended in 1 ml PBS. The total number of cells was quantified using microscopy. Cytospin slides were fixed and stained with DiffQuik (Baxter Healthcare Corp, Deerfield, Miami, FL) for leukocyte differential analysis. The number of neutrophils, macrophages, and lymphocytes in at least 200 cells per slide was quantified in a blind manner using a hemocytometer at × 1000 magnification.
Morphological examinations
Mice were euthanized by cervical dislocation, and their left lung lobes were removed and fixed in 10% buffered formalin for 24 h. The lungs were then embedded in paraffin, cut into 5-mm-thick sections and stained with HE (hematoxylin and eosin) to evaluate RSV-associated pulmonary histopathology. To semi-quantitatively estimate lung lesions, a histopathological score (HPS) was performed as previously described [
20]. The criteria assigned were 0 for no inflammation and 1, 2, and 3 for mild, moderate, and severe inflammation, respectively.
RSV-induced AHR measurement
We used whole-body plethysmography (Emca instrument; Allmedicus, France) to assess airway hyperresponsiveness (AHR) at days 1, 3, 5 and 7 post-RSV inoculation. Briefly, conscious and spontaneously breathing mice were exposed to aerosolized phosphate-buffered saline (PBS) solution, followed by increasing concentrations of aerosolized methacholine solution (3.125, 6.25, 12.5, 25, 50 mg/ml; Sigma, USA) in PBS, for 3 min exposures. After each nebulization, there was a 2-min internal quiescent, and the enhanced pause (Penh) was calculated over the subsequent 5 min. Penh is a dimensionless parameter that represents pulmonary airflow resistance (Penh = PEP/PIP× pause).
Determination of cytokines
The levels of IFN-γ and MMP-12 in BALF were measured using an enzyme-linked immunosorbent assay (ELISA) with commercial kits (Sizhengbai Beijing China) according to the manufacturer’s instructions. Duplicate wells were run, and the mean values were reported.
Flow cytometry
Single-cell suspensions of lung were prepared and cells were incubated with PMA (50 ng/ml; Sigma), ionomycin (1000 ng/ml; Sigma) and GolgiPlug-containing brefeldin A (BD Biosciences) in 1 ml complete RPMI (RPMI 1640 medium supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin). After 4–6 h incubation, the cells were harvested and blocked with antibody to mouse CD16/CD32 (Fc Block, BD). Samples were immunostained with antibody to mouse CD3, CD4, CD8 or isotype control conjugated with PerCP-cy5.5, FITC or PeCy7 for 30 minutes on ice and then fixed with 1% Formaldehyde in FACS Staining Buffer. The indicated antibodies were obtained from eBioscience (San Diego, CA). For intracellular IFN-γ detection, cells were fixed and permeabilized with CytoFix/CytoPerm solution (554722; BD) and Perm/Wash buffer (554723; BD) and then stained with APC-conjugated anti-IFN-γ mAb (BD Biosciences). Stained samples were measured on a flow cytometer, FACSCalibur (BD Biosciences). The data were analyzed using CellQuest software (BD Biosciences).
Western blotting analysis
The total protein of lung tissues were extracted using a total protein extraction kit (KeyGEN, Nanjing, China). Samples containing equal quantities of protein were separated on an 8% SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) gel and then transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica, MA). Membranes were probed with primary antibodies against SARM (1:500; SANTA, USA), TRIF (1:500; Abcam, Cambridge, MA) or β-actin (1:5,000; 4abio, Beijing, China). Alkaline phosphatase-conjugated goat anti-rabbit secondary antibody (1:10,000; MultiSciences, China) and goat anti-mouse antibody (1:10,000; MultiSciences, China) were used to detect the presence of the respective protein bands. Signals were quantified using Quantity One software (Bio-Rad, Hercules, CA) and normalized relative to β-actin.
In vivo siRNA transfection
GFP-tagged siRNAs of SARM were purchased from Invitrogen (Shanghai, China) using the following sequences: SARM: 237868 (3–1); sense:TGCTGTGAAGAAGCGGCACAGTTTGTGTTTTGGCCACTGACTGACACAAACTGCCGCTTCTTCA; antisense:CCTGTGAAGAAGCGGCAGTTTGTGTCAGTCAGTGGCCAAAACACAAACTGTGCCGCTTCTTCAC; 237868 (Negative control): sense:tgctgAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT, antisense:cctgAAATGTACTGCGTGGAGACGTCAGTCAGTGGCCAAAACGTCTCCACGCGCAGTACATTTc. We excluded the ectopic expression of SARM siRNA 3–1 in other organs and minimized its off-targets effects [
4]. siRNA was dissolved in a solution of 5% glucose and in vivo jetPEI (Polyplus Transfection, New York, NY, USA) to an N/P ratio of 7 (number of nitrogen residues of jetPEI per RNA phosphate), and a total of 80 μL of siRNA-jetPEI complex was administered intranasally to nude mice on the fourth day post-infection. Disease parameters were assessed, and the samples were harvested at day 5 post-infection.
Statistical analysis
All statistical tests were performed using Prism GraphPad Software (La Jolla, CA), and the results are expressed as the mean ± SEM. Two-way ANOVA with Bonferroni post-tests were used to compare the differences among multiple groups to AHR. Analysis of variance (ANOVA) was used to determine the differences between all groups to other indices. Data lacking normal distribution were evaluated using the nonparametric Kruskal-Wallis test, followed by Dunn’s multiple comparison. Differences were considered to be significant for p-values less than 0.05.
Discussion
In this study, we demonstrated that (1) T cells are the predominant cellular sources of IFN-γ induced by RSV; (2) MMP-12 accounts for at least part of the airway inflammation and AHR caused by RSV independent of IFN-γ; (3) SARM-TRIF signaling pathway is involved in regulating MMP-12 expression; and (4) IFN-γ can suppress MMP-12 expression in the condition of RSV challenge.
IFN-γ was significantly elevated in BALB/c mice, but not in nude mice or NOD/SCID mice, which are both deficient in T cells. Both CD3
+CD4
+IFN-γ
+ Th1 cells and CD3
+CD8
+IFN-γ
+ Tc1 cells were remarkably increased in BALB/c mice. These results strongly suggested that T cells are the primary producers of IFN-γ triggered by RSV. Our findings were consistent with recent evidence that in the PVM mouse model for human RSV, IFN-γ was undetectable until day 5 post-infection, at which time, CD8
+ T cells infiltrated into the lung [
7]. NK cells and macrophages and other cell types have been previously reported to be potential producers of IFN-γ [
9,
10]. Nevertheless, these conclusions were mainly drawn from mouse models with competent T cell responses, thus it cannot exclude the possibility that innate immune cells act as adjuvants of overt IFN-γ secretion by enhancing T cells activity. Indeed, activated NK cells are able to prime DCs to produce IL-12 and to induce highly protective CD8
+ T cell memory responses [
21]. However, Zhou
et al. [
22] have reported that nude mice have reduced IFN-γ levels on day 3 post RSV infection in contrast to BALB/c mice. The authors used 8–12 week old mice and they inoculated mice intranasally with 10
5 PFU RSV in a volume of 50 μl. These differences might be responsible for part of the contradictions. In addition, the authors did not clarify the background of their nude mice model. Thus, the biological changes observed might also be background dependent.
In contrast to IFN-γ, MMP-12 was remarkably induced by RSV in both mice strains but earlier in nude mice. And when MMP-12 was suppressed by MMP408, airway inflammation and AHR were dramatically alleviated. Several previous studies have shown that RSV triggers dramatic up-regulation of lung proteases which can delay viral clearance and facilitate airway inflammation and AHR [
12,
15]. Foronjy
et al. [
15] have recently observed that MMP-12 was significantly increased on days 1, 3, 5, 7 and 9 in Friend leukemia virus B sensitive strain mice. Moreover, Marchant
et al. [
23] further reported that RSV challenge resulted in greater viral loads in MMP-12−/− mice compared to their wild-type counterparts. However, no researches have discussed the specific effects of MMP-12 on RSV pathogenesis to date. Our results clearly indicate that MMP-12 can lead to airway inflammation and AHR caused by RSV. Thus, therapies targeting MMP-12 may be promising anti-RSV options.
Cells of the monocyte-macrophage lineage are the largest source of MMP-12 in vivo and MMP-12 is critical for macrophages migration [
24,
25]. In nude mice, macrophages and MMP-12 were both significantly induced by RSV, and were both significantly reduced by resveratrol and MMP408 treatment. Our in vitro study has further shown that MMP-12 was dramatically increased in the RSV-challenged RAW 264.7 cells (Additional file
3). Thus, macrophages might contribute to the increased MMP-12 levels in our nude mice models, however, without specific cellular depletion, we can not identify the relationship of macrophages and MMP-12 in the present study.
Interestingly, although with a smaller magnitude, macrophages were also strongly induced in BALB/c mice on days 3, 5 and 7 following RSV challenge. Nevertheless, MMP-12 was not increased simultaneously. There are two possibilities for these divergences. First, macrophages might be phenotypically or functionally different in RSV-infected nude mice. Indeed, it has been demonstrated that in the absence of efficient lymphocyte and IFN-γ responses, macrophages failed to express a classically activated phenotype in response to RSV [
26-
28]. The second possibility is that MMP-12 was suppressed by IFN-γ. In our BALB/c mice models, MMP-12 tended to be increased on day 7 when IFN-γ began to decrease and was significantly increased on day 9 when IFN-γ completely returned to baseline levels. Moreover, after IFN-γ was neutralized in BALB/c mice, MMP-12 was significantly increased. And after IFN-γ was elevated by recombinant murine IFN-γ treatment in nude mice, MMP-12 was significantly decreased. It has been reported that IFN-γ can protect mice against aneurysm formation and blockade of IFN-γ signaling pathways resulting in abdominal aortic aneurysms primarily due to increased MMP-12 expression [
29]. In addition, in vitro studies have also demonstrated that IFN-γ can inhibit MMP-9 in human monocytes and macrophages [
30] and in murine peritoneal macrophages [
31], as well as MMP-12 in murine macrophages [
32].
The critical role of TLRs-SARM-TRIF-IFN-γ signaling pathways in the pathogenesis of RSV disease has been well-documented [
4,
5]. Our results further demonstrated that SARM-TRIF signaling pathway is involved in regulating MMP-12 expression. RSV infection significantly down-regulated SARM, and once SARM was restored by resveratrol treatment, the levels of MMP-12 were substantially reduced, which was accompanied by alleviated airway inflammation and AHR. In contrast, SARM knockdown almost completely reversed the anti-RSV effects of resveratrol. Foronjy
et al. [
15] indicated that TLR3-TRIF only partially regulated the protease response and RIG-I-MAVS exerted a far more substantial effect on airway proteases responses following RSV infection in Friend leukemia virus B sensitive strain mice. However, in our mice models, MAVS was significantly decreased (Additional file
4). These contradictions might be attributed to the mice strain differences. TLR3-TRIF has been recognized as important players in enhancing MMPs responses [
19,
33]. However, to the best of our knowledge, this is the first study to examine the effects of SARM on MMP-12.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
XR L contributed to acquisition of data, data analysis and interpretation, and preparation of the manuscript. SM L, W L, N Z and J X: contributed to design of study and acquisition of data. L R, Y D, XH X: contributed to data analysis and interpretation. LJ W, Z F, EM L: contributed to conception, design of study, and revision of the manuscript. All authors read and approved the final manuscript and agreed to be accountable for all aspects of the work.