The Aplidin analogs PM01215 and PM02781 inhibit angiogenesis in vitro and in vivo

Bortezomib was purchased from Selleckchem and dissolved in DMSO (SIGMA Biochemicals) to a stock solution of 250 mM. Aplidin™ and Aplidin analogs PM01215 and PM02781 were synthesized in Pharmamar and dissolved in DMSO to stock solutions of 250 mM and stored in aliquots at −80 °C. All stocks were further diluted with DMSO to working concentrations of 1 mM and stored at −20 °C. N-acetyl cysteine (NAC, Sigma Biochemicals) was dissolved in distilled sterile water, and 30 % H₂O₂ was purchased from Merck. Thapsigargin was purchased from Life Technologies and dissolved in DMSO (SIGMA Biochemicals) to a stock solution of 1 mM.

Human PBMNCs from healthy donors (n = 3,) were prepared as described elsewhere [16]. In brief, blood samples from blood donors were collected in anticoagulant (EDTA) tubes and transferred to Leucosep® tubes (Greiner Bio-One) containing Ficoll (LSM1077 Lymphocyte separation medium, PAA) for density gradient centrifugation. Thereafter, mononuclear cell faction was washed in PBS, characterized by flow cytometry (size, granularity, CD45+ expression) and used for experiments.

All primary cells were characterized by flow cytometry using a panel of cell type-specific markers (Additional file 1: Table S1) and were tested for the absence of HIV1/2, HBV, HCV and mycoplasma. Only cells of low passages were used for experiments. OPM-2 multiple myeloma cells (AC55) were purchased 2012 directly from DSMZ (Germany), authenticated by us (STR-profiling, flow cytometry: CD138+/CD38+) and cultivated in RPMI1640 medium (Sigma Biochemicals) with 10 % bovine calf serum (Hyclone) and 100 IU/mL penicillin, 100 μg/mL streptomycin and 2 mM glutamine (all PAA Laboratories GmbH) on uncoated plastic material. OPM-2 cells were lentivirally transfected to express eGFP and propagated in the presence of blasticidin (2.5 μg/mL, Invitrogen) before usage for in vivo experiments.

Cells were harvested and lysed in a RIPA buffer (Cell Signaling) containing protease inhibitors (Complete Mini EDTA-free; Roche Applied Science). Total protein (20 μg) was denatured, separated with 4 -20 % SDS-PAGE (Criterion TGX, Bio-Rad) and transferred to an Immuno-Blot™ polyvinylidene difluoride (PVDF) membrane (Bio-Rad). After blocking the membrane in 5 % non-fat milk powder dissolved in phosphate-buffered saline (PBS), membranes were incubated overnight in 3 % non-fat milk powder or 5 % BSA at 4 °C with primary antibodies. Afterwards, membranes were incubated with an HRP-conjugated secondary antibody (Dako Cytomation) diluted 1:2,500. After washing, a chemoluminescent substrate (LumiGLO Reagent and Peroxide, Cell Signaling Technology) was added to the membrane, which was then exposed in the Chemidoc XRS station (Bio-Rad Laboratories). Antibodies used for Western Blot analysis were alpha tubulin (clone B5-1-2; Sigma Biochemicals), p27^Kip1 (clone G173-524, BD Pharmingen) and p53 (clone PAb1801, Calbiochem), p21^Cip1 (BD Biosciences), p16^INK4A (BD Biosciences), VEGF-R2 (Calbiochem), vasohibin (R&D Systems, Clone 411208), GRP78/HSPA5 (R&D Systems, Clone 474421), and XPB1 (SCBT, M-186). Mouse-anti JNK (Santa Cruz Biotechnology, clone D-2), rabbit anti-phospho-p44/42 MAPK (Erk1/2 D13.14.4E), mouse anti-P44/42 MAPK (Erk1/2, clone L34F12), rabbit anti-phospho-Akt (Ser473), rabbit anti-Akt (pan) and rabbit-anti-phospho-JNK (all purchased from Cell Signaling).

Cells were treated for 72 h with 10 nM solution of the respective compounds. For quantitative measurement of DKK-3 in supernatants a commercially available ELISA (human DKK-3 DuoSet; DY1118, R & D Systems) was used according to the manufacturer’s guidelines.

Cells were seeded on collagen-coated eight-well culture slides (Falcon BD Labware) and incubated with 10 nM of Aplidin, PM01215 and PM02781 for 5 h. Living cells were stained with CellRox®Green reagent to monitor intracellular oxidative stress, and nuclei were stained with NucBlue (Molecular Probes, Life Technologies) according to the manufacturer’s protocol. Confocal microscopy was performed with a spinning disc confocal microscopic system (Ultra VIEW VoX; Perkin Elmer, Waltham, MA, USA) that was connected to a Zeiss AxioObserver Z1 inverted microscope (Zeiss). Images were acquired with Velocity software (Perkin Elmer) using a 63x oil immersion objective with a numerical aperture of 1.42.

Cell death was evaluated by human FITC-labeled Annexin V (Enzo^®) and 7-amino-actinomycin D (7-AAD, Beckman Coulter) staining. Therefore, cells were resuspended in 200 μL Annexin V Binding Buffer (Abcam) with 2 μL Annexin V and 2 μL PI (20 μg/mL), incubated for 15 min, washed and resuspended in PBS/ 5 % FCS prior to analysis. Cells were examined in the FACSCalibur (Becton-Dickinson, Heidelberg, Germany). Cell cycle analysis was performed with the Coulter DNA PREP Reagent kit (Beckman Coulter).

Primary cells were all characterized by staining with a panel of antibodies and flow cytometric analysis (Additional file 1: Table S1). Therefore, we used anti-human EpCAM/TROP1 Phycoerythrin MAb (Clone 158206), anti-human CD31/PECAM-1 APC MAb (Clone 9G11), anti-human VEGF R2/KDR Phycoerythrin MAb (Clone 89106), anti-human CD45 PerCP MAb (Clone 2D1) and anti-human CD14 Fluorescein MAb (Clone 134620, all from R&D systems).

Total RNA was isolated from HUVECs using TRI Reagent (Sigma -Aldrich), according to the manufacturer’s instructions. RNA was purified by cell lyses and nucleic acid extraction using the RNeasy Kit (Qiagen). Thereafter, genomic DNA in the RNA samples was digested with the RQ1 DNAse (Promega). The cDNA was amplified from 1 μg total RNA using the SuperScript II Reverse Transcriptase Kit (Invitrogen Life Technologies). For validation, real time RT-PCR was performed using a SensiMix SYBR No-ROX Kit (Bioline) and a Rotor-Gene 6000 detection system (Corbett Research). Primers were designed to amplify specific GAPDH (for: 5-ctgacctgccgtctagaaaa; rev: 5-gagcttgacaaagtggtcgt), TATA Box Binding Protein (for: 5-ggagccaagagtgaagaaca; rev: 5-agcacaaggccttctaacct), DKK3 (for: 5- tcatcacctgggagctagag, rev: 5-caacttcatactcatcgggg); VASH1 (for: 5-agatccccataccgagtgtg, rev: 5-gggcctctttggtcatttcc), p16^INK4A (for 5-caacgcaccgaatagttacg, rev: 5-agcaccaccagcgtgtc), p27^KIP1 (for 5-gccctccccagtctctctta, rev: 5-tcaaaactcccaagcacctc), TP53 (for 5-gttccgagagctgaatgagg, rev: 5-ttatggcgggaggtagactg), X-Box Binding Protein 1 XBP1u (for: 5- agtccgcagcactcagac; rev: 5-gaactgggtccttctgggtag) XBP1s (for: 5- agtccgcagcaggtgcaggc; rev: 5-gaactgggtccttctgggtag), HSP5A (for: 5-ctcgactcgaattccaaaga; rev: 5-aaggggacatacatcaagca), and DDIT3 (CHOP) gene (for: 5-cctcctggaaatgaagaggaaga; rev: 5-tcctggttctcccttggtct).

Real time cell proliferation experiments were performed using the RTCA DP instrument (Roche Diagnostics GmbH), which was placed in a humidified incubator maintained at 5 % CO₂ and 37 °C. For proliferation assays, cells were seeded in complete medium in 16-well plates (E-plate 16, Roche Diagnostics GmbH) at a density of 2000 cells/well after coating with 10 μg/mm² fibronectin (Sigma Biochemicals). The plate containing gold microelectrodes on its bottom was monitored every 10 min for 4 h (adhesion process), then once every 30 min, until the end of experiment, for a total of 72 h. Data analysis was performed using RTCA software 1.2 supplied with the instrument.

Cells were incubated for 12 h with 10 nM of the respective compounds. To analyze tube formation, 24-well plates were coated with 200 μL growth factor-reduced matrigel (BD Biosciences). HUVECs were resuspended in 200 μL EGM-2 medium (1 × 10⁵ cells) containing 10 nM of the respective compound and placed on top of the polymerized matrix; tube formation was observed after 6 hours. Tubes were viewed under an inverted transmission microscope (Zeiss Axiovert 200 M) and documented with a digital imaging system (Axiovision Software, Zeiss).

For sprouting assays HUVEC spheroids were generated overnight in hanging-drop culture consisting of 400 cells in EBM-2 medium, 2 % FCS and 20 % methylcellulose (Sigma Biochemicals). Spheroids were embedded in collagen type I from rat tail (Becton Dickinson) and stimulated with 50 ng/ml VEGF (Sigma Biochemicals) in the presence or absence of compounds or control substances (DMSO, bortezomib). Sprouts were also analyzed by inverted transmission-microscopy (Zeiss Axiovert 200 M) and documented by a digital imaging (Axiovision Software, Zeiss). The cumulative sprout length (CSL) was analyzed after printing of high quality pictures and counting by two independent blinded observers.

Fertilized chicken eggs (Gallus domesticus, Charles River) were placed in a 75–80 % humidified 37 °C incubator (Grumbach) to allow normal embryo development. On day three eggs were opened, egg shells removed and embryos were placed in a sterile Petri dish in an egg incubator to induce CAM development. On day 8, when CAM and its vasculature were well developed, all experiments were performed. Subsequently, two rings per chicken were grafted on the CAM. Drugs (10 nmol/ring) with VEGF (1 μg/ring) or drugs alone were applied every second day at the center of Permanox™ rings.

On day 6 post-grafting chicken embryos were sacrificed by hypothermia, blood vessels in the ring area were photographed by stereo microscope (Olympus SZW 10) and vessel density was determined by counting with Photoshop CS4 (Adobe).

OPM-2^eGFP multiple myeloma cells (2.5 × 10⁵) were mixed with rat-tail collagen and human mesenchymal stromal cells (0.5 × 10⁵) and the 1 nmol of the respective compounds. Collagen drops (30 μl) were placed on parafilm for 30 min to allow polymerization of the extracellular matrix at 37 °C. Then onplants were transferred to the CAM of 7-day-old chick embryos. After 5 days of in vivo growth, onplants were documented by the Olympus SZX10 stereomicroscope (Olympus) equipped with an Olympus DFPL 2-4x objective lens connected with a digital camera (Olympus E410) and flexible cold light (KL200; Olympus). Excised xenografts were transferred into 0.5 ml RIPA Buffer (Sigma Aldrich, Linz, Austria) and homogenized with an Ultra Turrax homogenizer three times for 5 s on ice. Thereafter, homogenate underwent three freezing/thawing-cycles in liquid nitrogen and 37 °C water bath. After centrifugation, supernatants were diluted in assay buffer. GFP levels were measured by Cell Biolabs’ GFP ELISA Kit (San Diego, CA, USA), using biotinylated anti-GFP antibodies, according to the manufacturer’s protocol.

Cells were fixed (2 % formaldehyde, 0.2 % glutaraldehyde in PBS) for 5 min at room temperature and rinsed several times in PBS. To measure SA-β-gal activity, cells were incubated in a staining solution (4.2 mM citric acid, 12.5 mM sodium phosphate, 158 mM sodium chloride, 0.21 mM magnesium chloride, 2.21 mg/ml potassium ferrocyanide, 1.68 mg/ml potassium ferricyanide, 1 mg/ml X-Gal, pH 6.0) at 37 °C for 24 h. Cells were washed and embedded in PBS, viewed in an inverted transmission microscope and photographed (Zeiss Axiovert 200, Axiovision software).

Statistical analyses were performed with the GraphPad Prism™ software for Windows. Unpaired t-test was used to study differences between the means of one treatment group and control. The average scores across treated groups were not compared. Statistical analyses of quantitative PCR data were performed according to the delta Ct method described by Pfaffl et al. [17].

Testing more than 200 different analogs by Pharmamar in direct comparison to the original compound on tumor cell lines (Patent WO 2002002596) revealed two compounds with similar in vitro activity and more easy chemical synthesis than Aplidin™ (Fig. 1).

PM01215 and PM02781 were tested on HUVECs (n = 3) in the real-time proliferation system (xCELLigence, Roche Diagnostics) for effects on proliferation and cell numbers. As expected, incubation with 1 nM Aplidin™ completely stopped cell proliferation and 5 and 10 nM already induced apoptosis (Fig. 2a). Both Aplidin analogs showed less inhibition of cell proliferation after 3 days when tested in direct comparison to Aplidin at 1 nM (19.6 ÷.6.5 % cell index for Aplidin™ versus 84.8 ÷ 8.4 % for PM01215 or 62.3 ÷ 7.1 % for PM02781). Concentrations of 10 nM displayed similar activities on inhibition of cell growth after 3 days as the original compound Aplidin™ (10.0 ÷.2.7 % cell index for Aplidin™ versus 17.4 ÷ 4.9 % for PM01215 or 15.6 ÷ 2.2 % for PM02781). In comparison to both analogs, 10 nM Aplidin already induced visible signs of apoptosis and detachment of cells after 72 h.

With regard to induction of apoptosis on human primary endothelial cells, both new Aplidin analogs are less toxic than the original Aplidin™ (Table 1 and Fig. 2b) when used at 10 nM for 72 h (50.3 ÷.6.7 % cell viability for Aplidin™ versus 89.3 ÷ 3.0 % for PM01215 or 85.3 ÷ 6.3 % for PM02781).

Cell cycle analysis by staining with propidium iodide revealed that Aplidin derivatives (10 nM) induced arrest of endothelial cells in G1 phase (Table 2). In comparison to untreated cells the S phase fraction of cells (14.9 ± 1.4 %) was significantly reduced after PM01215 (3.7 ± 1.0 %) and PM02781 (3.4 ± 0.8 %) treatment. Simultaneously, the G1 phase fraction increased from 42.3 ± 2.5 % (control) to 61.1 ± 1.7 % (PM01215) or 61.8 ± 1.0 % (PM02781).

Aplidin™ has been reported to induce cell death by oxidative stress [10]. Therefore, we tested both Aplidin analogs with CellRox®Green, a fluorogenic probe for measuring oxidative stress in living cells. The cell-permeant dye is weakly fluorescent while in a reduced state and exhibits bright green photostable fluorescence upon oxidation with reactive oxygen species (ROS). Aplidin derivatives induced ROS already 5 h after incubation. ROS was effectively blocked by adding 25 μM N-acetyl-cysteine (NAC) as antioxidant to the culture medium (Fig. 3a). Furthermore, we analyzed them in a real-time proliferation system in direct comparison to H₂O₂, a known inductor of ROS, and attempted to rescue cells by adding NAC to culture medium (Fig. 3b). Growth of endothelial cells was inhibited by 20–30 μM H₂O₂. Proliferation of H₂O₂-treated cells was significantly increased by adding NAC (25 μM) to the culture supernatant. Aplidin analog-treated cells (10 nM each) could not be stimulated for proliferation, even after incubation with the antioxidant NAC, indicating a terminal growth arrest.

Aplidin analogs were tested for direct effects on phosphorylation of stress (JNK) and mitogenic (ERK) and survival kinases (AKT). In comparison to DMSO–treated endothelial cells, Aplidin analog–treated cells (each 10 nM, n = 3) showed no significantly altered phosphorylation of prosurvival kinases upon stimulation with EGM2 medium containing mitogenic growth factors such as VEGF and bFGF. Aplidin analogs did not increase phosphorylation of ERK 20 min after mitogenic stimulation (Fig. 3c). The pro-survival AKT (Protein Kinase-B) was not affected after treatment of endothelial cells with PM01215 and PM02781. In comparison to DMSO treated cells, PM01215 and PM02781 were significantly increasing JNK-phosphorylation in endothelial cells 5 min after mitogenic stimulation (Fig. 3c).

Aplidin analogs induced growth arrest in endothelial cells by induction of p16 ^INK4A gene expression (Fig. 4a) already 24 h after incubation. Bortezomib (5 nM) did not affect p16 ^INK4A gene levels. Western Blot analysis after 72 h confirmed that p16 protein was induced by Aplidin and analogs, whereas bortezomib-treated cells were already apoptotic and showed degradation of cellular protein (Fig. 4b). Bortezomib significantly elevated p27 ^Kip1 gene expression, but had no effect on TP53 gene expression 24 h after stimulation (Fig. 4a). Aplidin analogs did not affect TP53 or p27 ^Kip1 gene expression (Fig. 4a). As expected from its proteasome inhibitory property, bortezomib (5 nM) increased p53 and p21 protein in endothelial cells after 24 h of incubation (Fig. 4c). Aplidin analogs did not affect p53, p21 or p27 protein levels 24 h after incubation (Fig. 4c) or 72 h after stimulation (data not shown).

Since oxidative stress brings on premature senescence in primary cells, we analyzed the effects of PM01215 and PM02781 for induction of growth arrest by staining for senescence-associated β-galactosidase activity (SA-β-gal) after three days of incubation. In comparison to untreated control cells, Aplidin analogs (10 nM each) significantly increased the number of SA- β -gal positive cells (Fig. 4d).

Beside the analysis of oxidative stress and senescence we wanted to analyze effects of Aplidin and its analogs on induction of endoplasmatic reticulum (ER) stress and activation of unfolded protein response (UPR). Therefore we compared UPR responses in direct comparison to 10 nM thapsigargin, a strong inducer of UPR on human endothelial cells. Three different branches of UPR, the master regulator GRP78/HSP5A, the IRE1α/XPB1 s and PERK/CHOP/DDIT3 pathway were analyzed on gene expression level. Bortezomib, Aplidin and analogs did not induce HSP5A gene expression and splicing of XPB1 within 24 h (Fig. 5a/b). Only thapsigargin was able to increase GRP78 and XPB1 s protein as analyzed by Western Blot after 72 h (Fig. 5c). DDIT3/CHOP was significantly elevated on gene expression in bortezomib, Aplidin and analog-treated cells, but not in such a massive response as in thapsigargin-treated control cells (Fig. 5d).

Vascular maturation processes support mural cell coverage as well as capillary tube formation and are controlled by paracrine factors released by endothelial cells [18-21]. Therefore, we analyzed whether Aplidin analogs affect expression and release of Vasohibin-1 (VEGF target gene) and Dickkopf-3 protein. While bortezomib (5 nM) did not significantly alter VASH1 expression in endothelial cells after 24 h (n = 3; Fig. 5e), VASH1 gene expression was significantly reduced after stimulation with Aplidin™ (5 nM) and its analogs (10 nM each). We also detected a downregulation of KDR (VEGFR2) protein expression in endothelial cells 24 h after stimulation with bortezomib or Aplidin analogs (Fig. 5e). Moreover, all antiangiogenic drugs tested significantly reduced Dickkopf-3 release into culture medium 24 h after incubation (Fig. 5f).

Antiangiogenic effects of the Aplidin derivatives were tested in vitro in functional 3D assays inducing capillary tube formation and generation of sprouts from endothelial spheroids. Tube formation of HUVECs (n = 3) in matrigel was inhibited by Aplidin™ (5 nM) and Aplidin derivatives (10 nM each, Fig. 6a). DMSO (0.1 %) served as negative control and bortezomib (5 nM) as positive control for inhibition of capillary tube formation.

In addition, HUVECs (n = 3) were cultured as spheroids in hanging drops for 24 h. Thereafter, spheroids were seeded into methylcellulose/collagen type I matrix together with 100 ng/mL VEGF and drugs (Fig. 6b). In comparison to 0.1 % DMSO (control) Aplidin™ and analogs significantly inhibited angiogenic sprouting at concentrations of 1 and 10 nM.

Antiangiogenic effects of Aplidin derivatives were also tested in vivo in CAM after repeated topical application of 1 nmol of the drugs to Permanox™ rings with or without recombinant human VEGF (1 μg/ring; Fig. 7a). As expected, VEGF induced a strong angiogenic reaction that was efficiently blocked by simultaneous application of both Aplidin analogs (n = 6 for each group of animals, Fig. 7b). Moreover, we observed significant inhibition of spontaneous neovascularization in CAM (Fig. 7b). These data indicate that both analogs have antiangiogenic activities at sublethal concentrations in chicken embryos.

In addition, PM01215 and PM02781 were tested in a human multiple myeloma xenograft model in the chicken. The human myeloma cells OPM-2^eGFP were grafted together with human mesenchymal cells and collagen-type-I matrix on the CAM of chicken embryos.

Both, PM01215 and PM02781, significantly inhibited blood vessel formation adjacent to tumor grafts 5 days after incubation (Fig. 8a). Tumor cell mass was quantified by measuring the transgene GFP in myeloma cells in an ELISA after homogenization of tumors with adjacent host tissue. In comparison to control tumors, PM01215 and PM02781 treated grafts displayed significantly less tumor mass and cell growth (Fig. 8b). This strong reduction of tumor growth was also due to apoptosis of OPM-2 cells in the graft at these high concentrations (1 nmol). OPM-2 myeloma cells undergo apoptosis at high concentrations of Aplidin and analogs (Additional file 2: Table S2).

According to the Austrian law no local ethical approval is required for commercially available human primary cells. According to the Office of Laboratory Animal Welfare of the US public health service avian embryos are not considered live vertebrate animals until hatching. The NIH Office of Laboratory Animal Welfare has provided written guidance in this area (http://​www.​grants.​nih.​gov/​grants/​olaw/​references/​ilar91.​htm and NIH Publication No.: 06–4515). Residual blood samples from volunteers were used after obtaining written informed consent of healthy donors for scientific research projects. From the local ethic commission of the Medical University of Innsbruck (UN4012) we have a permission to use anonymized, voluntarily donated peripheral blood as controls. This is now stated in the ethics paragraph on page 18, line 458.