Skip to main content
Erschienen in: BMC Women's Health 1/2014

Open Access 01.12.2014 | Research article

Role of vascular endothelial growth factor polymorphisms (-2578C > A, -460 T > C, -1154G > A, +405G > C and +936C > T) in endometriosis: a case–control study with Brazilians

verfasst von: Jamila Alessandra Perini, Jessica Vilarinho Cardoso, Plínio Tostes Berardo, Rosane Vianna-Jorge, Luiz Eurico Nasciutti, Marta Bellodi-Privato, Daniel Escorsim Machado, Mauricio Simões Abrão

Erschienen in: BMC Women's Health | Ausgabe 1/2014

Abstract

Background

Endometriosis is regarded as a complex and heterogeneous disease in which genetic and environmental factors contribute to the phenotype. The Vascular Endothelial Growth Factor (VEGF) plays important roles in the pathogenesis of endometriosis. The present study was aimed at investigating the contribution of VEGF polymorphisms as risk factors for the development of endometriosis. This is the first study to evaluate the combined influence of the five most common VEGF polymorphisms.

Methods

This study was conducted at two hospitals from the Brazilian public health system, and comprised 294 women submitted to laparoscopic or laparotomy surgery: 182 patients had a histologically confirmed diagnosis of endometriosis (cases), whereas 112 had no evidence of the disease (controls). The VEGF polymorphisms were determined by TaqMan real-time polymerase chain reaction. The odds ratio (OR) with their 95% confidence intervals (CI) were calculated using an unconditional logistic regression model.

Results

Endometriosis patients and controls did not differ regarding age distribution, whereas the body mass index was significantly lower in endometriosis patients, when compared with controls (23.1 ± 3.9 versus 27.3 ± 5.9, P < 0.001). The evaluation of gynecological symptoms, including dysmenorrhea, non-cyclic chronic pelvic pain, dyspareunia and infertility, indicates significantly higher prevalences among endometriosis cases. The variant allele -1154A was significantly associated with endometriosis, either considering all cases (OR: 1.90, 95% CI: 1.23–2.97), deep infiltrating endometriosis (DIE) (OR: 1.83, 95% CI: 1.16-2.90) or moderate and severe endometriosis (stages III-IV) (OR: 1.97, 95% CI: 1.21-3.19). No significant differences were found in allele or genotype distributions of the –2578C > A, -460 T > C, +405G > C and +936C > T polymorphisms between endometriosis cases and controls. A total of six haplotypes were inferred derived from four polymorphisms (-2578C > A, -460 T > C, -1154G > A and +405G > C). There was a protective association between CCGG haplotype and endometriosis, either considering all cases (OR: 0.36, 95% CI: 0.15–0.86), DIE (OR: 0.37 95% CI: 0.15 – 0.90) or stages III-IV (OR: 0.35 95% CI: 0.13 – 0.95).

Conclusions

The present results indicate a positive association between VEGF -1154G > A and the risk of developing endometriosis, whereas the CCGG haplotype may be protective against the development of disease.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1472-6874-14-117) contains supplementary material, which is available to authorized users.

Competing interests

The authors declare that they have no competing interest.

Authors’ contributions

JAP designed the research, analyzed data, wrote the manuscript and obtained funding. JVC recruited the patients from the HFSE/RJ, contributed to data collection, genotyping and analysis. PTB followed the patients from the Servidores Federal Hospital of Rio de Janeiro (HFSE/RJ), contributed to data collection and edited the manuscript. RVJ contributed to interpretation of data, critical discussion and edited the manuscript. LEN contributed to the idea and edited the manuscript. MBP recruited the patients from the University of Sao Paulo's School of Medicine (FMU/SP) and contributed to data collection. DEM contributed to the idea, edited the manuscript and obtained funding. MSA followed the patients from the FMU/SP, contributed to data analysis, edited the manuscript and revisions for critical content. All authors read and approved the final manuscript.
Abkürzungen
BMI
Body mass index
CI
Confidence interval
DIE
Deeply infiltrating endometriosis
HWE
Hardy–Weinberg equilibrium
OR
Odds ratio
SD
Standard deviation
q.s
quantum sufficit
SNPs
Single-nucleotide polymorphisms
VEGF
Vascular endothelial growth factor.

Background

Endometriosis is a benign estrogen-dependent disease, characterized by the presence and growth of endometrial tissue outside the uterus, and represents one of the most common benign gynecological disorders nowadays [1]. This disease is associated with infertility, severe and incapacitating painful symptoms, including chronic pelvic pain, dysmenorrhea and dyspareunia [2, 3]. It has been estimated that endometriosis affects 10% of women of reproductive age, but the real prevalence may even be higher because it is often not diagnosed due to its heterogeneous clinical manifestation [4]. Endometriosis frequently produces serious effects on professional, social and marital life [5].
Despite many investigations about endometriosis, the pathogenesis of the disease remains unclear, although the predominant theory is that it is due to retrograde menstruation [6]. In addition, endometriotic lesions require an adequate blood supply to survive in their ectopic sites, and angiogenesis represents a crucial step during this process [7]. The development of new blood vessels is a complex dynamic process, which is regulated by a signal sequence of different angiogenic factors. The Vascular Endothelial Growth Factor (VEGF) is one of the most potent angiogenic factors and several authors postulated that it would be involved in the progress of the ectopic lesions in endometriosis [8, 9]. Accordingly, our group demonstrated that VEGF-induced angiogenesis is a critical aspect in the pathophysiology of this disease [1012].
VEGF is encoded by the VEGF gene [13], which is polymorphic, with several single nucleotide polymorphisms (SNPs) in regulatory regions [14]. Recently, there is growing interest in investigating if VEGF SNPs may affect the inheritable susceptibility to endometriosis [1518]. The results are conflicting, possibly due to the diversity of populations studied and because endometriosis is a heterogeneous disease [15]. In addition, no investigation regarding the susceptibility to endometriosis considered the combined effect of the five most studied VEGF SNPs (-2578C > A, -460 T > C, -1154G > A, +405G > C and +936C > T) in their possible haplotypes.
In the present work, we aimed to describe the frequency of alleles, genotypes and haplotypes of five VEGF SNPs among Brazilian women, and to evaluate their impact on endometriosis susceptibility.

Methods

Study population

The case–control study was approved by the Human Research Ethics Committee of the Hospital das Clínicas – Faculdade de Medicina – Universidade de São Paulo and of the Hospital Federal dos Sevidores do Estado (Protocols number 910/11 and 414/11, respectively). All participating patients (n = 294) provided written informed consent and answered a questionnaire about their demographics and preoperative painful symptoms. Data were obtained by in-person interviews at two hospitals from the Brazilian public health system, carried out from 2011 through 2013.
Patients assigned for laparoscopy or laparotomy for gynecological procedures were considered eligible. Individuals with any history or diagnosis of cancer or adenomyosis were not included, since both are angiogenesis-related pathologies [19, 20]. One hundred eighty-two patients undergoing laparoscopy (n = 174) or laparotomy (n = 8) for the diagnosis and treatment of endometriosis were enrolled as cases. The diagnosis of endometriosis, after their operative findings, was confirmed histologically, according to the presence of endometrial glands and/or stroma in the lesions. According to the revised American Fertility Society classification, 71 (39.0%) patients had minimal or mild endometriosis (stages I–II), 110 (60.4%) had moderate or severe endometriosis (stages III–IV) and 1 (0.6%) had these information missing. According to Nisolle and Donnez [21] three types of disease must be considered: superficial endometriosis (SUP), ovarian endometrioma (OMA) and DIE. The distribution of endometriotic patients according to their worst endometriotic lesion was as follows: SUP (14 patients; 7.7%), OMA (17 patients; 9.3%) and DIE (151 patients; 83.0%).
Controls (n = 112) were patients without visible endometriosis at surgery and who reported no previous diagnosis of endometriosis. In the control group, surgical laparoscopy (n = 106) or laparotomy (n = 6) was proposed in order to perform tubal ligation (n = 51) or treatment of benign diseases, such as ovarian cysts (n = 22), myoma (n = 10), hydrosalpinx (n = 8) or other reasons (n = 21).
The body mass index (BMI) was calculated as the weight (kg) divided by the square of height (m2). According to WHO’s expert committee [22], the weight status is classified into five groups: underweight (BMI < 18.5), normal weight (18.5 ≤ BMI ≤ 24.9), overweight (25 ≤ BMI ≤ 29.9), obesity (30 ≤ BMI < 40) and morbid obesity (BMI ≥ 40).
The present study focused specifically on objective symptoms, such as dysmenorrhea, chronic pelvic pain, deep dyspareunia and infertility. As suggested in our previous report [3], only severe and incapacitating symptoms of pain were included for statistical analysis purposes. Infertility (primary or secondary) was defined by the couple not being able to conceive after one year of regular, contraceptive-free intercourse.

VEGFgenotyping

Peripheral blood samples (3 mL) were collected in EDTA tubes, and DNA was extracted by using a commercial kit (Genomic DNA Extraction, Real Biotech Corporation) according to the manufacturer’s instructions. A validated TaqMan assay (VIC- and FAM-labeled) for detection of each VEGF -2578C > A (rs699947), -460 T > C (rs833061), -1154G > A (rs1570360), +405G > C (rs2010963), +936C > T (rs3025039) SNPs was purchased from Applied Biosystems. Table 1 summarizes the sets of probes and primers used for each analysis. PCR amplification for all SNPs was performed in 8 μL reactions with 30 ng of template DNA, 1× TaqMan Universal Master Mix (Applied Biosystems, Foster City, CA, USA), 1× each primer and probe assay, and H2O q.s. Thermal cycling was initiated with a first denaturation step of 10 min at 95°C, followed by 40 cycles of denaturation at 92°C for 15 s and annealing at 60°C for 1 min. The allele-detection process was performed on a 7500 Real-Time System (Applied Biosystems, Foster City, CA, USA) to determine the allelic discrimination.
Table 1
Characterization of VEGF polymorphisms, probes and primers sequences for genotyping by TaqMan real time PCR
Identified SNP
TaqMan assays
Region
Probe [SNP]
Primer
rs699947
C_8311602_10
PR
GCCAGCTGTAGGCCAGACCCTGGCA[A/C]GATCTGGGTGGATAATCAGACTGAC
5′-GGATGGGGCTGACT AGGTAAGC-3′
5′-AGCCCCCTTTTCCT CCAAC-3′
rs833061
C_1647381_10
PR
GAGTGTGTGCGTGTGGGGTTGAGGG[C/T]GTTGGAGCGGGGAGAAGGCCAGGGG
5′-TGTGCGTGTGGGGTTGAGAG-3′
5′-TACGTGCGGACAGGGCCTGA-3′
rs1570360
C_1647379_10
PR
AGCCCGGGCCCGAGCCGCGTGTGGA[A/G]GGGCTGAGGCTCGCCTGTCCCCGCC
5′-TCCTGCTCCCTCCT CGCCAATG-3′
5′-GGCGGGGACAGGC GAGCATC-3′
rs2010963
C_8311614_10
5′-UTR
CGCGCGGGCGTGCGAGCAGCGAAAG[C/G]GACAGGGGCAAAGTGAGTGACCTGC
5′-TTGCTTGCCATTCCCCACTTGA-3′
5′-CCGAAGCGAGAACAGCCCAGAA-3′
rs3025039
C_16198794_10
3′-UTR
GCATTCCCGGGCGGGTGACCCAGCA[C/T]GGTCCCTCTTGGAATTGGATTCGCC
5′-AAGGAAGAGGAGAC TCTGCGC-3′
5′-TATGTGGGTGGGT GTGTCTACAG-3′
PR is Promoter Region, 5′-UTR is 5′-Untranslated Region, 3′-UTR is 3′-Untranslated Region.

Statistical analysis

Comparisons of age and BMI in the study groups were performed using the Stundent’s t test, and data were presented as mean ± standard deviation (SD). Otherwise, the nominal data, such as spontaneous abortion, parity, infertility and preoperative painful symptoms, as well as the categories of BMI, were expressed as percentages and evaluated by Chi-Square Test or Fisher’s exact test, where applicable.
Deviations from Hardy–Weinberg equilibrium (HWE) were assessed by the goodness-of-fit χ2 test. VEGF allele frequency and genotype distribution were derived by gene counting. Allele and genotype frequencies between the groups were compared using the χ2 test or, when appropriate, the Fisher’s exact test. The haplotype patterns and linkage disequilibrium coefficients (D’ is degree of imbalance in module and R2 is degree of correlation) were inferred using Haploview [23], based on the algorithm of expectation and maximization [24]. The risk associations for endometriosis were estimated by the odds ratio (OR) with 95% confidence interval (95% CI). Confounding factors that could potentially influence the risk for endometriosis (P = 0.20) were taken into account in unconditional logistic regression models. All statistical analyses were conducted using Statistical Package for Social Sciences (SPSS Inc., Chicago, IL, USA) for Windows, version 15.0 and a P value less than 0.05 was considered statistically significant.

Results

No significant difference was observed in the mean age between the endometriosis patients (35.8 ± 8.6) and the control group (34.5 ± 6.4). Conversely, BMI, parity, number of spontaneous abortion, infertility and all preoperative endometriosis symptoms were significantly different between the two groups (Table 2). There was a predominance of low or normal BMI values (≤24.9) among endometriosis patients (75.1%), whereas controls had a predominance of overweight or obesity (58.4%), with 3.4% of patients showing morbid obesity (BMI ≥ 40). The distribution of endometriotic patients according to the worst endometriotic lesion was as follows: DIE (151 patients; 83.0%) and not DIE (31 patients; 17.0%).
Table 2
Demographics and clinical characteristics of the endometriosis patients and controls
Variable
Controls
Endometriosis
P valueb
No (%)
No (%)
BMI
   
  <18.5
3 (3.4)
13 (7.7)
<0.001
  18.5 ≤ BMI ≤ 24.9
31 (34.8)
113 (67.3)
  25 ≤ BMI ≤ 29.9
25 (28.1)
31 (18.5)
  30 ≤ BMI < 40
27 (30.3)
11 (6.5)
  ≤ 40
3 (3.4)
0 (0)
 
Parity
  
  0
21 (22.1)
116 (66.3)
<0.001
  1
14 (14.7)
35 (20.0)
  2
26 (27.4)
18 (10.3)
  ≤ 3
34 (35.8)
6 (3.4)
Spontaneous abortion
21 (22.8)
22 (12.6%)
0.032
Infertility
   
  No
88 (92.6)
93 (53.1)
<0.001
  Primary
6 (6.3)
60 (34.3)
  Secondary
1 (1.1)
22 (12.6)
Symptoma
  
  Dysmenorrhoea
21 (22.3)
91 (51.7)
<0.001
  Non-cyclic chronic pelvic pain
36 (38.3)
91 (51.7)
0.036
  Deep dyspareunia
12 (12.9)
100 (57.5)
<0.001
BMI is Body mass index. aA patient can have more than one concomitant symptom; bChi-Square Test or Fisher’s exact test.
The VEGF -2578C > A, -460 T > C, -1154G > A, +405G > C, +936C > T SNPs were in HWE in the overall study population and in each group (cases and controls). Figure 1 and Table 3 show, respectively, the minor allelic and genotypic frequencies of the VEGF SNPs. Significant differences in the allele and genotype frequencies were observed between the two groups with respect to the -1154G > A (P = 0.005 and P = 0.01, respectively). By contrast, no significant differences were detected in allele or genotype distribution of the -2578C > A, -460 T > C +405G > C, +936C > T SNPs between endometriosis patients and controls. The analysis of risk associations for the -1154G > A in developing either endometriosis or DIE (Table 4) suggests an approximate 2-fold increased risk for individuals with any variant genotype (GA + AA), or an approximate 6-fold increased risk for individuals with the homozygous variant genotype AA. Although no statistically significant risk association was detected for individuals with the heterozygous variant genotype (GA), a codominance model was inferred for the -1154G > A polymorphism (Ptrend = 0.008).
Table 3
Genotypic distribution of VEGF SNPs in endometriosis patients and controls
SNP
Population
N*
Genotypic distribution N (%)
P χ2
-2578C > A
  
CC
CA
AA
 
 
Controls
111
50 (45.0)
47 (42.3)
14 (12.7)
0.19
 
Cases
178
61 (34.3)
90 (50.6)
27 (15.1)
-460 T > C
  
TT
TC
CC
 
 
Controls
107
39 (36.4)
51 (47.7)
17 (15.9)
0.50
 
Cases
179
54 (30.2)
97 (54.2)
28 (15.6)
-1154G > A
  
GG
GA
AA
 
 
Controls
106
74 (69.8)
30 (28.3)
2 (1.9)
0.01
 
Cases
161
90 (55.9)
56 (34.8)
15 (9.3)
+405G > C
  
GG
GC
CC
 
 
Controls
110
38 (34.6)
56 (50.9)
16 (14.5)
0.16
 
Cases
181
83 (45.9)
75 (41.4)
23 (12.7)
+936C > T
  
CC
CT
TT
 
 
Controls
95
67 (70.5)
27 (28.4)
1 (1.1)
0.63
 
Cases
165
120 (72.8)
41 (24.8)
4 (2.4)
N* is the number of examined samples of cases and controls for each SNP. Differences in sample sizes are due to available data from PCR amplification for each SNP. P χ2 is P from Chi-square test (Pearson p-value) or Fisher’s exact test.
Table 4
Association analyses of the -1154G > A VEGF polymorphism in endometriosis patients compared with women without disease
-1154G > A
Controls
Cases
OR (95% IC)b
DIE Cases
OR (95% IC)c
Stages III-IV
OR (95% IC)d
(n = 106)
(n = 161)
(n = 131)
(n = 97)
N (%)
N (%)
N (%)
N (%)
Genotypes
       
GG
74 (69.8)
90 (55.9)
1a
75 (57.3)
1a
56 (57.7)
1a
GA
30 (28.3)
56 (34.8)
1.54 (0.90 - 2.63)
44 (33.6)
1.45 (0.82 - 2.54)
29 (29.9)
1.28 (0.69 - 2.37)
AA
2 (1.9)
15 (9.3)
6.17 (1.37 - 27.8)
12 (9.1)
5.92 (1.28 - 27.4)
12 (12.4)
7.93 (1.70 - 36.9)
Non-GG (GA + AA)
32 (30.2)
71 (44.1)
1.82 (1.09 - 3.06)
56 (42.7)
1.73 (1.01 - 2.96)
41 (42.3)
1.69 (0.95 - 3.02)
Allele
       
G
178 (84.0)
236 (73.3)
1a
194 (74.1)
1a
141 (72.7)
1a
A
34 (16.0)
86 (26.7)
1.90 (1.23 - 2.97)
68 (25.9)
1.83 (1.16 - 2.90)
53 (27.3)
1.97 (1.21 - 3.19)
OR is odds ratio, CI is confidence interval. aReference Group; bControls vs. Cases (All patients with endometriosis); cControls vs. Deeply infiltrating endometriosis patients (DIE); dControls vs. Moderate or severe endometriosis patients (stages III or IV). Due to insufficient DNA samples, some of the patients were not genotyped for -1154G > A SNP.
Haplotypes of the VEGF gene were determined for all patients and also for endometriosis cases and controls separately. The results revealed that SNPs -2578C > A, -460 T > C, -1154G > A and +405G > C were in strong linkage disequilibrium, forming a single haploblock, while +936C > T was not linked to the other SNPs (Figure 2). Therefore, haplotype analysis was only conducted between VEGF -2578C > A, -460 T > C, -1154G > A and +405G > C SNPs, and six haplotypes were inferred (Table 5). There was negative risk association for the development of endometriosis for the haplotypes CCGG and ATGG, when compared with the reference haplotype CTGG, either considering all cases, only DIE patients or stages III-IV of endometriosis. In addition, the haplotype ATGG showed negative risk associations for the development of endometriosis when considering all cases or DIE, but not stages III-IV, whereas the haplotype CTGC was protective only for the development of stages III-IV.
Table 5
Haplotype distributions of VEGF p olymorphisms in cases and controls and their association with the risk of developing endometriosis
-2578C > A/ -460 T > C/ -1154G > A/ +405G > C VEGFhaplotypes
Controls
All Cases
Pvalueb
OR (95% CI)c
DIE Cases
Pvalueb
OR (95% IC)d
Stages III-IV
Pvalueb
OR (95% IC)e
(N = 112)
(N = 182)
(N = 151)
(N = 110)
N (%)
N (%)
No (%)
No (%)
CTGG
42 (18.7)
85 (23.4)
 
1a
69 (22.9)
 
1a
55 (25.0)
 
1a
CTGC
90 (40.1)
121 (33.2)
0.10
0.66 (0.42 – 1.05)
104 (34.4)
0.18
0.70 (0.44 – 1.13)
69 (31.3)
0.05
0.58 (0.35 – 0.97)
ACAG
36 (16.0)
96 (26.4)
0.38
1.32 (0.77 – 2.24)
78 (25.8)
0.40
1.32 (0.76 – 2.29)
58 (26.4)
0.58
1.23 (0.69 – 2.19)
ACGG
37 (16.5)
51 (14.0)
0.23
0.68 (0.39 – 1.19)
42 (13.9)
0.27
0.69 (0.38 – 1.24)
31 (14.1)
0.21
0.64 (0.34 – 1.19)
CCGG
15 (6.7)
11 (3.0)
0.03
0.36 (0.15 – 0.86)
9 (3.0)
0.05
0.37 (0.15 – 0.90)
7 (3.2)
0.05
0.35 (0.13 – 0.95)
ATGG
4 (2.0)
0 (0.0)
0.03
-
0 (0.0)
0.05
-
0 (0.0)
0.09
-
OR is odds ratio, CI is confidence interval. aReference Group; bChi-Square Test or Fisher’s exact test; cControls vs. Cases (All patients with endometriosis); dControls vs. Deeply infiltrating endometriosis patients (DIE); eControls vs. Moderate or severe endometriosis patients (stages III or IV).

Discussion

The pathogenesis and the molecular mechanisms that underlie the development of endometriosis have troubled investigators through many years, remaining an enigma. Endometriosis is regarded as a complex trait in which genetic and environmental factors contribute to the disease heterogeneous phenotype. Regarding the epidemiological evaluation of the study population, we observed that women with endometriosis have lower BMI and are less frequently obese than control subjects. Our results corroborate previous findings [2529], although the reason for inverse correlation between BMI and endometriosis risk is still unclear. It can be hypothesized that genetic factors contributing to endometriosis may also be linked to BMI [30, 31]. Although epidemiological data can be used to better understand the endometriosis, further studies should investigate the genetics, environmental and physiopathological basis of the decreased BMI in women with endometriosis.
Because angiogenesis represents a critical step in the establishment and pathogenesis of endometriosis, this process has been viewed as a potential new target to better define the mechanisms that cause the disease. A large number of studies have observed that VEGF was significantly higher in women with endometriosis, which supported a key role for VEGF in the pathological angiogenesis in endometriosis [911]. Polymorphisms in VEGF may alter protein concentrations, influence the process of angiogenesis and relate to inter-individual variation in the risk of endometriosis. The promoter, and the 5’- and 3’- UTR of the VEGF gene contain key regulatory elements, which contribute to the high variability in VEGF production among tissues [14, 32, 33].
The inheritable susceptibility to endometriosis justifies the growing interest in identifying genetic polymorphisms that could lead to an increased risk or severity of the disease, in order to provide additional support for treatment planning. The present results indicate a positive association between VEGF -1154G > A and the risk of developing endometriosis, which is maintained when considering only the cases of DIE or stages III-IV. Such risk association was not observed previously [3436]. Thus, Liu et al. [34] proposed that the -1154AA genotype decreased endometriosis risk compared to the -1154GG genotype, whereas the latter reports showed no difference in the distribution of VEGF -1154G > A genotypes between cases and controls [35, 36]. Nevertheless, recent studies suggest that the VEGF -1154G > A SNP poses an increased risk of recurrent spontaneous abortion [37, 38]. Because such studies did not evaluate the occurrence of endometriosis as a possible cause of the recurrent spontaneous abortions, it cannot be excluded as a confounding factor in the association analyses. In addition, it has been reported that the frequency of the VEGF -1154G > A SNP in Brazilians might be different between individuals self-identified as “Blacks” or “Whites” [39]. The present study did not collect information on race or skin color. However, all individuals came from the same region of Brazil, had similar social backgrounds, and were recruited at two public hospitals, when assigned for laparoscopic procedures, regardless of the therapeutic indication. Therefore, no major racial or color differences is expected between cases and controls, which had equal access to the public health system.
With regards to the other four VEGF SNPs (-2578C > A, -460 T < C, +405G > C, +936C < T), our results suggest no significant effect on the susceptibility to endometriosis. It is noteworthy that our result is in agreement with Zhao and colleagues [40], which suggested no evidence for an association between endometriosis and the VEGF -2578C > A, -460 T < C, +405G > C and +936C < T SNPs, when considered together in a larger number (958 cases and 959 controls) of Australian women. Such findings appear to be corroborated by other studies which evaluated the different VEGF SNPs independently from their effect on the risk of endometriosis in different populations, and found no significant associations with -2578C > A[16, 40], -460 T < C[16, 34, 4048], +405G > C[16, 35, 40, 43, 44, 49, 50] or +936C < T[34, 35, 40, 51]. Nevertheless, results from a meta-analysis suggest that the VEGF -2578C > A might be protective for the development of endometriosis [18], whereas +936C > T was pointed as a risk factor [1618]. The increased risk of endometriosis for +936C < T was found independently on a single study, although the SNP showed no correlation with VEGF mRNA in endometriosis lesions or VEGF protein levels in peritoneal fluid [44]. Accordingly, Kim and colleagues [51] showed a lack of association between +936C < T genotypes and serum VEGF levels in endometriosis patients and controls.
The discrepancies between different studies involving the impact of VEGF SNPs on the susceptibility to endometriosis may be caused by different allele frequencies and heterogeneity in the study populations, besides environmental backgrounds. A strong point of our study is that all patients recruited (cases and controls) were surgically evaluated to explore for endometriosis. The histological confirmation of endometriosis was required to define cases, whereas controls had no visible ectopic endometrium sites to excluding possibly asymptomatic endometriosis. As a limitation, our controls included women with other non-endometriosis gynecological diseases, and might provide lower risk estimates if they are also associated with the polymorphisms under study.
As far as we know, the present work is the first study to focus on the possible contribution of the five most studied VEGF SNPs (-2578C > A, -460 T > C, -1154G > A, +405G > C and +936C < T) and its haplotypes on the susceptibility of endometriosis. In agreement with previous studies, -2578C > A, -460 T > C, -1154G > A[34] and -2578C > A, -1154G > A, +405G > C[35] were in linkage disequilibrium, while the +936C < T was visibly physically far, and had low LD with the other 4 markers in the gene [34, 35]. Only three studies reported association between VEGF haplotypes and susceptibility to endometriosis; however, the haplotypes with only two [41, 46] or three SNPs [34, 35] were evaluated. In the present study, we observed negative risk associations with the development of endometriosis for the haplotypes CTGC (only for stages III-IV), ATGG (for all cases combined or DIE), and CCGG haplotype (for all conditions). The haplotype ACAG, which was the only one containing the -1154A allele showed a non-significant positive risk association for endometriosis, in all conditions evaluated. Taken together, the results suggest that the effects of VEGF haplotypes in the risk of endometriosis are more significant and clinically relevant than those of each SNP evaluated separately. It is becoming increasingly important to derive data from different populations to build a database which can then be used in future investigations to a better understanding of the genetic and environmental factors affecting risk to development endometriosis.

Conclusion

In conclusion, our findings with VEGF SNPs and endometriosis in Brazilian women indicate a risk association for the polymorphism -1154G > A, and protective effect for the haplotype CCGG. This is the first study to evaluate the combined influence of the five most common VEGF SNPs. Therefore, further studies on the functional relevance of the VEGF polymorphisms and exposure to environmental factors in endometriosis are required to confirm our observations.

Acknowledgments

The authors thank Aline Cristina Silva de Jesus from University State of West Zone of Rio de Janeiro, Brazil, for her technical assistance. This study was supported by the Brazilian agency Fundação Carlos Chagas Filho de Amparo à Pesquisa do Estado do Rio de Janeiro - FAPERJ, Brazil (E-26/110.175/2010 and E-26/111.669/2011).
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​4.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.

Competing interests

The authors declare that they have no competing interest.

Authors’ contributions

JAP designed the research, analyzed data, wrote the manuscript and obtained funding. JVC recruited the patients from the HFSE/RJ, contributed to data collection, genotyping and analysis. PTB followed the patients from the Servidores Federal Hospital of Rio de Janeiro (HFSE/RJ), contributed to data collection and edited the manuscript. RVJ contributed to interpretation of data, critical discussion and edited the manuscript. LEN contributed to the idea and edited the manuscript. MBP recruited the patients from the University of Sao Paulo's School of Medicine (FMU/SP) and contributed to data collection. DEM contributed to the idea, edited the manuscript and obtained funding. MSA followed the patients from the FMU/SP, contributed to data analysis, edited the manuscript and revisions for critical content. All authors read and approved the final manuscript.
Anhänge

Authors’ original submitted files for images

Below are the links to the authors’ original submitted files for images.
Literatur
1.
Zurück zum Zitat Burney RO, Giudice LC: Pathogenesis and pathophysiology of endometriosis. Fertil Steril. 2012, 98: 511-519. 10.1016/j.fertnstert.2012.06.029.CrossRefPubMed Burney RO, Giudice LC: Pathogenesis and pathophysiology of endometriosis. Fertil Steril. 2012, 98: 511-519. 10.1016/j.fertnstert.2012.06.029.CrossRefPubMed
3.
Zurück zum Zitat Bellelis P, Dias-Jr JA, Podgaec S, Gonzales M, Baracat EC, Abrão MS: Epidemiological and clinical aspects of pelvic endometriosis – a case series. Rev Assoc Med Bras. 2010, 56: 467-471. 10.1590/S0104-42302010000400022.CrossRefPubMed Bellelis P, Dias-Jr JA, Podgaec S, Gonzales M, Baracat EC, Abrão MS: Epidemiological and clinical aspects of pelvic endometriosis – a case series. Rev Assoc Med Bras. 2010, 56: 467-471. 10.1590/S0104-42302010000400022.CrossRefPubMed
4.
Zurück zum Zitat Kennedy S, Bergqvist A, Chapron C, D'Hooghe T, Dunselman G, Greb R, Hummelshoj L, Prentice A, Saridogan E: ESHRE guideline for the diagnosis and treatment of endometriosis. Hum Reprod. 2005, 20: 2698-2704. 10.1093/humrep/dei135.CrossRefPubMed Kennedy S, Bergqvist A, Chapron C, D'Hooghe T, Dunselman G, Greb R, Hummelshoj L, Prentice A, Saridogan E: ESHRE guideline for the diagnosis and treatment of endometriosis. Hum Reprod. 2005, 20: 2698-2704. 10.1093/humrep/dei135.CrossRefPubMed
5.
Zurück zum Zitat Fourquet J, Gao X, Zavala D, Orengo JC, Abac S, Ruiz A, Laboy J, Flores I: Patients’ report on how endometriosis affects health, work, and daily life. Fertil Steril. 2010, 93: 2424-2428. 10.1016/j.fertnstert.2009.09.017.CrossRefPubMedPubMedCentral Fourquet J, Gao X, Zavala D, Orengo JC, Abac S, Ruiz A, Laboy J, Flores I: Patients’ report on how endometriosis affects health, work, and daily life. Fertil Steril. 2010, 93: 2424-2428. 10.1016/j.fertnstert.2009.09.017.CrossRefPubMedPubMedCentral
6.
Zurück zum Zitat Sampson JA: Peritoneal endometriosis due to menstrual dissemination of endometrial tissue into the peritoneal cavity. Am J Obstet Gynecol. 1927, 14: 422-469.CrossRef Sampson JA: Peritoneal endometriosis due to menstrual dissemination of endometrial tissue into the peritoneal cavity. Am J Obstet Gynecol. 1927, 14: 422-469.CrossRef
7.
Zurück zum Zitat Groothuis PG, Nap AW, Winterhager E, Grummer R: Vascular development in endometriosis. Angiogenesis. 2005, 8: 147-156. 10.1007/s10456-005-9005-x.CrossRefPubMed Groothuis PG, Nap AW, Winterhager E, Grummer R: Vascular development in endometriosis. Angiogenesis. 2005, 8: 147-156. 10.1007/s10456-005-9005-x.CrossRefPubMed
8.
Zurück zum Zitat McLaren J: Vascular endothelial growth factor and endometriotic angiogenesis. Hum Reprod Update. 2000, 6: 45-55. 10.1093/humupd/6.1.45.CrossRefPubMed McLaren J: Vascular endothelial growth factor and endometriotic angiogenesis. Hum Reprod Update. 2000, 6: 45-55. 10.1093/humupd/6.1.45.CrossRefPubMed
9.
Zurück zum Zitat Taylor RN, Yu J, Torres PB, Schickedanz AC, Park JK, Mueller MD, Sidell N: Mechanistic and therapeutic implications of angiogenesis in endometriosis. Reprod Sciences. 2009, 16: 140-146. 10.1177/1933719108324893.CrossRef Taylor RN, Yu J, Torres PB, Schickedanz AC, Park JK, Mueller MD, Sidell N: Mechanistic and therapeutic implications of angiogenesis in endometriosis. Reprod Sciences. 2009, 16: 140-146. 10.1177/1933719108324893.CrossRef
10.
Zurück zum Zitat Pupo-Nogueira A, de Oliveira RM, Petta CA, Podgaec S, Dias JA, Abrao MS: Vascular endothelial growth factor concentrations in the serum and peritoneal fluid of women with endometriosis. Int J Gynaecol Obstet. 2007, 99: 33-37. 10.1016/j.ijgo.2007.04.033.CrossRefPubMed Pupo-Nogueira A, de Oliveira RM, Petta CA, Podgaec S, Dias JA, Abrao MS: Vascular endothelial growth factor concentrations in the serum and peritoneal fluid of women with endometriosis. Int J Gynaecol Obstet. 2007, 99: 33-37. 10.1016/j.ijgo.2007.04.033.CrossRefPubMed
11.
Zurück zum Zitat Machado DE, Abrao MS, Berardo PT, Takiya CM, Nasciutti LE: Vascular density and distribution of vascular endothelial growth factor (VEGF) and its receptor VEGFR-2 (Flk-1) are significantly higher in patients with deeply infiltrating endometriosis affecting the rectum. Fertil Steril. 2008, 90: 148-155. 10.1016/j.fertnstert.2007.05.076.CrossRefPubMed Machado DE, Abrao MS, Berardo PT, Takiya CM, Nasciutti LE: Vascular density and distribution of vascular endothelial growth factor (VEGF) and its receptor VEGFR-2 (Flk-1) are significantly higher in patients with deeply infiltrating endometriosis affecting the rectum. Fertil Steril. 2008, 90: 148-155. 10.1016/j.fertnstert.2007.05.076.CrossRefPubMed
12.
Zurück zum Zitat Machado DE, Berardo PT, Palmero CY, Nasciutti LE: Higher expression of vascular endothelial growth factor (VEGF) and its receptor VEGFR-2 (Flk-1) and metalloproteinase-9 (MMP-9) in a rat model of peritoneal endometriosis is similar to cancer diseases. J Exp Clin Cancer Res. 2010, 29: 4-10.1186/1756-9966-29-4.CrossRefPubMedPubMedCentral Machado DE, Berardo PT, Palmero CY, Nasciutti LE: Higher expression of vascular endothelial growth factor (VEGF) and its receptor VEGFR-2 (Flk-1) and metalloproteinase-9 (MMP-9) in a rat model of peritoneal endometriosis is similar to cancer diseases. J Exp Clin Cancer Res. 2010, 29: 4-10.1186/1756-9966-29-4.CrossRefPubMedPubMedCentral
13.
Zurück zum Zitat Vincenti V, Cassano C, Rocchi M, Persico G: Assignment of the vascular endothelial growth factor gene to human chromosome 6p21.3. Circulation. 1996, 93: 1493-1495. 10.1161/01.CIR.93.8.1493.CrossRefPubMed Vincenti V, Cassano C, Rocchi M, Persico G: Assignment of the vascular endothelial growth factor gene to human chromosome 6p21.3. Circulation. 1996, 93: 1493-1495. 10.1161/01.CIR.93.8.1493.CrossRefPubMed
14.
Zurück zum Zitat Watson CJ, Webb NJ, Bottomley MJ, Brenchley PE: Identification of polymorphisms within the vascular endothelial growth factor (VEGF) gene: Correlation with variation in VEGF protein production. Cytokine. 2000, 12: 1232-1235. 10.1006/cyto.2000.0692.CrossRefPubMed Watson CJ, Webb NJ, Bottomley MJ, Brenchley PE: Identification of polymorphisms within the vascular endothelial growth factor (VEGF) gene: Correlation with variation in VEGF protein production. Cytokine. 2000, 12: 1232-1235. 10.1006/cyto.2000.0692.CrossRefPubMed
15.
Zurück zum Zitat de Marqui AB T: Genetic polymorphisms and endometriosis: contribution of genes that regulate vascular function and tissue remodeling. Rev Assoc Med Bras. 2012, 58: 620-632. 10.1590/S0104-42302012000500022.CrossRef de Marqui AB T: Genetic polymorphisms and endometriosis: contribution of genes that regulate vascular function and tissue remodeling. Rev Assoc Med Bras. 2012, 58: 620-632. 10.1590/S0104-42302012000500022.CrossRef
16.
Zurück zum Zitat Liang S, Huang Y, Fan Y: Vascular endothelial growth factor gene polymorphisms and endometriosis risk: a meta-analysis. Arch Gynecol Obstet. 2012, 286: 139-146. 10.1007/s00404-012-2270-1.CrossRefPubMed Liang S, Huang Y, Fan Y: Vascular endothelial growth factor gene polymorphisms and endometriosis risk: a meta-analysis. Arch Gynecol Obstet. 2012, 286: 139-146. 10.1007/s00404-012-2270-1.CrossRefPubMed
17.
Zurück zum Zitat Xu S, Wu W, Sun H, Lu J, Yuan B, Xia Y, De Moor B, Marchal K, Wang X, Xu P, Cheng W: Association of the vascular endothelial growth factor gene polymorphisms (-460C/T, +405G/C and +936 T/C) with endometriosis: a meta-analysis. Ann Hum Genet. 2012, 76: 464-471. 10.1111/j.1469-1809.2012.00726.x.CrossRefPubMed Xu S, Wu W, Sun H, Lu J, Yuan B, Xia Y, De Moor B, Marchal K, Wang X, Xu P, Cheng W: Association of the vascular endothelial growth factor gene polymorphisms (-460C/T, +405G/C and +936 T/C) with endometriosis: a meta-analysis. Ann Hum Genet. 2012, 76: 464-471. 10.1111/j.1469-1809.2012.00726.x.CrossRefPubMed
18.
Zurück zum Zitat Li YZ, Wang LJ, Li X, Li SL, Wang JL, Wu ZH, Gong L, Zhang XD: Vascular endothelial growth factor gene polymorphisms contribute to the risk of endometriosis: an updated systematic review and meta-analysis of 14 case–control studies. Genet Mol Res. 2013, 12: 1035-1044. 10.4238/2013.April.2.20.CrossRefPubMed Li YZ, Wang LJ, Li X, Li SL, Wang JL, Wu ZH, Gong L, Zhang XD: Vascular endothelial growth factor gene polymorphisms contribute to the risk of endometriosis: an updated systematic review and meta-analysis of 14 case–control studies. Genet Mol Res. 2013, 12: 1035-1044. 10.4238/2013.April.2.20.CrossRefPubMed
19.
Zurück zum Zitat Folkman J: Angiogenesis: an organizing principle for drug discovery?. Nat Rev Drug Discov. 2007, 6: 273-286. 10.1038/nrd2115.CrossRefPubMed Folkman J: Angiogenesis: an organizing principle for drug discovery?. Nat Rev Drug Discov. 2007, 6: 273-286. 10.1038/nrd2115.CrossRefPubMed
20.
Zurück zum Zitat Kang S, Zhao J, Liu Q, Zhou R, Wang N, Li Y: Vascular endothelial growth factor gene polymorphisms are associated with the risk of developingadenomyosis. Environ Mol Mutagen. 2009, 50: 361-366. 10.1002/em.20455.CrossRefPubMed Kang S, Zhao J, Liu Q, Zhou R, Wang N, Li Y: Vascular endothelial growth factor gene polymorphisms are associated with the risk of developingadenomyosis. Environ Mol Mutagen. 2009, 50: 361-366. 10.1002/em.20455.CrossRefPubMed
21.
Zurück zum Zitat Nisolle M, Donnez J: Peritoneal endometriosis, ovarian endometriosis, and adenomyotic nodules of the rectovaginal septum are three different entities. Fertil Steril. 1997, 68: 585-596. 10.1016/S0015-0282(97)00191-X.CrossRefPubMed Nisolle M, Donnez J: Peritoneal endometriosis, ovarian endometriosis, and adenomyotic nodules of the rectovaginal septum are three different entities. Fertil Steril. 1997, 68: 585-596. 10.1016/S0015-0282(97)00191-X.CrossRefPubMed
22.
Zurück zum Zitat WHO Expert Committee: Physical status: the use and interpretation of anthropometry. World Health Organ Tech Rep Ser. 1995, 854: 1-452. WHO Expert Committee: Physical status: the use and interpretation of anthropometry. World Health Organ Tech Rep Ser. 1995, 854: 1-452.
24.
Zurück zum Zitat Barrett JC, Fry B, Maller J, Daly MJ: Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 2005, 21: 263-265. 10.1093/bioinformatics/bth457.CrossRefPubMed Barrett JC, Fry B, Maller J, Daly MJ: Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 2005, 21: 263-265. 10.1093/bioinformatics/bth457.CrossRefPubMed
25.
Zurück zum Zitat Ferrero S, Anserini P, Remorgida V, Ragni N: Body mass index in endometriosis. Eur J Obstet Gynecol Reprod Biol. 2005, 121: 94-98. 10.1016/j.ejogrb.2004.11.019.CrossRefPubMed Ferrero S, Anserini P, Remorgida V, Ragni N: Body mass index in endometriosis. Eur J Obstet Gynecol Reprod Biol. 2005, 121: 94-98. 10.1016/j.ejogrb.2004.11.019.CrossRefPubMed
26.
Zurück zum Zitat Hediger ML, Hartnett HJ, Louis GM: Association of endometriosis with body size and figure. Fertil Steril. 2005, 84: 1366-1374. 10.1016/j.fertnstert.2005.05.029.CrossRefPubMedPubMedCentral Hediger ML, Hartnett HJ, Louis GM: Association of endometriosis with body size and figure. Fertil Steril. 2005, 84: 1366-1374. 10.1016/j.fertnstert.2005.05.029.CrossRefPubMedPubMedCentral
27.
Zurück zum Zitat Matalliotakis IM, Cakmak H, Fragouli YG, Goumenou AG, Mahutte NG, Arici A: Epidemiological characteristics in women with and without endometriosis in the Yale series. Arch Gynecol Obstet. 2008, 277: 389-393. 10.1007/s00404-007-0479-1.CrossRefPubMed Matalliotakis IM, Cakmak H, Fragouli YG, Goumenou AG, Mahutte NG, Arici A: Epidemiological characteristics in women with and without endometriosis in the Yale series. Arch Gynecol Obstet. 2008, 277: 389-393. 10.1007/s00404-007-0479-1.CrossRefPubMed
28.
Zurück zum Zitat Parazzini F, Cipriani S, Bianchi S, Gotsch F, Zanconato G, Fedele L: Risk factors for deep endometriosis: a comparison with pelvic and ovarian endometriosis. Fertil Steril. 2008, 90: 174-179. 10.1016/j.fertnstert.2007.05.059.CrossRefPubMed Parazzini F, Cipriani S, Bianchi S, Gotsch F, Zanconato G, Fedele L: Risk factors for deep endometriosis: a comparison with pelvic and ovarian endometriosis. Fertil Steril. 2008, 90: 174-179. 10.1016/j.fertnstert.2007.05.059.CrossRefPubMed
29.
Zurück zum Zitat Pillet MCL, Schneider A, Borghese B, Santulli P, Souza C, Streuli I, Ziegler D, Chapron C: Deep infiltrating endometriosis is associated with markedly lower body mass index: a 476 case–control study. Human Reproduction. 2012, 27: 265-272. 10.1093/humrep/der346.CrossRef Pillet MCL, Schneider A, Borghese B, Santulli P, Souza C, Streuli I, Ziegler D, Chapron C: Deep infiltrating endometriosis is associated with markedly lower body mass index: a 476 case–control study. Human Reproduction. 2012, 27: 265-272. 10.1093/humrep/der346.CrossRef
30.
Zurück zum Zitat Ravussin E, Bogardus C: Energy balance and weight regulation: genetics versus environment. Br J Nutr. 2000, 83: S17-20.CrossRefPubMed Ravussin E, Bogardus C: Energy balance and weight regulation: genetics versus environment. Br J Nutr. 2000, 83: S17-20.CrossRefPubMed
31.
Zurück zum Zitat Kennedy S: Genetics of endometriosis: a review of the positional cloning approaches. Semin Reprod Med. 2003, 21: 111-118.CrossRefPubMed Kennedy S: Genetics of endometriosis: a review of the positional cloning approaches. Semin Reprod Med. 2003, 21: 111-118.CrossRefPubMed
32.
Zurück zum Zitat Renner W, Kotschan S, Hoffmann C, Obermayer-Pietsch B, Pilger E: A common 936 C/T mutation in the gene for vascular endothelial growth factor is associated with vascular endothelial growth factor plasma levels. J Vasc Res. 2000, 37: 443-448. 10.1159/000054076.CrossRefPubMed Renner W, Kotschan S, Hoffmann C, Obermayer-Pietsch B, Pilger E: A common 936 C/T mutation in the gene for vascular endothelial growth factor is associated with vascular endothelial growth factor plasma levels. J Vasc Res. 2000, 37: 443-448. 10.1159/000054076.CrossRefPubMed
33.
Zurück zum Zitat Koukourakis MI, Papazoglou D, Giatromanolaki A, Bougioukas G, Maltezos E, Sivridis E: VEGF gene sequence variation defines VEGF gene expression status and angiogenic activity in non-small cell lung cancer. Lung Cancer. 2004, 46: 293-298. 10.1016/j.lungcan.2004.04.037.CrossRefPubMed Koukourakis MI, Papazoglou D, Giatromanolaki A, Bougioukas G, Maltezos E, Sivridis E: VEGF gene sequence variation defines VEGF gene expression status and angiogenic activity in non-small cell lung cancer. Lung Cancer. 2004, 46: 293-298. 10.1016/j.lungcan.2004.04.037.CrossRefPubMed
34.
Zurück zum Zitat Liu Q, Li Y, Zhao J, Sun DL, Duan YN, Wang N, Zhou RM, Kang S: Association of polymorphisms -1154G/A and -2578C/A in the vascular endothelial growth factor gene with decreased risk of endometriosis in Chinese women. Hum Reprod. 2009, 24: 2660-2666. 10.1093/humrep/dep208.CrossRefPubMed Liu Q, Li Y, Zhao J, Sun DL, Duan YN, Wang N, Zhou RM, Kang S: Association of polymorphisms -1154G/A and -2578C/A in the vascular endothelial growth factor gene with decreased risk of endometriosis in Chinese women. Hum Reprod. 2009, 24: 2660-2666. 10.1093/humrep/dep208.CrossRefPubMed
35.
Zurück zum Zitat Lamp M, Saare M, Laisk T, Karro H, Kadastik U, Metspalu A, Peters M, Salumets A: Genetic variations in vascular endothelial growth factor but not in angiotensin I-converting enzyme genes are associated with endometriosis in Estonian women. Eur J Obstet Gynecol Reprod Biol. 2010, 153: 85-89. 10.1016/j.ejogrb.2010.07.021.CrossRefPubMed Lamp M, Saare M, Laisk T, Karro H, Kadastik U, Metspalu A, Peters M, Salumets A: Genetic variations in vascular endothelial growth factor but not in angiotensin I-converting enzyme genes are associated with endometriosis in Estonian women. Eur J Obstet Gynecol Reprod Biol. 2010, 153: 85-89. 10.1016/j.ejogrb.2010.07.021.CrossRefPubMed
36.
Zurück zum Zitat Rotman C, Fischel L, Cortez G, Greiss H, Rana N, Rinehart J, Coulam CB: A search to identify genetic risk factors for endometriosis. Am J Reprod Immunol. 2013, 69: 92-95. 10.1111/aji.12034.CrossRefPubMed Rotman C, Fischel L, Cortez G, Greiss H, Rana N, Rinehart J, Coulam CB: A search to identify genetic risk factors for endometriosis. Am J Reprod Immunol. 2013, 69: 92-95. 10.1111/aji.12034.CrossRefPubMed
37.
Zurück zum Zitat Coulam CB, Jeyendran RS: Vascular endothelial growth factor gene polymorphisms and recurrent pregnancy loss. Am J Reprod Immunol. 2008, 59: 301-305. 10.1111/j.1600-0897.2007.00515.x.CrossRefPubMed Coulam CB, Jeyendran RS: Vascular endothelial growth factor gene polymorphisms and recurrent pregnancy loss. Am J Reprod Immunol. 2008, 59: 301-305. 10.1111/j.1600-0897.2007.00515.x.CrossRefPubMed
38.
Zurück zum Zitat Lee HH, Hong SH, Shin SJ, Ko JJ, Oh D, Kim NK: Association study of vascular endothelial growth factor polymorphisms with the risk of recurrent spontaneous abortion. Fertil Steril. 2010, 93: 1244-1247. 10.1016/j.fertnstert.2008.11.017.CrossRefPubMed Lee HH, Hong SH, Shin SJ, Ko JJ, Oh D, Kim NK: Association study of vascular endothelial growth factor polymorphisms with the risk of recurrent spontaneous abortion. Fertil Steril. 2010, 93: 1244-1247. 10.1016/j.fertnstert.2008.11.017.CrossRefPubMed
39.
Zurück zum Zitat Muniz JJ, Izidoro-Toledo TC, Metzger IF, Sandrim VC, Tanus-Santos JE: Interethnic differences in the distribution of clinically relevant vascular endothelial growth factor genetic polymorphisms. DNA Cell Biol. 2009, 28: 567-572. 10.1089/dna.2009.0925.CrossRefPubMed Muniz JJ, Izidoro-Toledo TC, Metzger IF, Sandrim VC, Tanus-Santos JE: Interethnic differences in the distribution of clinically relevant vascular endothelial growth factor genetic polymorphisms. DNA Cell Biol. 2009, 28: 567-572. 10.1089/dna.2009.0925.CrossRefPubMed
40.
Zurück zum Zitat Zhao ZZ, Nyholt DR, Thomas S, Treloar SA, Montgomery GW: Polymorphisms in the vascular endothelial growth factor gene and the risk of familial endometriosis. Mol Hum Reprod. 2008, 14: 531-538. 10.1093/molehr/gan043.CrossRefPubMed Zhao ZZ, Nyholt DR, Thomas S, Treloar SA, Montgomery GW: Polymorphisms in the vascular endothelial growth factor gene and the risk of familial endometriosis. Mol Hum Reprod. 2008, 14: 531-538. 10.1093/molehr/gan043.CrossRefPubMed
41.
Zurück zum Zitat Bhanoori M, Arvind Babu K, Pavankumar Reddy NG, Lakshmi Rao K, Zondervan K, Deenadayal M, Kennedy S, Shivaji S: The vascular endothelial growth factor (VEGF) +405G > C 5’-untranslated region polymorphism and increased risk of endometriosis in South Indian women: A case control study. Hum Reprod. 2005, 20: 1844-1849. 10.1093/humrep/deh852.CrossRefPubMed Bhanoori M, Arvind Babu K, Pavankumar Reddy NG, Lakshmi Rao K, Zondervan K, Deenadayal M, Kennedy S, Shivaji S: The vascular endothelial growth factor (VEGF) +405G > C 5’-untranslated region polymorphism and increased risk of endometriosis in South Indian women: A case control study. Hum Reprod. 2005, 20: 1844-1849. 10.1093/humrep/deh852.CrossRefPubMed
42.
Zurück zum Zitat Kim SH, Choi YM, Choung SH, Jun JK, Kim JG, Moon SY: Vascular endothelial growth factor gene +405 C/G polymorphism is associated with susceptibility to advanced stage endometriosis. Hum Reprod. 2005, 20: 2904-2908. 10.1093/humrep/dei146.CrossRefPubMed Kim SH, Choi YM, Choung SH, Jun JK, Kim JG, Moon SY: Vascular endothelial growth factor gene +405 C/G polymorphism is associated with susceptibility to advanced stage endometriosis. Hum Reprod. 2005, 20: 2904-2908. 10.1093/humrep/dei146.CrossRefPubMed
43.
Zurück zum Zitat Ikuhashi Y, Yoshida S, Kennedy S, Zondervan K, Takemura N, Deguchi M, Ohara N, Maruo T: Vascular endothelial growth factor +936 C/T polymorphism is associated with an increased risk of endometriosis in a Japanese population. Acta Obstet Gynecol Scand. 2007, 86: 1352-1358. 10.1080/00016340701644991.CrossRefPubMed Ikuhashi Y, Yoshida S, Kennedy S, Zondervan K, Takemura N, Deguchi M, Ohara N, Maruo T: Vascular endothelial growth factor +936 C/T polymorphism is associated with an increased risk of endometriosis in a Japanese population. Acta Obstet Gynecol Scand. 2007, 86: 1352-1358. 10.1080/00016340701644991.CrossRefPubMed
44.
Zurück zum Zitat Cosín R, Gilabert-Estellés J, Ramón LA, España F, Gilabert J, Romeu A, Estellés A: Vascular endothelial growth factor polymorphisms (-460C/T, +405G/C, and 936C/T) and endometriosis: their influence on vascular endothelial growth factor expression. Fertil Steril. 2009, 92: 1214-1220. 10.1016/j.fertnstert.2008.08.079.CrossRefPubMed Cosín R, Gilabert-Estellés J, Ramón LA, España F, Gilabert J, Romeu A, Estellés A: Vascular endothelial growth factor polymorphisms (-460C/T, +405G/C, and 936C/T) and endometriosis: their influence on vascular endothelial growth factor expression. Fertil Steril. 2009, 92: 1214-1220. 10.1016/j.fertnstert.2008.08.079.CrossRefPubMed
45.
Zurück zum Zitat Liu Q, Li Y, Zhao J, Zhou RM, Wang N, Sun DL, Duan YN, Kang S: Association of single nucleotide polymorphisms in VEGF gene with the risk of endometriosis and adenomyosis. Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 2009, 26: 165-169.PubMed Liu Q, Li Y, Zhao J, Zhou RM, Wang N, Sun DL, Duan YN, Kang S: Association of single nucleotide polymorphisms in VEGF gene with the risk of endometriosis and adenomyosis. Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 2009, 26: 165-169.PubMed
46.
Zurück zum Zitat Attar R, Agachan B, Kuran SB, Toptas B, Eraltan IY, Attar E, Isbir T: Genetic variants of vascular endothelial growth factor and risk for the development of endometriosis. In Vivo. 2010, 24: 297-301.PubMed Attar R, Agachan B, Kuran SB, Toptas B, Eraltan IY, Attar E, Isbir T: Genetic variants of vascular endothelial growth factor and risk for the development of endometriosis. In Vivo. 2010, 24: 297-301.PubMed
47.
Zurück zum Zitat Altinkaya SO, Ugur M, Ceylaner G, Ozat M, Gungor T, Ceylaner S: Vascular endothelial growth factor +405 C/G polymorphism is highly associated with an increased risk of endometriosis in Turkish women. Arch Gynecol Obstet. 2011, 283: 267-272. 10.1007/s00404-009-1344-1.CrossRefPubMed Altinkaya SO, Ugur M, Ceylaner G, Ozat M, Gungor T, Ceylaner S: Vascular endothelial growth factor +405 C/G polymorphism is highly associated with an increased risk of endometriosis in Turkish women. Arch Gynecol Obstet. 2011, 283: 267-272. 10.1007/s00404-009-1344-1.CrossRefPubMed
48.
Zurück zum Zitat Emamifar B, Salehi Z, Mehrafza M, Mashayekhi F: The vascular endothelial growth factor (VEGF) polymorphisms and the risk of endometriosis in northern Iran. Gynecol Endocrinol. 2012, 28: 447-450. 10.3109/09513590.2011.632791.CrossRefPubMed Emamifar B, Salehi Z, Mehrafza M, Mashayekhi F: The vascular endothelial growth factor (VEGF) polymorphisms and the risk of endometriosis in northern Iran. Gynecol Endocrinol. 2012, 28: 447-450. 10.3109/09513590.2011.632791.CrossRefPubMed
49.
Zurück zum Zitat Toktam M, Kioomars SN, Kourosh K, Adel S, Behrokh MM, Mohhamad Mehdi A, Hamid Reza KK: Association of vascular endothelial growth factor (VEGF) +405 g > c polymorphism with endometriosis in an Iranian population. J Reprod Infertil. 2010, 11: 33-37.PubMed Toktam M, Kioomars SN, Kourosh K, Adel S, Behrokh MM, Mohhamad Mehdi A, Hamid Reza KK: Association of vascular endothelial growth factor (VEGF) +405 g > c polymorphism with endometriosis in an Iranian population. J Reprod Infertil. 2010, 11: 33-37.PubMed
50.
Zurück zum Zitat Saliminejad K, Memariani T, Ardekani AM, Kamali K, Edalatkhah H, Pahlevanzadeh Z, Khorram Khorshid HR: Association study of the TNF-α -1031 T/C and VEGF + 450G/C polymorphisms with susceptibility to endometriosis. Gynecol Endocrinol. 2013, 29: 974-977. 10.3109/09513590.2013.824956.CrossRefPubMed Saliminejad K, Memariani T, Ardekani AM, Kamali K, Edalatkhah H, Pahlevanzadeh Z, Khorram Khorshid HR: Association study of the TNF-α -1031 T/C and VEGF + 450G/C polymorphisms with susceptibility to endometriosis. Gynecol Endocrinol. 2013, 29: 974-977. 10.3109/09513590.2013.824956.CrossRefPubMed
51.
Zurück zum Zitat Kim JG, Kim JY, Jee BC, Suh CS, Kim SH, Choi YM: Association between endometriosis and polymorphisms in endostatin and vascular endothelial growth factor and their serum levels in Korean women. Fertil Steril. 2008, 89: 243-245. 10.1016/j.fertnstert.2007.02.023.CrossRefPubMed Kim JG, Kim JY, Jee BC, Suh CS, Kim SH, Choi YM: Association between endometriosis and polymorphisms in endostatin and vascular endothelial growth factor and their serum levels in Korean women. Fertil Steril. 2008, 89: 243-245. 10.1016/j.fertnstert.2007.02.023.CrossRefPubMed
Metadaten
Titel
Role of vascular endothelial growth factor polymorphisms (-2578C > A, -460 T > C, -1154G > A, +405G > C and +936C > T) in endometriosis: a case–control study with Brazilians
verfasst von
Jamila Alessandra Perini
Jessica Vilarinho Cardoso
Plínio Tostes Berardo
Rosane Vianna-Jorge
Luiz Eurico Nasciutti
Marta Bellodi-Privato
Daniel Escorsim Machado
Mauricio Simões Abrão
Publikationsdatum
01.12.2014
Verlag
BioMed Central
Erschienen in
BMC Women's Health / Ausgabe 1/2014
Elektronische ISSN: 1472-6874
DOI
https://doi.org/10.1186/1472-6874-14-117

Weitere Artikel der Ausgabe 1/2014

BMC Women's Health 1/2014 Zur Ausgabe

Hirsutismus bei PCOS: Laser- und Lichttherapien helfen

26.04.2024 Hirsutismus Nachrichten

Laser- und Lichtbehandlungen können bei Frauen mit polyzystischem Ovarialsyndrom (PCOS) den übermäßigen Haarwuchs verringern und das Wohlbefinden verbessern – bei alleiniger Anwendung oder in Kombination mit Medikamenten.

ICI-Therapie in der Schwangerschaft wird gut toleriert

Müssen sich Schwangere einer Krebstherapie unterziehen, rufen Immuncheckpointinhibitoren offenbar nicht mehr unerwünschte Wirkungen hervor als andere Mittel gegen Krebs.

Weniger postpartale Depressionen nach Esketamin-Einmalgabe

Bislang gibt es kein Medikament zur Prävention von Wochenbettdepressionen. Das Injektionsanästhetikum Esketamin könnte womöglich diese Lücke füllen.

Bei RSV-Impfung vor 60. Lebensjahr über Off-Label-Gebrauch aufklären!

22.04.2024 DGIM 2024 Kongressbericht

Durch die Häufung nach der COVID-19-Pandemie sind Infektionen mit dem Respiratorischen Synzytial-Virus (RSV) in den Fokus gerückt. Fachgesellschaften empfehlen eine Impfung inzwischen nicht nur für Säuglinge und Kleinkinder.

Update Gynäkologie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert – ganz bequem per eMail.