Background
The ubiquitin proteasome system (UPS) is the major proteolytic system encountered in the cytoplasm and nucleus of virtually all nucleated eukaryotic cells[
1]. Tight regulation of UPS-mediated proteolysis is maintained to control half-lives of proteins involved in cell cycle regulation, transcriptional control, antigen processing, angiogenesis, and removal of incorrectly folded or damaged proteins[
2]. It has become evident that proteasomal function is essential for cell survival and that inhibition of proteasomal activity is a powerful means to induce cytotoxicity in many cancer cells derived from various histology[
3,
4].
Resveratrol, a naturally occurring polyphenolic compound, is enriched in a variety of food sources, such as grapes, peanuts and red wine. A number of previous studies have reported that resveratrol can inhibit the growth of human cancer cells when it is present alone at rather high concentrations (usually >50 uM) [
5‐
8]. In addition, it has been reported when it is used in combination with other anticancer drugs, resveratrol can avoid some of the debilitating side effects and sensitize a number of cancer cell lines to the anticancer actions of some other conventional chemotherapy drugs such as TNFα, paclitaxel, et al., as well as radiotherapy [
5‐
7,
9‐
13]. Accumulating data support that proteasome inhibitors have the potential to reduce the viability of proliferating cells, while nonproliferating, quiescent cells, in short-term experiments at least, are remarkably protected against apoptosis induced by proteasome inhibitors[
14,
15]. One common feature of quiescent cells is the upregulation of p27
Kip1, a ubiquitous cyclin dependent kinase inhibitor (CKI), which leads to G1/S arrest and appears to be a general property of cells that switch to a nonproliferative phenotype[
16,
17]. In addition, it has been reported that p27
Kip1-mediated cell cycle arrest at G1/S transition is required for protection against proteasome inhibitors[
18].
In the current study, we have found that resveratrol dramatically protects leukemic cells from cytotoxic actions of proteasome inhibitors via p27Kip1-mediated G1/S cell cycle arrest. In addition, we have demonstrated that synergistic induction of p27Kip1 via FOXO1 by MG132 in combination with resveratrol is, at least partly, responsible for the protective effects of resveratrol. In light of the recent interest in the resveratrol for its possible use in combination chemotherapy regimens and widespread use of resveratrol among cancer patients, this study calls for more caution for leukemia patients using resveratrol as a dietary adjuvant during treatment with proteasome inhibitors.
Methods
Culture of multiple leukemic cell lines
K562, U937, NB4, Daudi and Raji cell lines were maintained in RPMI1640 medium (Sigma-Aldrich, Saint Louis, MO) supplemented with 10% fetal bovine serum (FBS, Sigma-Aldrich, Saint Louis, MO).
Chemicals
MG132, epoxomycin, PSI and lactacystin were purchased from Calbiochem. 0.02% DMSO was used as vehicle control.
Cell viability assays
For cell viability assays, cells were plated in 96-well dishes (1 × 104 cells per well) and treated with different effectors for 24 h. Cell viability was assessed using the 3-(4,5-dimethylthiazol-2-thiazolyl)-2,5-diphenyl tetrazolium bromide (MTT) assay (Chemicon, Bedford, MA) according to the manufacturer's instruction.
Detection of apoptotic cells
For cell death assays, cells were washed twice in phosphate-buffered saline and then stained with Annexin V-FITC (Biovision, Mountainview, CA) and propidium iodide (PI, Sigma-Aldrich) according to the manufacturer's instructions. After staining with annexin V-FITC and PI, samples were analyzed by fluorescence-activated cell scanner (FACScan) flow cytometer (Becton Dickinson, Franklin Lakes, NJ).
Analysis of the cell cycle by flow cytometry
Cells were exposed to different concentrations of resveratrol for 24 h. The cells were fixed in 70% ethanol and stained with 50 μg/ml of propidium iodide (PI). The fluorescence was measured using the Becton Dickinson FACScan (Bedford, MA). Distribution of cells in distinct cell cycle phase was determined using ModFIT cell cycle analysis software.
Western blot analysis
Cells were lysed in lysis buffer (20 mM Tris-HCl, 150 mM NaCl, 2 mM EDTA, 1% Triton-X100 and protease inhibitor cocktail (Sigma-Aldrich, Saint Louis, MO). Cell extract protein amounts were quantified using the BCA protein assay kit. Equivalent amounts of protein (25 μg) were separated using 12% SDS-PAGE and transferred to PVDF membrane (Millipore Corporation, Billerica, MA).
Preparation of cytoplasmic and nuclear extract
After treatment, cells were lysed in buffer A (containing 10 mM HEPES, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT, 1% Nonidet P-40 and protease inhibitor cocktail) and centrifuged at 12,000 g for 10 min at 4°C. The supernatant was collected and used as the cytoplasmic extracts. The nuclei pellet was resuspended in buffer B (20 mM HEPES, pH7.9, containing 1.5 mM MgCl2, 450 mM NaCl, 25% glycerol, 0.2 mM EDTA, 0.5 mM DTT and protease inhibitor cocktail) and agitated fro 60 min at 4°C, and the nuclear debris was spun down at 20,000 g for 15 min. The supernatant (nuclear extract) was collected. Antibodies against Histone H2B and LDH were used as loading controls for nuclear and cytosolic proteins, respectively.
Chromosomal immunoprecipitation (ChIP) assay
ChIP assays were performed using a kit from Upstate Biotechonology Inc. (Lake Placid, NY) according to the supplied protocol. In brief, cells were exposed to different treatment and fixed with 1% formaldehyde in PBS to cross-link chromatin. Cell lysates were prepared and sonicated on ice to break chromatin DNA to an average length of 400 bp. After a preclearing step, immunoprecipitation was carried out at 4°C overnight with anti-FOXO1 antibody or normal goat IgG (negative control antibody). Immune complexes were collected with salmon sperm DNA saturated protein A-agarose beads. After extensive washing the immunoprecipitated complexes were eluted with 0.1 M NaHCO3 and 1% SDS, and then protein-DNA cross-links were reversed by incubating at 65°C for 5 hours. DNA was purified using proteinase K digestion, phenol: chloroform extraction and ethanol precipitation. Real-time PCR was performed using primers specific for the p27
Kip1 sequence between -237 and +15 (forward: 5'-AGGTTTGTTGGCAGCAGTACC-3' and reverse: 5'-AGGCTGACGAAGAAGAAAATG-3') to generate a 252 bp amplification product containing the FOXO response element[
19,
20]. A standard curve was prepared using serial dilutions of PCR products using genomic DNA as template. The amount of p27
Kip1 promoter fragment that was present in the immunoprecipitation and input fractions was calculated from the standard curve. The input represents 1% of the material used in the immunoprecipitation assay. The results were expressed as the immunoprecipitation/input ratios of the PCR products were used for comparison.
Small interfering RNA
The siRNA sequences used here were as follows: siRNA against p27Kip1 (sip27Kip1), GGAGCAAUGCGCAGGAAUAUU; siRNA against FOXO1 (siFOXO1), CCCUGUAACUGACAGACCAAAU. The scramble nonsense siRNA (scramble; CCGUAUCGUAAGCAGUACU) that has no homology to any known genes was used as control. The cells were transfected using FuGENE 6 according to the manufacturer's instruction.
Statistics
The statistical significance of the difference was analyzed by ANOVA and post hoc Dunnett's test. Statistical significance was defined as p < 0.05. All experiments were repeated three times, and the results are presented as mean ± standard deviation (SD) of the three repeated experiments performed in triplicate.
Discussion
Single agent of proteasome inhibitor resulted in significant responses in leukemic cells and the combination of proteasome inhibitors and other chemotherapeutic drugs enhanced its antitumoral efficacy [
3,
33‐
37]. Initially, the experiments were planned to test whether resveratrol could sensitized K562 cells to the anticancer actions of proteasome inhibitors. To our surprise, resveratrol did not promote, but rather attenuated the apoptotic effects of MG132 in cultured K562 cells. We further extended our investigation using a panel of leukemic cells and found that resveratrol also attenuated the cytotoxic actions of MG132 in NB4, U937, Raji and Daudi cells. Furthermore, resveratrol also compromised the apoptotic effects of other three structurally different proteasome inhibitors, PSI, epoxomicin and lactacystin. This was consistent with the previous study that resveratrol exerted its protective effects against proteasome inhibitor-induced cellular damages in human skeletal myotubes [
38]. Consistent with our previous report[
21], in the current study, we found that resveratrol
per se did not cause obvious apoptosis when less than 100 μM concentration was used within 24 h. Chakraborty PK et al. reported that treatment with 40 μM resveratrol for 48 h induced apoptosis of K562 cells [
39]. The different effects of resveratrol on apoptosis of K562 cells might be ascribed to different period of exposure. Alternatively, Chakraborty PK et al. used subG1 fractions represented as apoptotic cells [
39], while in the current study, we used Annexin V/PI double staining followed by flow cytometry to detect apoptotic cells. The different methods used in these studies might contribute to the different apoptotic actions of resveratrol. The higher cytoprotective effect of resveratrol on cytotoxic actions of proteasome inhibitors was observed when it was used at 5-20 μM concentration. We observed that 50-100 μM resveratrol was slightly cytotoxic for K562 cells, which could explain why this concentration exerted a lower cytoprotective action compared with 20 μM resveratrol. Even this, when cells were concurrently incubated with 100 μM of resveratrol, the apoptosis observed after exposure to MG132 was significantly lower than the one observed in the cells exposed to MG132 alone, indicating that even when 100 μM resveratrol could induce a certain degree of cytotoxicity in these cells, at the same time exerted a cytoprotective action against cytotoxicity-mediated by proteasome inhibition. Resveratrol was reported to be abundant in grapes, blueberries and peanuts. In grapes, its highest concentration was in the skin (50-100 μg per gram), thereby making red wines (but not white wines) the richest dietary source [
40]. In plasma, it bound with lipoproteins and albumin which facilitated its carrier-mediated cellular uptake [
41]. In experimental animals, resveratrol was rapidly metabolized by the liver and its plasma half-life remained quite low [
42], however, in human, about 70% of orally administered resveratrol (25 mg) was absorbed with a peak plasma level of ~2 μM and a half-life of ~10 h [
43]. In the current study, we found that 5 μM of resveratrol could antagonize the cytotoxic effects of proteasome inhibitors. Therefore, concurrent intake of resveratrol products should be discreet.
Arrest at G1/S transition appeared to be a general property of cells that switched to a nonproliferative phenotype [
16,
17,
44]. Compared with nonproliferating, quiescent cells, proliferating cells were much more sensitive to cytotoxicity induced by proteasome inhibitors [
14,
15]. In the current study, we found that combination of resveratrol and MG132 significantly increased proportion of cells in G1 fraction, therefore, protective effects of resveratrol against proteasome inhibition might be the result of blocking cell cycle progression at the G1/S transition and thus preventing the cells from proliferation.
Proteasome inhibitor-induced apoptosis generally was accompanied by the accumulation of p27
Kip1, a universal CDK-cyclin inhibitor responsible for cell cycle arrest at G1/S transition [
45]. A rather broad spectrum of effects were ascribed to elevated levels of p27
Kip1 protein ranging from proapoptotic functions in various systems to survival-promoting properties in others. Conflicting observations were also reported regarding the role of p27
Kip1 in apoptosis induced by proteasome inhibitors. As overexpression of p27
Kip1 in various tumor cell lines was sufficient to induce apoptosis in various cancer cell lines [
46,
47], it had therefore been deduced that cytotoxicity induced by proteasome inhibitors could be due to the uncoordinated upregulation of p27
Kip1 [
45,
48,
49]. These pro-apoptotic properties were also consistent with the notion that p27
Kip1 exerted the task of a tumor suppressor gene. In contrast to these observations, the cytotoxic effects of proteasome inhibitors in general appeared to be selective for proliferating cells, but quiescent cells generally with high levels of p27
Kip1 in nucleus seemed to be protected [
14,
15]. For example, primary endothelial cells which became contact inhibited upon reaching confluence displayed a remarkable degree of resistance against apoptosis induced by proteasome inhibitors in the presence of increased steady state levels of p27
Kip1, when compared with their proliferating counterparts [
15]. Similar observations were also observed in different cancer cell lines engineered to overexpress p27
Kip1 [
50‐
52]. Likewise, inducible overexpression of p27
Kip1 protected K562 cells against induction of apoptosis by proteasome inhibitors [
18]. Since proliferation and differentiation were usually mutually exclusive, it was not surprised that cell cycle arrest at G1/S transition and p27
Kip1 was also involved in the differentiation of erythroid precursors [
53,
54]. Thus, induction of cell differentiation via accumulation of p27
Kip1 and G1/S arrest might also contribute to the protective roles of resveratrol against proteasome inhibition-mediated cytotoxicity.
A major consequence of the anti-apoptotic properties of p27Kip1 appeared that high levels of p27Kip1 in tumor cells might not be always good news for cancer patients: high levels of active p27Kip1 within tumor cells might indicate that although less aggressive and more slowly growing, this tumor might be more difficult to be attacked by treatment with proteasome inhibitors or other chemotherapeutic drugs.
In conclusion, the present study demonstrated that resveratrol had the potential to negate the therapeutic efficacy of proteasome inhibitors in leukemic cells and suggested that intake of resveratrol-related products might be contraindicated for patients undergoing treatment with proteasome inhibitors. Considering the widespread use of resveratrol among cancer patients, further investigations should be necessary to elucidate the in vivo significance of these findings, which in turn might inform the need for dietary advice on the consumption of resveratrol during chemotherapy with proteasome inhibitors.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
XFN carried out the cell culture and molecular studies, and participated in the data analysis. BQL carried out ChIP, nuclear fractionation and flow cytometry. ZXD participated in real-time PCR and cell culture. YYG participated in flow cytometry and MTT assay. CL participated in cell culture and flow cytometry.NL participated in the DNA cloning and Western blot analysis. YG participated in manuscript proofreading. HQW conceived of the study, and participated in manuscript drafting and coordinate. All authors read and approved the final manuscript.