Background
Nuclear factor-κB (NF-κB) is a nuclear transcription factor that regulates the expression of a large number of genes associated with inflammation[
1,
2], tissue damage and repair[
3,
4], cell differentiation[
5,
6], apoptosis[
7,
8] and tumor growth[
9,
10]. NF-κB is composed of five distinct but structurally related subunits: RelA, RelB, c-Rel, p50 and p52, and these five mature proteins can form various homodimeric and heterodimeric combinations[
11,
12]. The dimers remain in an inactive form in the cytoplasm, sequestered by one of the IκB family members, mainly IκBα. In canonical NF-κB signaling, nuclear translocation of NF-κB is controlled by the signal-induced degradation of IκBs. Exposure of cells to stimuli, such as pro-inflammatory cytokines, activates the IκB kinase (IKK), which phosphorylates IκB, and IκB then becomes susceptible to ubiquitination and degradation through the proteasome system. Free p50 and p65 or c-Rel then translocate into the nucleus to activate related genes, and this gene regulation occurs mainly through promoter element binding[
13,
14]. Some pro-inflammatory cytokines, chemokines, and many oncogenes associated with tumor development and progression are NF-κB activators, including palmitic acid, the most abundant long chain saturated fatty acid[
15]. Furthermore, the mitochondrial antiviral signaling (MAVS) protein can recruit several TRAF proteins, and these proteins are associated with NF-κB activation[
16]. Another protein, protein-arginine methyltransferase 5 (PRMT5), is overexpressed in many cancers and promotes tumorigenesis by stimulating NF-κB[
17]. Though these activators, TNF-α acts as an important proinflammatory cytokine to stimulate NF-κB activity.
TNF-α, one form of TNF[
18], acts as a proinflammatory cytokine, and increased TNF-α levels have been observed in serum and other patient samples with inflammation[
19]. It is mainly produced by monocytes, macrophages, initial hemorrhages and necrosis of tumor tissue[
20,
21]. TNF-α is a secreted protein, mature TNF-α protein plays its role mainly through its receptors on the surface[
22‐
24]. So far, TNF-α seem powerful to destroy tumor, but has fallen short of expectations in clinical use as an anti-tumor agent because of its indeterminacy at therapeutic doses. The autocrine or paracrine TNF-α expression can make the opposite effect, like some reports showed TNF-α play a role in the promotion of cell growth in low concentration[
25,
26]. Low doses of endogenous TNF-α produced by normal epithelial cells or epithelial-derived cancer cells can also act as a tumor promoter, in NSCLC cells, the TNF-α expression may affect the normal lung adjacent to the tumor[
27], in human breast cancer cell, TNF-α enhanced invasiveness of the malignant cells dependent on matrix metalloprotease[
28], in ovarian cancer cells the CXCR4 expression also in a TNF-α–dependent manner[
29]. Many studies have demonstrated the role of TNF-α in cell proliferation, and some reports have shown that TNF-α acts as an apoptotic mediator in some cell lines, such as hematopoietic cells[
30] and cartilage progenitor cells[
31]. This proapoptotic effect can be weakened by other substances in the body, such as miRNAs. However, little is known about the ability of miRNAs to regulate TNF-α expression.
miRNAs are small non-coding RNAs that regulate gene expression at the post-transcriptional level through translational repression or mRNA degradation. They exert control over approximately 60% of human genes associated with development, cell differentiation, growth, motility and apoptosis[
32,
33], which render miRNAs one of the most abundant classes of regulatory molecules. Particularly in malignancies, aberrant miRNA expression has emerged as a hallmark of cancer[
34]. Because each miRNA is thought to regulate hundreds of mRNAs, and each mRNA is also modulated by many miRNAs[
35], the identification of miRNA targets represents an important step in understanding miRNA function. miR-130a, a miRNA has been shown to promote cell survival in several cell lines through different signaling mechanisms[
36‐
38], but its mechanism of action and expression are still not clear in cervical cancer.
In this study, we found that NF-κB and miR-130a promoted cervical cancer cell growth. miR-130a directly targeted the 3’UTR of TNF-α and repressed its translation, and TNF-α activated NF-κB to upregulate miR-130a expression. Thus, TNF-α can stimulate NF-κB activity and enhance miR-130a levels, which then reduces TNF-α levels. Therefore, this NF-κB/miR-130a/TNF-a/NF-κB feedback signaling pathway may play an important role in the growth regulation of cervical cancer cells.
Materials and methods
Cell culture and transfection
The human cervical cancer cell lines HeLa and C33A were grown in RPMI1640 medium (GIBCO BRL, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS), 100 IU/ml of penicillin and 100 mg/ml of streptomycin. The cell lines were incubated at 37°C in a humidified chamber supplemented with 5% CO2. Transfections were performed using the Lipofectamine 2000 Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. All transfections were performed in three independent experiments.
miRNA targets were predicted using the following algorithms: Target-Scan, PicTar, and MiRBase Targets.
Plasmid construction
To construct the pcDNA3/NF-κB vector expressing p50 subunit, we amplified a DNA fragment carrying p50 by PCR using sense and antisense NF-κB primers, and then the fragment was cloned into the pcDNA3 vector at the EcoRI and Xhol restriction sites.
To construct the pSilencer/shR-NF-κB vector interfere p50 subunit expression, a 70-bp double-stranded fragment was obtained via an annealing reaction using two single-strands. The fragment was then cloned into a pSilencer 2.1 vector plasmid (Ambion) at the BamHI and Hind III sites.
To construct a pcDNA3/pri-miR-130a vector expressing miR-130a, we amplified a DNA fragment carrying pri-miR-130a from genomic DNA using sense and antisense Pri-130a primers. The 3’UTR, including predicted target sites, was amplified by PCR using TNF-α-3’UTR-sense and -antisense primers, and the amplified sequence was cloned into an expression plasmid (pcDNA3/EGFP) downstream of the EGFP gene between the EcoRI and BamHI restriction sites. Similarly, the 3’UTR containing mutated miR-130a binding sites was amplified using PCR site-directed mutagenesis and cloned into the pcDNA3/EGFP plasmid between the same restriction sites with TNF-α-3’UTR-mut-sense and -antisense primers. The resulting vectors were designated as pcDNA3/EGFP-TNF-α-3’UTR and pcDNA3/EGFP-TNF-α-3’UTRmut.
The human TNF-α mRNA lacking the 3’UTR was amplified from human HeLa cell cDNA by PCR using sense and antisense TNF-α primers, which are listed in Table
1, and then cloned into the pcDNA3 vector at the EcoRI and Xhol restriction sites, which created the pcDNA3/TNF-α plasmid.
Table 1
Oligonucleotide sequences
NF-κB-sence | CGGAATTCGCCACCAGAATGGCAGAAGATGATC |
NF-κB-antisence | TGTCACTCGAGGCAATTTTGCCTTCTAGAGGTC |
NF-κB-siR-Top | GATCCCGCCTGAACAAATGTTTCATTTGGTCAAGAGCCAAATGAAACATTTGTTCAGGCTTTTTTGGAAA |
NF-κB-siR-Bot | AGCTTTTCCAAAAAAGCCTGAACAAATGTTTCATTTGGCTCTTGACCAAATGAAACATTTGTTCAGGCGG |
Pri-130a-sense | ATGGGATCCAGAGGGAGCCCGTGAGCTG |
Pri-130a-antisense | CGGAATTCGTATAACTAACAAGTGAGGCTACC |
ASO-miR-130a | AUGCCCUUUUAACAUUGCACUG |
ASO-NC | TGACTGTACTGAGACTCGACTG |
miR-130a-RT | GTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGATACGACATGCCCT |
miR-130a-Forward | TGCGGCAGTGCAATGTTA |
U6-RT | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATATGG |
U6- Forward | TGCGGGTGCTCGCTTCGGCAGC |
miR-Reverse primer | CCAGTGCAGGGTCCGAGGT |
TNF-α-3’UTR-sense | CGGGATCCGAAATTGACACAAGTGGACC |
TNF-α-3’UTR-antisense | CGGAATTCCTCCCAAATAAATACATTCATCTG |
TNF-α-3’UTR-mut-sense | CCCTCTATTTATGATACGAGTTGTGATTATTT |
TNF-α-3’UTR-mut-antisense | AAATAATCACAACTCGTATCATAAATAGAGGG |
TNF-α-sense | CGGAATTCGCCACCATGAGCACTGAAAGC |
TNF-α-antisense | CCCGCTCGAGGCCAGGGCAATGATCCCAAAG |
β-actin-sense | CGTGACATTAAGGAGAAGCTG |
β-actin-antisense | CTAGAAGCATTTGCGGTGGAC |
GAPDH-sense | GCGAATTCCGTGTCCCCACTGCCAACGTGTC |
GAPDH-antisense | GCTACTCGAGTTACTCCTTGGAGGCCATGTGG |
All DNA oligonucleotides used are listed in Table
1, and all constructs were confirmed by DNA sequencing.
Fluorescent reporter assay
HeLa and C33A cells were co-transfected with pcDNA3/pri-miR-130a or ASO-miR-130a in a 48-well plate followed by the pcDNA3/EGFP-TNF-α-3’UTR or pcDNA3/EGFP-TNF-α-3’UTR-mut reporter plasmids. The RFP expression vector, pDsRed2-N1 (Clontech, Mountain View, CA), was used for normalization. Cells were lysed with RIPA 48 h after transfection, and proteins were collected. EGFP and RFP fluorescence intensities were determined using an F-4500 fluorescence spectrophotometer (HITACHI, Tokyo, Japan).
Cell viability assay
HeLa and C33A cells were seeded in 24-well plates overnight and then transfected with plasmid (1 μg each) or oligonucleotides (final concentration 200 nM). Afterwards, cells were trypsinized and counted, seeded in 96-well plates (in triplicate) for an MTT assay at a density of 8,000 cells/well (HeLa) or 10,000 cells/well (C33A), and incubated at 37°C for 24 h. Then, at 24, 48 and 72 h after cell seeding, 10 μl MTT (final concentration, 0.5 mg/ml) was added, and the cells were maintained at 37°C for another 4 h. The medium was removed, and the precipitate was dissolved in 100 μl DMSO. After shaking for 15 min, the absorbance at 570 nm (A570) was measured using an uQuant Universal Microplate Spectrophotometer (Bio-Tek Instruments, Winooski, USA).
Following transfection in 24-well plates as described above, HeLa and C33A cells were counted and seeded in 12-well plates (in triplicate) at a density of 200 cells/well. The plates were incubated at 37°C in a 5% CO2 humidified incubator. The culture medium was replaced every 3 days. After 14 days in culture, cells were stained with crystal violet and counted. Colonies with at least 50 cells were considered for quantification.
RNA preparation and Quantitative reverse transcrption PCR (qRT-PCR)
Total RNA extracted from HeLa and C33A cells was using the TRIZOL reagent (Invitrogen, Carlsbad, CA), according to the manufacturer’s instructions. RNA extraction from tissue samples was performed by using the mirVana miRNA Isolation Kit (Ambion) according to the manufacturer’s instructions. To assess RNA integrity, a portion each RNA sample was used for concentration and purity measurements (A260 and A280 by spectrophotometry), and a separate portion was subjected to denaturing electrophoresis in a 1% agarose gel stained with ethidium bromide.
qRT-PCR used to detect the miRNA and mRNA levels and was performed using an iQ5 real-time PCR detection system (Bio-Rad). Moloney murine leukemia virus (M-MLV) reverse transcriptase (Promega, Madison, WI) was used to reverse transcribe cDNA from RNA samples. The SYBR Premix Ex Taq™ kit (TaKaRa, Otsu, Shiga, Japan) was used to measure amplified DNA. Related primers were purchased from AuGCT, Inc. (Beijing, China), and sequences are shown in Table
1.
To detect miR-130a, 2 μg of total RNA (in triplicate) was reverse transcribed to cDNA using M-MLV. U6 was used as a housekeeping gene to normalize gene expression. The following PCR cycles were used: 94°C for 3 min followed by 40 cycles of 94°C for 30 s, 56°C for 30 s, and 72°C for 30 s. To detect target genes, 5 μg of total RNA (in triplicate) was reverse transcribed into cDNA. Endogenous β-actin gene levels were used as a control to normalize gene expression. The following PCR cycles were used: 94°C for 3 min followed by 40 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 30 s.
Western blot
Western blotting was performed to determine protein expression. Briefly, HeLa and C33A cells were transfected with plasmid (4 μg each) or control oligonucleotides (final concentration of 200 nM). After seeding in 25-ml culture flasks, cells were washed with PBS and lysed after 30 min in RIPA lysis buffer at 4°C to harvest total protein. To collect nucleoproteins, cells were harvested with PBS, centrifuged to obtain a cell precipitate, 0.4% NP-40 added, and the cell precipitate resuspended. After centrifugation, the supernatant contained the nucleoproteins. Next, 0.1% NP-40 was added to the remaining cell precipitate, the precipitate was resuspended and centrifuged, the supernatant was discarded, and the remaining material resuspended in RIPA buffer to obtain cytoplasmic proteins. Equal amounts of protein were subjected to electrophoresis using a 10% SDS-polyacrylamide gel under denaturing conditions and were then transferred onto a nitrocellulose membrane. To assess protein levels, membranes were incubated in blocking buffer for 4 h at room temperature and then with antibodies raised against p50 or TNF-α overnight at 4°C. Membranes were then washed and subsequently incubated with secondary antibody. Protein expression was assessed by enhanced chemiluminescence and exposure to chemiluminescent film. The LabWorks™ Image Acquisition and Analysis Software (UVP, Upland, CA) were used to quantify the protein band intensities. All the antibodies were purchased from Tianjin Saier Biotech (Tianjin, China).
Immunofluorescent staining
Cells were seeded on 14-well slides at a concentration of 2000 cells/well and incubated overnight. After the cells adhered to the slides, the culture medium was replaced with medium containing TNF-α (Sigma-Aldrich, St. Louis, MO) at a final concentration of 20 ng/mL, and the cells were cultured for 24 h. Cells were fixed with 4% paraformaldehyde for 30 min, permeabilized with 0.5% Triton X-100 for 5 min, and blocked with 10% donkey serum at room temperature for 2 h. Following blocking, primary antibodies were diluted in 1% normal donkey serum, placed on the slide surface, and incubated at 4°C overnight. Cells were washed, and a FITC-labeled donkey anti-rabbit secondary antibody was diluted in 1% normal donkey serum and added to the slides. Finally, DAPI was used to stain the nuclei. Fluorescent images were acquired using a Digital Sight DS-U1 scanning microscope (Nikon, Tokyo, Japan) at an excitation wavelength of 488 nm. Images were superimposed using the NIS Elements F 2.20 imaging software (Nikon).
Tumor xenograft experiment
For in vivo tumor study, 3 × 106 Hela cells transfected with pri-miR-130a and it is control vector were suspended in 150 μl of serum-free 1640 for each mouse. Each mouse (6 in each group, female, BALB/c-nu/nu at 6 weeks of age) were implanted subcutaneously in the right armpit of nude mice. All mice were killed 14 days after implantation. The samples were frozen in liquid nitrogen or fixed with phosphate-buffered neutral formalin. All studies were performed under the American Association for the Accreditation of Laboratory Animal Care guidelines for humane treatment of animals and adhered to national and international standards. Ethical approval was given by the medical ethics committee of the Ethics Committees of Tianjin Medical University with the following reference number: TMUhMEC 2011018.
Immunohistochemistry
The tissue samples were fixed in phosphate-buffered neutral formalin, embedded in paraffin, and cut into 5 μm thick sections. Tissue sections were deparaffinized, rehydrated, and microwave-heated in sodium citrate buffer for antigen retrieval. The sections were then incubated with 0.3% hydrogen peroxide/phosphate-buffered saline for 30 min. Sections were incubated with a primary antibody against TNF-α at a 1:50 dilution and incubated overnight at 4°C. Detection of the primary antibody was performed using goat anti-rabbit-HRP for 1 hour at room temperature and visualized with DAB substrate.
Statistical analysis
Data are expressed as the mean ± standard deviation (SD). Statistical analyses were performed with a paired t-test. P < 0.05 was considered statistically significant. Experiments were performed in triplicate, and one representative experiment is shown in the Figures.
Discussion
NF-κB is one of the most important intracellular nuclear transcription factors, and it plays a central role in the transcriptional regulation of many genes that are influenced by various stimuli. Some studies have shown that NF-κB promotes tumorigenesis through transcriptional regulation. NF-κB activation is involved in Ras-induced carcinogenic effects and telomerase reverse transcriptase activity[
44‐
46], but it can also promote apoptosis[
47‐
49]. Here, utilizing MTT and colony formation assays, we demonstrated that NF-κB played a growth-promoting role in the HeLa and C
33A human cervical cancer lines.
miRNAs have been found to be involved in physiological and pathological processes. Moreover, NF-κB has been shown to regulate miRNA expression, and in turn, some miRNAs modulate NF-κB expression directly or indirectly[
50,
51]. We are interested in miRNA regulation of the NF-κB signal pathway. Hence, we found that NF-κB induced miR-130a expression to significantly increase, whereas the knockdown of NF-κB repressed miR-130a expression. Therefore, we conclude that NF-κB promotes miR-130a expression. Numerous studies have shown that miR-130a plays an important role in cell function and carcinogenesis by targeting various genes, such as FOG-2[
36], GAX[
37] and Smad4[
38] in cardiomyocytes, vascular smooth muscle cells and granulocytic precursors cells, respectively. In cancer, miR-130a targets MET in non-small cell lung carcinoma[
40] and can target ATG2B and DICER1 to kill Chronic Lymphocytic Leukemia cells[
41]. To determine whether miR-130a’s effects on cervical cancer growth are downstream of NF-κB, we used gain-of- and loss-of-function assays to examine the role of miR-130a in cervical cancer cells. MTT and colony formation assays showed that miR-130a promoted HeLa and C
33A cell viability and colony formation compared with the control, which is consistent with NF-κB’s ability to enhance the growth of human cervical cell lines.
miRNA possesses diverse roles that up- or down-regulate target gene expression[
52‐
57]. To identify the miR-130a target genes responsible for its effects on cervical cancer cells, we used bioinformatics and functional knowledge associated with NF-κB and miR-130a and chose TNF-α as a candidate gene for further study. In the EGFP reporter assay, the expression of an EGFP reporter plasmid containing the TNF-α 3’UTR was repressed by miR-130a, and the mutated TNF-α 3’UTR abolished this effect. Furthermore, qRT-PCR and Western blot analysis showed that miR-130a decreased TNF-α mRNA and protein expression levels in cervical cancer cells compared with the control. Together, these data suggest that miR-130a downregulates TNF-α expression by binding to its 3’UTR. Moreover, ectopic TNF-α expression lacking the 3’UTR abrogated the effects of miR-130a on cervical cancer cell growth in the colony formation assay, but cell viability assessed by MTT assay was not obviously affected. These effects may result from miR-130a’s regulation of TNF-α requiring a certain length of time to be effective or involving other target genes; however, the detailed mechanism still needs to be investigated. Therefore, we conclude that miR-130a promotes cell growth through at least the partial involvement of TNF-α.
Tumor necrosis factor-alpha has been reported to be related to a variety of physiological processes, including cytotoxicity and the regulation of anti-viral and immune responses, and most of these processes are regulated through downstream regulatory factors[
58,
59]. Although TNF-α can destroy tumors, in different environments, it may possess other effects, even acting as an endogenous tumor promoter[
27‐
29,
60]. TNF-α is a strong NF-κB activator[
61‐
63]. While high concentrations of TNF-α can induce the death of cervical cancer cells[
64‐
66], we found that low TNF-α concentrations induced cervical cancer cell growth. However, how NF-κB provides feedback regulation of TNF-α expression is not well known. Here, we found that TNF-α stimulated the nuclear translocation of NF-κB and induced miR-130a expression in HeLa and C
33A cells. A recent report showed that LPS could increase miR-130a expression, and NF-κB was involved in this process in human biliary epithelial cells[
11]. Because LPS is a widely known TNF-α activator, these results support our conclusions. Thus, TNF-α stimulates NF-κB to induce miR-130a expression, and in turn, miR-130a downregulates TNF-α expression, which may form a feedback loop of TNF-α/NF-κB/miR-130a/TNF-α. This negative feedback loop may regulate TNF-α production to maintain relatively low concentrations. These low TNF-α concentrations may stimulate the nuclear translocation of NF-κB and enable cells to survive. Therefore, this NF-κB/miR-130a/TNF-α feedback loop may contribute to low TNF-α concentrations that avoid the induction of apoptosis in carcinogenesis.
Competing interests
The authors declare no competing interests.
Authors’ contributions
JZ: participated in the experimental work and preparation of manuscript. HW, PL, YZ: participated in the experimental work. Ml: analyzed the data and participated in article preparation. HT: designed, directed the experiment. Analyzed data and prepared the manuscript. All authors read and approved the final manuscript.