Background
14-3-3 proteins are present in all eukaryotic organisms that have been examined and are highly conserved between species. The number of proteins in the 14-3-3 family varies with species. However, in mammals, seven isoforms have been identified named as β, γ, ε, σ, ζ, θ and η, and they function by binding other proteins predominantly through phosphorylated serine residues [
1,
2]. These proteins are highly conserved and are involved in the regulation of a variety of key physiological pathways such as cell cycle progression [
3] apoptosis [
4] and mitogenic signaling [
5]. Binding target proteins enable 14-3-3 family members to regulate the activity of enzymes, control subcellular localization of their targets, or act as scaffolds that promote protein-protein interactions.
14-3-3 proteins were identified as abundant proteins in the brain and were first described to activate neurotransmitter synthesis [
6]. Subsequently, they were implicated in a variety of neurological conditions [
7] suggesting that they functioned primarily in the brain. However, 14-3-3 protein family members are widely expressed in mammalian tissues and recent evidence suggests that these proteins may also play a role in the development of human cancers. Examination of 14-3-3 protein levels in human tumors including lung [
8], prostate [
9], breast [
10], oral [
11], ovarian [
12] and pancreatic cancers [
13,
14] indicate that 14-3-3 protein expression becomes aberrant during tumorigenesis. However, it is unclear if or how these proteins contribute to tumorigenesis.
Of the 14-3-3 proteins linked to cancer, the best studied is 14-3-3σ, which is a transcriptional target of the p53 tumor suppressor. Activation of p53 by DNA damage leads to induction of 14-3-3σ and G2 arrest [
3]. Loss of 14-3-3σ also results in defective DNA damage repair [
15] and promotes tumorigenesis in breast epithelia [
16]. Moreover, down regulation of 14-3-3σ enables primary human epithelial cells to grow indefinitely [
17]. Collectively these findings suggest that 14-3-3σ may function as a tumor suppressor and confirm that 14-3-3 gene expression can be regulated by p53.
The role of 14-3-3γ isoform in cancer is less well understood. However, Jin et al. [
18] have shown that 14-3-3γ can inhibit transcriptional activity of p53 and we have previously shown that the 14-3-3γ protein is overexpressed in lung cancers and can promote polyploidy [
19]. In order to gain insight into the role that 14-3-3γ may have in lung tumorigenesis we examined their expression and the co-occurrence of p53 mutations in lung tumor specimens. We found evidence suggestive of a functional interaction between 14-3-3γ and p53.
Methods
Frozen human lung tumor specimens and non malignant tissues were obtained from Cooperative Human Tissue Network, Vanderbilt University Medical Center (Nashville, TN). 80 samples were selected based on the tumor type and percentage of tumor cell content (> 70%) and also 21 normal tissues were selected. These studies were evaluated by the University of Arizona Human Subjects Protection Program and judged to be exempt as the specimens are de-identified. The human lung cancer cells, A549, H358 and H322 cells were obtained from American Type Culture Collection (ATCC), USA. The human colorectal cancer cell lines p53+/+ and p53-/- HCT116 were provided by Dr. Bert Vogelstein (The Johns Hopkins University). Anti-p53 and Anti-14-3-3γ antibodies were obtained from Santa Cruz (Santa Cruz, CA). Antibody to β-actin was purchased from Sigma, St Louis, MO. PCR kits were obtained from Invitrogen, USA. First strand cDNA synthesis kit was obtained from Fermentas, USA.
Real-Time PCR quantitation of mRNA expression for 14-3-3γ
The mRNA expression level was determined by quantitative reverse transcription-PCR on total RNA, using the ABI PRISM 7700 Sequence Detection System. The RNA was isolated using TRIZOL (Invitrogen, USA) and treated with DNase to avoid amplification of genomic DNA. cDNA was synthesized from 500 ng of total RNA and it was used for PCR. PCR was carried out in 50 μl reaction mixture containing 25 μl of SYBR Green qPCR SuperMix-UDG, 1.5 μl of 10 μM each forward and reverse primer, 2 μl of cDNA and water to 50 μl. Thermal cycling conditions were carried at 50°C for 2 min, 95°C for 2 min, 40 cycles of 95°C for 30 sec and 58°C for 30 sec using the ABI PRISM 7700 Sequence Detection System. The primers for 14-3-3γ and GAPDH transcript are listed in Table
1. All experiments were repeated three times. Data are expressed as ΔCt values [ΔCt = Ct of the target gene (14-3-3γ) minus Ct of the GAPDH]. To calculate number of fold changes compared with normal tissues, 2
-ΔΔCt equation was used; all statistics were performed with ΔCt values.
Table 1
List of primer sequences used for mRNA expression of 14-3-3γ and GAPDH
14-3-3γ
| CTGAATGAGCCACTGTCGAA | GCACGGACCATCTCAATCTT |
GAPDH
| AGGGCCCTGACAACTCTTTT | AGGGGTCTACATGGCAACTG |
Quantitative-PCR for relative gene quantity of 14-3-3γ
Normal and tumor specimens were embedded in OCT and sections were prepared using a MICROM GmbH cryostat (Waldorf, Germany). The sections were fixed in 75% ethanol and stained in 1.5% eosin for 30 sec. Then they were washed in 95% ethanol, dehydrated in 100% high-grade ethanol, incubated with Xylene, air dried, and subjected to laser capture microdissection (LCM) using the Veritas Microdissection instrument (Arcturus Engineering, CA) and CapSure LCM Caps (Arcturus Engineering, CA). DNA was extracted using the Picopure DNA extraction kit (Arcturus Engineering, CA). Q-PCR was performed using the ABI PRISM 7700 sequence Detection System (Applied Biosystems, USA) by TaqMan based technique. The sequences of the genomic primers and probes used for Q-PCR are listed in Table
2. The primers were tested to ensure amplification of single discrete bands. Relative quantification was performed using the comparative CT (ΔCT) method. To normalize the Q-PCR data against aneuploidy that commonly occurs in NSCLCs [
20], the Ct values of the 14-3-3γ gene are normalized with phosphoinositide-3-kinase regulatory subunit 1 (PI3KR1) gene, which is unaltered in NSCLCs [
21]. Each real-time qPCR reaction mixture contained 10 μl of DNA sample (obtained from Picopure DNA extraction kit), 12.5 μl of Platinum Quantitative PCR SuperMix-UDG (Invitrogen, USA), 0.75 μl of 10 μM gene-specific forward and reverse primers, 0.25 μl of 10 μM fluorescent probe and water to 25 μl. Thermal cycling conditions were carried at 50°C for 2 min, 95°C for 2 min, 40 cycles of 95°C for 30 sec and 58°C for 30 sec using the ABI PRISM 7700 Sequence Detection System. Samples were run on a 2% agarose gel to ensure that only a single amplicon was produced.
Table 2
List of primer sequences used for amplification of 14-3-3γ and PI3KR1 genes by Qpcr
14-3-3γ
| CCTCAGCTGCTCGCTCTG |
CGGAGAAGGAGGAGGACACT
| 6-FAM- CGGTCCTCTCCGGCACTTGGGC-TAMRA |
PI3KR1
| AAGTCTTAAGTTTGGGTTG AGTCG | TAATGATTGACCAAGCTTTTA TGC | 6-FAM- TAATGATTGACCAAGCTTTTATGC-TAMRA |
RT-PCR and Direct sequencing for p53 mutations
For the mutational analysis of p53 gene exons 5-9, RT-PCR analysis and direct sequencing were performed. cDNA from tumor samples was synthesized from 500 ng of total RNA and then PCR was performed using following primers, forward 5'-GCC AAG TCT GTG ACT TGC ACG-3' and reverse 5'-AGA GGA GCT GGT GTT GTT GG-3'. The cycling conditions used for these PCRs were as follows: 94°C for 5 min, 30 cycles of 94°C for 30 sec, 55°C for 45 sec and 72°C for 1 min, with a final extension step of 72°C for 10 min. The PCR products were gel purified using gel purification kit (Qiagen, USA). Purified DNA samples were sequenced at the University of Arizona Genetics Core facility.
Western blot for expression of 14-3-3γ, p53 and β-actin proteins
The protein lysates from either frozen sections or cell lines were collected using ice-cold RIPA buffer containing 150 mM NaCl, 50 mM Tris, 1 mM EDTA, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, pH 7.4 and 2 μl/ml Protease inhibitor cocktail (Sigma, USA). Protein concentrations were determined using the BioRad protein assay kit (Biorad, USA) and 50 μg protein was separated by 12% SDS-PAGE gel. The proteins were then transferred onto a nitrocellulose membrane (Millipore, USA) and then blocking was carried out by incubating with 5% nonfat milk in TBST buffer. After blocking, the membranes were incubated with primary antibodies raised against human 14-3-3γ (Rabbit polyclonal, Santa Cruz, USA), p53 (DO1, mouse monoclonal, Santa Cruz, USA) and β-actin for 1 hr. Then the membranes were washed three times, incubated with secondary-HRP (Sigma, USA) for 1 hr and then washed with TBST buffer for three times. Blots were developed by Super Signal West Pico detection system (Pierce, Rockford, IL). The membranes were stripped and reprobed with β-actin monoclonal antibody (Sigma, USA) to confirm equal loading. For frozen tumor specimens, the protein quantification from western blot image was done with the help of Image J program (NIH, MD) and 2-fold above the normal is considered as 14-3-3γ overexpressing tumors.
One Hybrid Assays
The Grow'n'Glow GFP One-Hybrid System (MoBiTec, USA) was used to test for p53 binding to YWHAG promoter sequences. The prey control plasmid pJG4-5-p53, supplied with the kit, consists of the p53 cDNA fused to the B42 activation domain; expression of the p53 fusion protein is under the control of the GAL1 promoter. The 600 and 1200 bp promoter sequences were subcloned into the GFP reporter vector ("bait" plasmid), pGNG2, which contains the GFPUV gene driven by the GAL1, 10 minimal promoter. The 600 and 1200 bp fragments were amplified by PCR from the pGL3 plasmid containing complete 14-3-3γ promoter using the following primers: 600 bp forward primer, 5'-GAGAGCGGCCGCGTCGGTCCTCTCCGGCACTT-3'; 1200 bp forward primer, 5'-GAGAGCGGCCGCATGAACGAGAATATATCAGCGTGACC-3'; reverse primer for both reactions, 5'-GAGAACTAGTCTTCGCGGGGCTGGGTCT-3'. A NotI recognition sequence is incorporated into the forward primers; the reverse primer includes a SpeI recognition sequence. The amplification products and the pGNG2 plasmid were cut with NotI and SpeI, and the promoter sequences were ligated into the vector. The two promoter constructs were verified by sequencing. The p53 encoding plasmid was co-transformed with reporter construct into Saccharomyces cerevisiae strain, W303 and successful transformants selected on -ura -trp synthetic medium containing dextrose. Individual colonies were inoculated into -ura -trp SC medium with 2% dextrose and grown to mid-log phase. The cells were then split in two, washed with sterile water, and resuspended in -ura -trp SC medium containing either 2% sucrose or 2% galactose. After six hours, cell density was measured spectrophotometrically (OD600) and 200 μL aliquots loaded onto a 96-well microplate. The plates were inspected visually under long wave UV light for green fluorescence; the fluorescence was quantified using a plate reader (excitation at 395 nm and emission at 509 nm) (Molecular Devices, USA). The mean values for each promoter construct and carbon source were normalized for cell density and expressed as the ratio of fluorescence in galactose to that in sucrose, the latter set at one fold.
ChIP assays
We collected A549, H358, H322, HCT116p53
+/+ and HCT116p53
-/- cells for ChIP assay 8h after γ-irradiation. ChIP assays were carried out essentially as described [
22]. p53 immunoprecipitation was done with 5 μg of antibody against p53 (DO1, Santa Cruz, USA), or with Mouse IgG (Santa Cruz, USA) as a negative control. We carried out PCR amplification using primers (forward, 5'-AACCACTGTGGCCAGCCGGTAT-3'; reverse, 5'-ACAGGAGGCGCGTCCATTGT-3'), designed to give a product including the p53-binding element. The PCR protocol was 30 cycles of a 45 sec denaturation step at 94°C, a 1 min annealing step at 58°C and a 1-min extension step at 72°C. The PCR products were resolved by 1.5% agarose gel electrophoresis.
Plasmid Constructions
To create the pGL3-100, pGL3-586, pGL3-830, pGL3-840, pGL3-850 and pGL3-1200 14-3-3γ promoter plasmids, the genomic DNA from human foreskin fibroblast cells (HFF1 cells, provided by Dr. Rilo, University of Arizona) was PCR amplified with forward primers hanging KpnI site and reverse primers hanging NheI site, products were digested and gel purified followed by ligation with KpnI/NheI digested pGL3 linearized vector. For PGL3-1200 Δ850-840 and PGL3-1200 Δ850-830, 350 bp fragment upstream of p53 RE (-830 to -850) was amplified by PCR with forward primer hanging KpnI. 840 and 830 bp downstream from p53RE products were amplified with reverse primers hanging NheI site. These products were ligated together with KpnI/NheI digested PGL3 empty vector followed by transformation. All the promoter reporter constructs were sequenced and confirmed at the University of Arizona sequencing facility.
Transfections and Luciferase Assays
All of the transfections were done in triplicate in 24-well plates. Approximately, 1 × 103 cells/well were seeded 24 h before transfection. Plasmids were transfected into cells using Lipofectamine reagent (Life Technologies, Inc.). Luciferase assays were performed using the Dual Luciferase Assay System (Promega, USA) that already contains an internal control detectable simultaneously with the luciferase reporter gene. Each experiment was conducted at least in triplicates. Ad-GFP and Ad-P53-GFP adenoviruses are laboratory stocks. Cells were at 60% confluence when infected with 10MOI. siRNA duplexes targeting the p53 mRNA was chemically synthesized by Dharmacon Research. Their target sequences are as follows: p53, 5'-CAGTCTACCTCCCGCCATA-3' (p53 siRNA-1) and 5'-GAAGAAACCACTGGATGGA-3' (p53 siRNA-2). The control siRNAs is as follows: 5'-GGCTACGTCCAGGAGCGCACC-3'.
Statistical analysis
The statistical analysis was performed by analysis of variance. Only ΔCt values were used for the statistical analysis of gene amplification and mRNA expression. The Dunnett's multiple comparison was used to test the statistical significance between normal tissues and tumor tissues. Pearson correlation was used to correlate fold changes of gene amplification and mRNA followed by Student's t-test.
Discussion
The novel finding of this study is that 14-3-3γ is negatively regulated by p53 by binding to its promoter. Studies with human non small cell lung cancers have shown that expression of 14-3-3γ directly correlated with the p53 status, and elevated protein expression resulted from an increase in the quantity of mRNA, suggesting that there is a functional interaction between elevated 14-3-3γ expression and loss of p53. Although we found some evidence of 14-3-3γ gene amplification in some tumors, there was no significant correlation with elevated levels of gene expression. Hence, gene amplification could not account for up regulation of 14-3-3γ expression. Previously, we showed that 14-3-3γ caused polyploidy in lung cancer cell lines suggesting that elevated levels of expression of this family member may lead to genomic instability [
19]. Therefore, it may be that increased 14-3-3γ expression cooperates with loss of p53 in the promotion of genomic instability in lung cancer.
Studies using in vitro experiments showed two lines of evidence suggesting that p53 repression of human 14-3-3γ is a physiologically relevant response. First, endogenous induction of wt-p53by γ-irradiation repressed the expression of 14-3-3γ at the levels of mRNA and protein. Second, ectopic expression of wt-p53 significantly suppressed the expression of 14-3-3γ. Therefore, overexpression of human wt-p53 can exert a strong inhibitory effect on human 14-3-3γ gene expression and tumors having mut-p53 showed strong expression. Despite the lack of studies on the regulation of 14-3-3γ gene expression, our findings suggest that p53 could be one of the regulators, which may, when inactivated, contribute to the elevated level of 14-3-3γ gene expression in tumor tissues. It is interesting to observe that wt-p53 induced repression of the human 14-3-3γ transcription was mediated by direct binding to its promoter. The important observation is that human 14-3-3γ has a p53 binding site and this site is conserved with the known reported p53-repressed genes [
25]. Here the binding of p53 to its response element could result in direct repression of 14-3-3γ gene. Interestingly, the other 14-3-3 isoform, 14-3-3σ, which is well studied, is positively regulated by p53 [
3]. Even though 14-3-3γ protein shares more than 80% homology in protein sequence with 14-3-3σ, it is negatively regulated by p53. This functional difference between the two proteins is still unclear.
The finding that human 14-3-3γ is subject to p53 repression, as reported here, provides the first linkage between p53, a powerful tumor suppressor, and 14-3-3γ, an oncogene that promotes genomic instability and tumorigenesis. The fact that the 14-3-3γ promoter has a p53 binding site indicates that 14-3-3γ expression is regulated at the transcriptional level by p53.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
VMR carried out experimental design, molecular cloning, CHIP assay, Western blot and qPCR. CWP performed yeast hybrid assay. WQ carried out western blot for 14-3-3γ. JDM designed the experiments and analyzed the data. VMR and JDM wrote the manuscript. All the authors have read and approved the final manuscript.