Skip to main content
Erschienen in: Diabetology & Metabolic Syndrome 1/2019

Open Access 01.12.2019 | Research

Reducing effect of insulin resistance on alpha-synuclein gene expression in skeletal muscle

Erschienen in: Diabetology & Metabolic Syndrome | Ausgabe 1/2019

Abstract

Background

Alpha-synuclein (SNCA) as the presynaptic protein is expressed in different tissues and prevents insulin-resistance (IR) through increasing glucose-uptake by adipocytes and muscles. However, the effect of insulin metabolism on SNCA expression has scarcely elucidated. In present study we assessed the probable effect of insulin resistance on SNCA expression in muscle C2C12 cells and also skeletal muscle tissues of type 2 diabetic mice.

Materials and methods

Sixteen male C57BL/6 mice were divided into two experimental groups, including control and type 2 diabetic mice with IR (induced by high-fat diet + low-dose streptozotocin). The animals of the study involved the measurements of fasting blood glucose, oral-glucose-tolerance-test, as well as fasting plasma insulin. Moreover, insulin-resistant and insulin-sensitive muscle C2C12 cells were prepared. The insulin-resistance was confirmed by the glucose-uptake assay. Comparative quantitative real time PCR was used to assess the SNCA expression.

Results

The obtained results have showed a significant ~ 27% decrease in SNCA expression level in muscle tissue of diabetic mice (P = 0.022). Moreover, there was a significant change of SNCA expression in insulin-resistant C2C12 cells (P < 0.001).

Conclusion

Type 2 diabetes due to insulin-resistance can decrease SNCA gene expression in muscles. In addition to the role of SNCA in cell susceptibility to insulin and glucose uptake, the SNCA expression can also be affected by insulin metabolism.
Hinweise

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
GLUT4
glucose transporter-4
T2D
type-2 diabetes
SNCA
alpha-synucleins
NIDDM
non-insulin dependent diabetes mellitus
IR
insulin-resistant
IS
insulin-sensitive
GM
growth medium
DM
differentiation medium
B2M
beta 2 microglobulin
LPAR2
lyso-phosphatidic acid receptor
PQ
paraquat
SGLT1
sodium–glucose transporter 1
AMPK
adenosine monophosphate-activated protein kinase

Background

Insulin has a critical role in regulation of glucose uptake and metabolism in different tissues via activating of the tyrosine kinase signaling pathway [1]. Insulin resistance (IR) as the main hyperglycemic process in non-insulin dependent diabetes mellitus (NIDDM) is observed in many tissues such as adipose and skeletal muscle [2]. Alpha-synuclein (SNCA, α-Syn) as one of the members of synuclein protein family is mainly expressed in brain tissue. Synucleins have 127–140 amino acids with similar domains and sequence similarity of 62–55% [3, 4]. SNCA as a principal component of Lewy bodies can be associated with neurodegenerative disorders such as Parkinson’s disease [5, 6]. However, it has been shown that the SNCA is expressed not only in neurons but also in various tissues including liver, spleen, kidney, red blood cells, cardiomyocytes, and skeletal muscles [7]. SNCA increases the glucose uptake in adipocytes and skeletal myocytes via activation of LPAR2/Gab1/PI3K/Akt signaling pathway and can be involved in prevention of insulin resistance [1, 3, 8]. Moreover, SNCA increases the transfer of vesicles containing GLUT4 to the dopaminergic neurons cell surface through its interaction with Rab8 [9]. It has reported that decreased levels of plasma alpha-synuclein were associated with insulin resistance. Furthermore, the plasma level of alpha-synuclein was reversely related to body mass index (BMI) and homeostatic model assessment for insulin resistance (HOMA-IR) [1]. However, there is not any clear principal mechanism of SNCA interactions with molecules in the insulin-dependent intracellular pathway. Since the basal expression of SNCA in the muscle cells in response to insulin has not been investigated to date, we decided to examine the expression of SNCA in insulin-resistant (IR) and insulin-sensitive (IS) models of skeletal muscle cells in both in vitro and in vivo studies.

Materials and methods

Animals study

This study was conducted on a total of 16 male C57BL/6 mice (Pasteur Institute, Iran) with 8 weeks of age and approximately 20–25 g. All procedures were according to the institutional animal ethics guidelines which approved by the Ethics Committee of North Khorasan University of Medical Sciences (ethical code: IR.nkums.REC.1397.036). The animals were kept in a clean cage under controlled condition (25 ± 2 °C) and humidity (50%) with a 12/12 h light/dark cycle. All the mice were fed with a normal pellet diet (NPD) containing 5% fat, 50% carbohydrate, 25% protein and total calorific value 25 kJ/kg (Royan Institute, Iran) and free water 1 week before the initiation of the experiment and allowed to acclimatize to the laboratory environment. All the mice were divided into two groups with eight animals for each experimental groups as given below: group (1) healthy mice as controls fed with normal chow, group (2) the mice with diebetes induced by high-fat diet + STZ (HFD + STZ).

Type 2 diabetes induction

After 7 weeks of dietary manipulation of diabetic group by high-fat diet, a low dose of STZ (45 mg/kg) was injected into the mice, intraperitoneally. The food intake, body weight, and fasting plasma glucose were measured every week until 12 weeks. The mice with a fasting blood glucose level higher than 8.3 mmol/L 4 weeks after the injection were included to the study [10].

Biochemical measurements

As we mentioned in previous study, an oral glucose tolerance test was performed following 14-h fasting in the study groups 4 weeks after STZ injection. The glucose concentrations were measured in blood samples that were taken from the tail using Accu-Chek glucose meter at 0, 15, 30, 60 and 120 min post administration of glucose solution (3 g/kg) [11]. Moreover, the concentrations of fasting plasma insulin (Abnova, Taiwan) were measured by the enzyme-linked immunosorbent assay (ELISA) following the manufacturer’s protocols at the end of the animal study [12, 13].

Cell culture and differentiation

The C2C12 cells (Pasteur Institute, Iran) were cultured in a growth medium (DMEM, Gibco, UK) supplemented with 10% heat-inactivated fetal bovine serum (FBS, Gibco, UK), penicillin 100 IU/ml, and streptomycin 100 μg/ml (Gibco, UK) before cell differentiation (37 °C and 5% CO2). After seeding into 12-well plates and obtaining 60% of confluency, myoblasts differentiation to myotubes was induced by changing growth medium (GM) to differentiation medium (DM) which was supplemented with 3% of horse serum (Capricorn Scientific, Germany) and 1% of penicillin/streptomycin. Insulin-resistant (IR) cells were generated through a cell culture for 3 days in differentiation medium supplemented with 100 nM insulin (Sigma, USA). The insulin-sensitive (IS) cells were not exposed to insulin.

Glucose uptake assay

Glucose uptake was assessed in IR and IS models to confirm the insulin-resistance. Myoblasts were initially incubated for 1 h in glucose-free media followed by 3 h incubation in DMEM containing 8 mM glucose. Then the cells were exposed to 1 μM insulin for 1 h and media were taken from the respective wells. The remained glucose in media was measured using the glucose oxidase method (Pars Azmoon, Iran) [14].

RNA extraction and quantitative real-time PCR

RNA extractions from cells and frozen muscle tissues were performed using a column method according to the manufacturer’s instruction (Bio basic, Canada). The total RNA quality and concentrations were determined by measuring the 260/280 nm ratio using a bio-spectrophotometer (Lambda max, Japan). Complementary DNA (cDNA) was synthesized using PrimeScript Reverse Transcript Reagent Kit (Takara, Japan). The quantitative SYBR green (Takara, Japan) real-time polymerase chain reaction (qRT-PCR) was done in duplicate reactions (Rotor-Gene 6000, Qiagen, Germany) to assess the SNCA mRNA expression. All the primer sequences are mentioned in Table 1. Thermal profile was a 95 °C for 5 min followed by 40 cycles at 95 °C for 10 s, 60 °C for 20 s, and 62 °C for 30 s. Melting curve analysis was also performed by increasing the temperature (1 °C) from 57 °C to 95 °C with continues fluorescence acquisition. Relative expressions of SNCA mRNA levels were calculated using the 2−ΔΔCT method and normalized based on Beta 2 Microglobulin (B2M) mRNA levels.
Table 1
Specific primers for real time- PCR assay
Primer sequence (5′ → 3′)
Target
PCR product (bp)
F: TGACAGCAGTCGCTCAGAAG
R: TCATAGTCTTGGTAGCCTTCCTCTG
SNCA
NM_001042451
190
F-5′-CTTCAGCAAGGACTGGTC-3′
R-5′-TCTCGATCCCAGTAGACG-3′
B2M
NM_009735.3
129

Statistical analysis

All of the in vitro experiments have been repeated three times in duplicate reactions (n = 6). Data were interpreted based on mean ΔCT ± SE. Relative gene expression data comparisons were performed using t-student and ANOVA compared with the control group. Probability values < 0.05 were considered statistically significant.

Results

Biochemical parameters

Feeding the mice with high-fat diet showed significantly increases in FBG and body weight in diabetic group. Injection of STZ at 7th week induced hyperglycemia and decreased body weight in diabetic group. However, the total body weight of HFD + STZ diabetic mice was more than NPD healthy mice. Moreover, the amounts of water and food consumption of diabetic mice were increased compared with control group. Fasting plasma glucose concentrations and fasting plasma insulin levels in diabetic mice were more than healthy group, which together show impaired glucose tolerance and insulin resistance. Moreover, the blood glucose levels after an oral glucose tolerance test in the study groups have shown the rate of glucose disappearance in NPD-fed healthy group was significantly higher than HFD-fed diabetic mice (Fig. 1).

SNCA gene expression in skeletal muscle tissues and muscle C2C12 cells

We examined the changes on the gene expression of SNCA in insulin resistant diabetic mice. As results showed the SNCA gene expression decreased ~ 27% in diabetic mice which were induced by HFD with low doses of STZ (P = 0.022) (Fig. 2). Moreover, it was observed that there was a significant ~ 47% decrease in the levels of SNCA mRNA expression in IR cells (P < 0.001) compared with IS cells (Fig. 2).

Discussion

There are little studies that have shown the interactive effects between insulin metabolism and alpha-synuclein (SNCA). This study elucidated a different expression of SNCA in insulin-resistant model of skeletal muscle using the C2C12 cell line and animal study.
Insulin resistance as one of the main T2D features can be developed by various environmental factors such as obesity [15]. Insulin increases the glucose uptake through increasing the glucose transporter 4 (GLUT4) transfer at the cell surface in adipose and skeletal muscle cells. As same as adipose tissues, GLUT4 has a key role in glucose uptake in the muscle fibers [16].
SNCA is mainly expressed in the brain and can be associated with pathogenesis of neurodegenerative disorders such as Alzheimer’s disease, Parkinson’s disease, dementia with Lewy bodies, and multiple-system atrophy [5, 6, 17, 18]. Recent studies have suggested that the SNCA is also associated with physical and pathological processes of muscle tissues [19]. SNCA is involved in regulation of glucose uptake in adipocytes and muscle cells through activation of LPAR2/Gab1/PI3K/Akt signaling pathway. In contrast, lack of SNCA in mice model resulted in reduced glucose uptake and metabolism. Therefore, SNCA can be associated with glucose transfer into the adipocyte and muscle cells through the PI3K/Akt signaling pathway and insulin independent [3]. It has been reported that the insulin resistance was eliminated in adipose and skeletal muscle tissues of the SNCA knock-out mice which were fed with high-fat diet. Moreover, they have shown that the plasma levels of SNCA were diminished in patients with insulin resistance. They also showed that the higher plasma levels of SNCA in humans and rodents models were associated with glucose metabolism and improved insulin response. Indeed, SNCA had a positive effect on glucose metabolism through the lyso-phosphatidic acid receptor (LPAR2). They have suggested that the SNCA can be associated with glucose uptake, reduced insulin resistance, and T2D [1]. According to the extracellular interaction between SNCA and LPAR2, it seems that SNCA may have an endocrine role, in addition to its intracellular activities. Since the role of SNCA has shown in glucose uptake in adipose and muscle cells, in present study we examined the effect of insulin resistance on the SNCA expression in the muscle C2C12 cell line and skeletal muscle tissues of diabetic mice with insulin resistance. The obtained results showed a significant negative correlation between SNCA expression and insulin resistance in both in vitro and in vivo studies.
Some studies have focused on the relationship between Parkinson’s disease and diabetes mellitus. It has shown that the SNCA aggregation as the main component of Lewy bodies increases the cell toxicity in dopaminergic neurons which can be the probable missing circle of diabetes progression in Parkinson’s disease. An in vitro study on dopaminergic N27 cell line has shown that the paraquat (PQ) associated cell toxicity was significantly reduced by glucose deprivation. On the other hand, the overexpression of wild type or A53T mutant α-synuclein and its interaction with PQ can stimulate glucose uptake through increasing levels of GLUT4 and sodium–glucose transporter 1 (SGLT1). Dopaminergic cell death was affected by PQ–SNCA interaction which is associated with glucose metabolism and adenosine monophosphate-activated protein kinase (AMPK) pathway [20]. Furthermore, advanced glycated end products (AGEs) in diabetic patients also elevate the glycated SNCA and its aggregation in dopaminergic neurons [21]. Another study has also shown that the SNCA–Rab8 interaction may increase the transfer of vesicles containing GLUT4 to the cell surface of dopaminergic cells [9].

Conclusions

In the present study, we showed that the SNCA expression was decreased in insulin resistant C2C12 cells and also skeletal muscle tissues of diabetic mice with insulin resistance. These results support the studies that show the decreased levels of plasma SNCA in insulin resistant diabetic patients. According to the reduced SNCA expression in the muscle cell following insulin resistance, the SNCA overexpression may improve the insulin-resistant cell response to insulin. It can be concluded that the SNCA can be dependent to insulin and may have important role in glucose metabolism in insulin-dependent cells.

Acknowledgements

Not applicable.
All applicable international, national, and/or institutional guidelines for the care and use of animals were followed. This study approved by the ethics committee of North Khorasan University of Medical Sciences (ethics code: IR.nkums.REC.1397.036).
Not applicable.

Competing interests

The authors declare that they have no competing interests.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Literatur
1.
Zurück zum Zitat Rodriguez-Araujo G, Nakagami H, Takami Y, Katsuya T, Akasaka H, Saitoh S, et al. Low alpha-synuclein levels in the blood are associated with insulin resistance. Sci Rep. 2015;5:12081.CrossRef Rodriguez-Araujo G, Nakagami H, Takami Y, Katsuya T, Akasaka H, Saitoh S, et al. Low alpha-synuclein levels in the blood are associated with insulin resistance. Sci Rep. 2015;5:12081.CrossRef
2.
Zurück zum Zitat Petersen MC, Shulman GI. Mechanisms of insulin action and insulin resistance. Physiol Rev. 2018;98(4):2133–223.CrossRef Petersen MC, Shulman GI. Mechanisms of insulin action and insulin resistance. Physiol Rev. 2018;98(4):2133–223.CrossRef
3.
Zurück zum Zitat Rodriguez-Araujo G, Nakagami H, Hayashi H, Mori M, Shiuchi T, Minokoshi Y, et al. Alpha-synuclein elicits glucose uptake and utilization in adipocytes through the Gab1/PI3K/Akt transduction pathway. Cell Mol Life Sci. 2013;70(6):1123–33.CrossRef Rodriguez-Araujo G, Nakagami H, Hayashi H, Mori M, Shiuchi T, Minokoshi Y, et al. Alpha-synuclein elicits glucose uptake and utilization in adipocytes through the Gab1/PI3K/Akt transduction pathway. Cell Mol Life Sci. 2013;70(6):1123–33.CrossRef
4.
Zurück zum Zitat Aggarwal SR. What’s fueling the biotech engine—2012 to 2013. Nat Biotechnol. 2014;32(1):32.CrossRef Aggarwal SR. What’s fueling the biotech engine—2012 to 2013. Nat Biotechnol. 2014;32(1):32.CrossRef
5.
Zurück zum Zitat Breydo L, Wu JW, Uversky VN (2012) α-Synuclein misfolding and Parkinson’s disease. Biochim Biophys Acta. 2012;1822(2):261–85.CrossRef Breydo L, Wu JW, Uversky VN (2012) α-Synuclein misfolding and Parkinson’s disease. Biochim Biophys Acta. 2012;1822(2):261–85.CrossRef
6.
Zurück zum Zitat Dawson TM, Dawson VL. Molecular pathways of neurodegeneration in Parkinson’s disease. Science. 2003;302(5646):819–22.CrossRef Dawson TM, Dawson VL. Molecular pathways of neurodegeneration in Parkinson’s disease. Science. 2003;302(5646):819–22.CrossRef
7.
Zurück zum Zitat Burré J, Sharma M, Südhof TC. Cell biology and pathophysiology of α-synuclein. Cold Spring Harb Perspect Med. 2018;8(3):a024091.CrossRef Burré J, Sharma M, Südhof TC. Cell biology and pathophysiology of α-synuclein. Cold Spring Harb Perspect Med. 2018;8(3):a024091.CrossRef
8.
Zurück zum Zitat Gao S, Duan C, Gao G, Wang X, Yang H. Alpha-synuclein overexpression negatively regulates insulin receptor substrate 1 by activating mTORC1/S6K1 signaling. Int J Biochem Cell Biol. 2015;64:25–33.CrossRef Gao S, Duan C, Gao G, Wang X, Yang H. Alpha-synuclein overexpression negatively regulates insulin receptor substrate 1 by activating mTORC1/S6K1 signaling. Int J Biochem Cell Biol. 2015;64:25–33.CrossRef
9.
Zurück zum Zitat Shi MM, Shi CH, Xu YM. Rab GTPases: the key players in the molecular pathway of Parkinson’s disease. Front Cell Neurosci. 2017;11:81.PubMedPubMedCentral Shi MM, Shi CH, Xu YM. Rab GTPases: the key players in the molecular pathway of Parkinson’s disease. Front Cell Neurosci. 2017;11:81.PubMedPubMedCentral
10.
Zurück zum Zitat Zhang M, Lv XY, Li J, Xu ZG, Chen L. The characterization of high-fat diet and multiple low-dose streptozotocin induced type 2 diabetes rat model. Exp Diabetes Res. 2009;2008:704045.PubMedCentral Zhang M, Lv XY, Li J, Xu ZG, Chen L. The characterization of high-fat diet and multiple low-dose streptozotocin induced type 2 diabetes rat model. Exp Diabetes Res. 2009;2008:704045.PubMedCentral
11.
Zurück zum Zitat Yessoufou A, Moutairou K, Khan NA. A model of insulin resistance in mice, born to diabetic pregnancy, is associated with alterations of transcription-related genes in pancreas and epididymal adipose tissue. J Obes. 2010;26:2011. Yessoufou A, Moutairou K, Khan NA. A model of insulin resistance in mice, born to diabetic pregnancy, is associated with alterations of transcription-related genes in pancreas and epididymal adipose tissue. J Obes. 2010;26:2011.
12.
Zurück zum Zitat Goodarzi G, Shirgir A, Alavi S, Khoshi A. Effect of insulin–glucose metabolism compared with obesity on adipose omentin gene expression in different models of diabetic C57BL/6 mice. Diabetol Metab Syndr. 2019;11(1):1–8.CrossRef Goodarzi G, Shirgir A, Alavi S, Khoshi A. Effect of insulin–glucose metabolism compared with obesity on adipose omentin gene expression in different models of diabetic C57BL/6 mice. Diabetol Metab Syndr. 2019;11(1):1–8.CrossRef
13.
Zurück zum Zitat Reed MJ, Meszaros K, Entes LJ, Claypool MD, Pinkett JG, Gadbois TM, Reaven GM. A new rat model of type 2 diabetes: the fat-fed, streptozotocin-treated rat. Metab Clin Exp. 2000;49(11):1390–4.CrossRef Reed MJ, Meszaros K, Entes LJ, Claypool MD, Pinkett JG, Gadbois TM, Reaven GM. A new rat model of type 2 diabetes: the fat-fed, streptozotocin-treated rat. Metab Clin Exp. 2000;49(11):1390–4.CrossRef
14.
Zurück zum Zitat Gallant M, Odei-Addo F, Frost C, Levendal R-A. Biological effects of THC and a lipophilic cannabis extract on normal and insulin resistant 3T3-L1 adipocytes. Phytomedicine. 2009;16(10):942–9.CrossRef Gallant M, Odei-Addo F, Frost C, Levendal R-A. Biological effects of THC and a lipophilic cannabis extract on normal and insulin resistant 3T3-L1 adipocytes. Phytomedicine. 2009;16(10):942–9.CrossRef
15.
Zurück zum Zitat Weyer C, Bogardus C, Mott DM, Pratley RE. The natural history of insulin secretory dysfunction and insulin resistance in the pathogenesis of type 2 diabetes mellitus. J Clin Investig. 1999;104(6):787–94.CrossRef Weyer C, Bogardus C, Mott DM, Pratley RE. The natural history of insulin secretory dysfunction and insulin resistance in the pathogenesis of type 2 diabetes mellitus. J Clin Investig. 1999;104(6):787–94.CrossRef
16.
Zurück zum Zitat Hatakeyama H, Kanzaki M. Heterotypic endosomal fusion as an initial trigger for insulin-induced glucose transporter 4 (GLUT4) translocation in skeletal muscle. J Physiol. 2017;595(16):5603–21.CrossRef Hatakeyama H, Kanzaki M. Heterotypic endosomal fusion as an initial trigger for insulin-induced glucose transporter 4 (GLUT4) translocation in skeletal muscle. J Physiol. 2017;595(16):5603–21.CrossRef
17.
Zurück zum Zitat Spillantini MG, Crowther RA, Jakes R, Hasegawa M, Goedert M. α-Synuclein in filamentous inclusions of Lewy bodies from Parkinson’s disease and dementia with Lewy bodies. Proc Natl Acad Sci. 1998;95(11):6469–73.CrossRef Spillantini MG, Crowther RA, Jakes R, Hasegawa M, Goedert M. α-Synuclein in filamentous inclusions of Lewy bodies from Parkinson’s disease and dementia with Lewy bodies. Proc Natl Acad Sci. 1998;95(11):6469–73.CrossRef
18.
Zurück zum Zitat Yu S, Li X, Liu G, Han J, Zhang C, Li Y, et al. Extensive nuclear localization of α-synuclein in normal rat brain neurons revealed by a novel monoclonal antibody. Neuroscience. 2007;145(2):539–55.CrossRef Yu S, Li X, Liu G, Han J, Zhang C, Li Y, et al. Extensive nuclear localization of α-synuclein in normal rat brain neurons revealed by a novel monoclonal antibody. Neuroscience. 2007;145(2):539–55.CrossRef
19.
Zurück zum Zitat Askanas V, Engel WK, Alvarez RB, McFerrin J, Broccolini A. Novel immunolocalization of α-synuclein in human muscle of inclusion-body myositis, regenerating and necrotic muscle fibers, and at neuromuscular junctions. J Neuropathol Exp Neurol. 2000;59(7):592–8.CrossRef Askanas V, Engel WK, Alvarez RB, McFerrin J, Broccolini A. Novel immunolocalization of α-synuclein in human muscle of inclusion-body myositis, regenerating and necrotic muscle fibers, and at neuromuscular junctions. J Neuropathol Exp Neurol. 2000;59(7):592–8.CrossRef
20.
Zurück zum Zitat Anandhan A, Lei S, Levytskyy R, Pappa A, Panayiotidis MI, Cerny RL, et al. Glucose metabolism and AMPK signaling regulate dopaminergic cell death induced by gene (α-synuclein)-environment (paraquat) interactions. Mol Neurobiol. 2017;54(5):3825–42.CrossRef Anandhan A, Lei S, Levytskyy R, Pappa A, Panayiotidis MI, Cerny RL, et al. Glucose metabolism and AMPK signaling regulate dopaminergic cell death induced by gene (α-synuclein)-environment (paraquat) interactions. Mol Neurobiol. 2017;54(5):3825–42.CrossRef
21.
Zurück zum Zitat König A, Vicente Miranda H, Outeiro TF. Alpha-synuclein glycation and the action of anti-diabetic agents in Parkinson’s disease. J Parkinson’s Dis. 2018;8(1):33–43.CrossRef König A, Vicente Miranda H, Outeiro TF. Alpha-synuclein glycation and the action of anti-diabetic agents in Parkinson’s disease. J Parkinson’s Dis. 2018;8(1):33–43.CrossRef
Metadaten
Titel
Reducing effect of insulin resistance on alpha-synuclein gene expression in skeletal muscle
Publikationsdatum
01.12.2019
Erschienen in
Diabetology & Metabolic Syndrome / Ausgabe 1/2019
Elektronische ISSN: 1758-5996
DOI
https://doi.org/10.1186/s13098-019-0499-6

Weitere Artikel der Ausgabe 1/2019

Diabetology & Metabolic Syndrome 1/2019 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Reizdarmsyndrom: Diäten wirksamer als Medikamente

29.04.2024 Reizdarmsyndrom Nachrichten

Bei Reizdarmsyndrom scheinen Diäten, wie etwa die FODMAP-arme oder die kohlenhydratreduzierte Ernährung, effektiver als eine medikamentöse Therapie zu sein. Das hat eine Studie aus Schweden ergeben, die die drei Therapieoptionen im direkten Vergleich analysierte.

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.