Background
Lung cancer remains the leading cause of malignant tumor-related deaths worldwide [
1], with 85% of these cases being non-small cell lung cancer including lung adenocarcinomas (LUAD) and squamous cell carcinomas (LUSC) [
2]. Although surgical resection has achieved good results in patients with early NSCLC, the total survival time of patients remains short. Most LUAD patients are diagnosed at an advanced stage with a low survival rate and high postoperative recurrence rate [
3]. Therefore, it is necessary to uncover key regulatory molecules involved in the oncogenesis and progression of LUAD, which may lay the foundation for the development of new therapeutic strategies for patients with LUAD.
RNA-binding motif protein 14 (RBM14, also called CoAA) is amplified at chromosome 11q13 locus [
4] and is reported to regulate transcription and alternative splicing [
5,
6]. RBM14 is increased in a variety of tumors. The overexpression of RBM14 in NIH 3T3 cells promotes cell proliferation and colony formation [
4], whereas the downregulation of RBM14 inhibits osteosarcoma cell growth [
7]. Moreover, RBM14 enhances the transcriptional activity of PEA3 group member and is implicated in the migration of breast cancer [
8]. RBM14 also is reported to increase radio-resistance of glioblastoma [
9]. Besides, RBM14 can play the part of tumor suppressor by reducing the expression of c-Myc [
10]. However, the effect of RBM14 on lung cancer remains unclear.
In the present study, we have explored the function of RBM14 and potential mechanisms in LUAD. Higher mRNA and protein level of RBM14 is found in LUAD tissues and cell lines. The upregulated RBM14 is caused by the DNA methylation and H3 acetylation of its promotor. The transcription factor YY1 directly binds to EP300 and recruits EP300 to the promoter regions of RBM14, which further promotes the expression of RBM14. YY1-induced RBM14 promotes cell growth and inhibits apoptosis by regulating the reprogramming of glycolysis.
Methods
Data resource and comprehensive analysis
Cell culture
Human bronchial epithelial (HBE) cells and lung cancer cell lines (A549, PC9, H1299, and H1650) were obtained from ATCC. All cells were cultured in RPMI-1640 medium (Hyclone, Logan, USA) supplemented with 10% FBS (Gibco, Grand Island, USA) and antibiotics (100 units/ml penicillin and 100 μg/ml streptomycin) at 37°C in a humidified atmosphere (95% air, 5% CO2).
Cell transfections
The specific siRNA of RBM14 and YY1 overexpressed vector were ordered from Sangon Biotech (Shanghai, China). The sequence of si-RBM14 is 5′-GCATTCTGGCCATAGAGCTCGTATT-3′. The sequence of the scrambled siRNA is 5′-TGCTGACTCCAAAGCTCTG-3′. After being incubated overnight, the siRNAs or plasmids were transfected by using lipofectamine 2000 reagent (ThermoFisher Scientific, Waltham, USA). Forty-eight hours after transfection, cells were harvested for further analysis.
Reverse transcription-quantitative PCR
Total RNA was extracted using TRIzol® (Thermo Fisher Scientific). PrimeScript RT kit was used to reverse the mRNA into cDNA, and the SYBR-Green PCR Master One-Mix kit (TransGen, Biotech, Co., Ltd.) was used for quantitative real-time PCR. β-actin was used as an internal control. The sense and anti-sense primers were listed in Table
1.
Table 1
The primers used in this study
RBM14 | CTTCGACTACCAGCAGGCTTTT | CCGTCAGAGGCGCCACATAAG |
EP300 | ATTAAGGAACTGGAACAGGAG | AGAGGTCGTTAGATACATTGG |
HK2 | TGATGTGGCTGTGGATGAGCT | GCCAGGCAGTCACTCTCAATCTG |
PDK1 | GTGTAGATTAGAGGGATG | AAGGAATAGTGGGTTAGG |
PKM2 | GCACACCGTATTCAGCTCTG | TCCAGGAATGTGTCAGCCAT |
LDHA | AGGCTGGGAGTTCACCCATTAAGC | GAGTCCAATAGCCCAGGATGTG |
GLUT1 | TGTCGTGTCGCTGTTTGTGGTGGA | TGAAGAACAGAACCAGGAGCACAG |
GLUT3 | GAGGTGCTGCTCACGTCTC | TTGAATTGCGCCTGCCAAAG |
β-actin | ATTGGCAATGAGCGGTTC | CGTGGATGCCACAGGACT |
Chromatin immunoprecipitation assays
A Simple ChIP Enzymatic Chromatin IP Kit (#9002, Cell Signaling Technology, Danvers, USA) was used to evaluate the accumulation of YY1, EP300, H3K9ac, and H3K27ac in RBM14 promoter according to the manufacturer’s instructions. Briefly, after being crosslinked with EBM-2 containing 1% formaldehyde, the crosslinked cells were collected in a lysis buffer containing 1% PMSF. Chromatin was digested by micrococcal nuclease, and 2% of aliquots of lysate were used as input control. Lysates were incubated with 3 μg primary antibody or normal rabbit IgG, followed by immunoprecipitation with protein G agarose beads and incubation at 4 °C overnight with gentle shaking. DNA crosslink was reversed by the addition of 5 mol/L NaCl and Proteinase K at 65 °C for 2 h. Immunoprecipitated DNA was purified and amplified by PCR using specific primers. The IgG (ab172730, Abcam), anti-EP300 (ab275378, Abcam), anti-YY1 (ab109228, Abcam), anti-H3K9ac antibody (ab32129, Abcam), and anti-H3K27ac antibody (ab4729, Abcam) were used. Immunoprecipitated DNAs were analyzed by qPCR. Primer sequences targeting RBM14 promoter (−91~+7; ch11: 66616629-66616727, named RBM14-promoter) were as follows: sense, 5′-CATTCCTGAGGAGGACTGCC-3′ and anti-sense, 5′-TCTTCATTTTGTCGCCGCAG-3′.
Western blotting
Cells were lysed by RIPA buffer (P0013C, Beyotime, Jiangsu, China), and the protein concentration was measured using a BCA kit (P0010, Beyotime). The protein was separated using SDS-PAGE and transferred onto a PVDF membrane (ISEQ00010, EMD Millipore). After blocking with 5% skimmed milk, the membrane was incubated with primary antibodies against RBM14 (ab70636, Abcam), YY1 (#63227, Cell Signaling Technology), p300 (#54062, Cell Signaling Technology), and β-actin (ab179467, Abcam) over-night at 4°C. After washing, the secondary antibody (Cell Signaling Technology) was added for 1 h of incubation. Protein signals were analyzed using an enhanced chemiluminescence substrate reagent kit (P0018M, Beyotime).
Co-immunoprecipitation
Cells were lysed with IP buffer (1 mM EDTA, 20 mM HEPES, 150 mM NaCl, 0.05% sodium deoxycholate, and 0.05% NP-40) added protease inhibitors and phosphatase inhibitor cocktails. After centrifugation at 12,000 rpm for 10 min, the cell lysates were incubated with indicated antibody and protein A/G PLUS agarose beads (#9863, #37478, Cell Signaling Technology) overnight at 4 °C. After washing, the beads were lysed with loading buffer and boiled at 100 °C for 10 min. Then, the protein was detected by Western blotting.
Cell Counting Kit-8
The transfected cells (1 × 104 per well) were cultured in 96 well plates for 72 h of incubation. Then, 10 μl Cell Counting Kit (CCK)-8 solution (C0038, Beyotime) was added to each well and incubated at 37°C for 2 h. The absorbance was detected at 450 nm using a microplate reader.
Apoptosis
Apoptotic cells were detected using an Annexin V-fluorescein isothiocyanate (FITC) Apoptosis Detection kit (#556547, BD Biosciences) according to the manufacturer’s instructions. Briefly, cells were re-suspended in 600 μl binding buffer. Then, 5 μl Annexin V/FITC and 5 μl propidium iodide (PI) were added. After being stained in dark for 15 min at room temperature, cells were analyzed by using a FACS Calibur (BD Biosciences).
Glycolysis
Forty-eight hours after transfection, PC9 and A549 cells were cultured in the phenol red-free medium for 24 h. The level of glucose and lactate in the culture supernatant was detected by Glucose Assay Kit (#361510, Rsbio, Shanghai, China) and Lactate Assay Kit (#A019–2, Nanjing Jiancheng Bioengineering Institute, China) according to the manufacturer’s instructions. A Seahorse XF Glycolysis Stress Test kit (#103020-100, Agilent Technologies, Santa Clara, USA) was used to evaluate ECAR according to the manufacturer’s instructions. The basal ECAR was measured under the basal condition, followed by the sequential addition to each well of glucose (10 mM), oligomycin (2 mM), and 2-deoxyglucose (100 mM).
Statistical analysis
All data analyses were performed using GraphPad Prism software (v6.02). Quantitative results are displayed as the mean ± standard error. Two-tailed Student’s t test and one-way analysis of variance (ANOVA) followed by Tukey’s test were used to compare the differences in two groups and multiple groups. Kaplan–Meier survival curve was analyzed with the log-rank test. Each experiment was conducted three times at a minimum. P < 0.05 was considered statistically significant.
Discussion
There are only several studies suggesting that overexpression and deletion of RBM14 gene may be involved in tumorigenesis and progression, but the function and regulation mechanism of RBM14 in lung cancer remains unknown. Here, we identified RBM14 as an oncogene and the overall survival of patients with high RBM14 expression was significantly poor. The increased RBM14 is induced by DNA methylation and histone acetylation. RBM14 knockdown inhibited growth and promoted apoptosis by regulating glycolysis. Our result suggested that RBM14 can be a potential therapeutic target for lung cancer.
The occurrence and development of lung cancer result in the accumulation of genetic and epigenetic changes [
11,
12]. DNA methylation, as the representative of epigenetic modifications, alters the expression of tumor-promoting genes or tumor suppressors [
13‐
16]. Epigenetic silencing of MPDZ inhibits growth and progression of lung cancer [
17] and epigenetic activation of FOXF1 confers cisplatin-resistant of NSCLC [
18]. Here, we found that the DNA methylation levels of RBM14 promoter are decreased in LUAD and 5-aza-dC treatment promoted the expression of RBM14 in lung cancer cell lines, indicating that DNA methylation of RBM14 is one of the induction factors for the overexpressed RBM14 in LUAD.
Transcription factors can regulate gene expression by recruiting histone modification-related enzymes. YY1 functions as a transcriptional factor that could activate or restrain its target genes, depending on the cofactors that recruit it [
19‐
21]. YY1 recruits EZH2 through its oncoprotein binding domain to inhibit gene expression by enhancing H3K27me3 [
22]. Gao et al. indicate that YY1 interacts with spleen tyrosine kinase and inhibits SNAI2 transcription in lung cancer cells [
23]. Wei et al. suggest that YY1 directly interacts with p300 and suppresses p53 stability, leading to the enhancement of cell proliferation and tumor growth [
24]. KDM6A is recruited to the NTRK1 promoter by YY1 with subsequent enhancing NTRK1-encoded protein expression [
25]. In this study, we confirmed the interaction between YY1 and EP300 and found that YY1 could promote RBM14 transcription by recruiting the HAT EP300, which transfers acetyl groups to histones.
YY1 has been reported to play crucial roles in various physiological functions, including cell proliferation, cell cycle, angiogenesis, metastasis, and glucose metabolism. Guo et al. find that YY1 participates in MIR31HG-mediated glycolysis colorectal cancer [
26]. YY1 overexpression could reverse the decrease of glucose uptake, lactate production, ATP release, HK2, and LDHA proteins in circYY1 depletion breast cancer cells [
27]. YY1 was also reported to promote the Warburg effect and tumorigenesis via glucose transporter GLUT3 [
28]. Our data indicated that YY1 regulated glycolysis by promoting RBM14 expression.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.