Skip to main content
Erschienen in: Gut Pathogens 1/2016

Open Access 01.12.2016 | Research

Zonula occludens toxins and their prophages in Campylobacter species

verfasst von: Fang Liu, Hoyul Lee, Ruiting Lan, Li Zhang

Erschienen in: Gut Pathogens | Ausgabe 1/2016

Abstract

Background

We previously showed that zonula occludens toxin (Zot) encoded by Campylobacter concisus zot 808T gene has the potential to initiate inflammatory bowel disease. This Zot protein caused prolonged intestinal epithelial barrier damage, induced intestinal epithelial and macrophage production of tumor necrosis factor-α and enhanced the responses of macrophages to other microbes. In order to understand the potential virulence of Zot proteins in other Campylobacter species, in this study we examined their presence, similarities, motifs and prophages.

Methods

The presence of Zot proteins in Campylobacter species was examined by searching for the Zot family domain in multiple protein databases. Walker A and Walker B motifs in Zot proteins were identified using protein sequence alignment. A phylogenetic tree based on Campylobacter zot genes was constructed using maximum-likelihood method. Campylobacter Zot proteins were compared using protein sequence alignment. The zot-containing prophages in Campylobacter species were identified and compared with known prophage proteins and other viral proteins using protein sequence alignment and protein BLAST.

Results

Twelve Zot proteins were found in nine Campylobacter species/subspecies. Among these Campylobacter species, three species had two Zot proteins and the remaining six species/subspecies had one Zot protein. Walker A and Walker B motifs and a transmembrane domain were found in all identified Campylobacter Zot proteins. The twelve Campylobacter zot genes from the nine Campylobacter species/subspecies formed two clusters. The ZotCampyType_1 proteins encoded by Cluster 1 Campylobacter zot genes showed high similarities to each other. However, ZotCampyType_2 proteins encoded by Cluster 2 Campylobacter zot genes were more diverse. Furthermore, the zot-containing Campylobacter prophages were identified.

Conclusion

This study reports the identification of two types of Campylobacter Zot proteins. The high similarities of ZotCampyType_1 proteins suggest that they are likely to have similar virulence. ZotCampyType_2 proteins are less similar to each other and their virulent properties, if any, remain to be examined individually.
Begleitmaterial
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​s13099-016-0125-1) contains supplementary material, which is available to authorized users.
Abkürzungen
IBD
inflammatory bowel disease
Zot
zonula occludens toxin
ZotCampyType_1
Campylopbacter Zot protein encoded by Cluster 1 zot gene
ZotCampyType_2
Campylopbacter Zot protein encoded by Cluster 2 zot gene
p-loop NTPase
p-loop containing nucleoside triphosphate hydrolase

Background

Campylobacter concisus is a Gram-negative spiral shaped motile bacterium [1]. Their growth under both anaerobic and microaerobic conditions is largely determined by the presence of H2 [2]. This bacterium usually colonizes the human oral cavity [3, 4]. However, it may also colonize the intestinal tract of some individuals and its prevalence in intestinal biopsies has been associated with human inflammatory bowel disease (IBD) [59]. Translocation of C. concisus from the oral cavity to intestinal tract has been suggested to be a cause of a subgroup of IBD [10]. Campylobacter concisus has also been suggested to be involved in diarrheal disease due to the frequent isolation of this bacterium from diarrheal stool samples [8, 1113].
Campylobacter concisus zonula occludens toxin (Zot) is encoded by the zot gene located in CON_phi2 prophage [14, 15]. The zot genes in different C. concisus strains have polymorphisms [14]. In a recent study, we examined the effects of C. concisus Zot encoded by zot 808T gene on human intestinal epithelial cells and macrophages using cell line models. In that study, we found that C. concisus Zot caused prolonged intestinal epithelial barrier damage, induced intestinal epithelial and macrophage production of proinflammatory cytokines such as tumor necrosis factor-α, and enhanced the responses of macrophages to Escherichia coli [16]. These data suggest that C. concisus Zot may play a role in initiating chronic intestinal inflammatory conditions such as IBD through damaging the intestinal barrier and enhancing the immune responses to luminal microbes.
In addition to C. concisus, four additional Campylobacter species including Campylobacter ureolyticus, Campylobacter corcagiensis, Campylobacter gracilis and Campylobacter iguaniorum were recently reported to possess the zot gene [1721]. The similarities of Zot proteins in different Campylobacter species have not been examined. In this study, we examined Zot proteins and their genes in Campylobacter species, which revealed two clusters of Campylobacter zot genes and two types of Campylobacter Zot proteins. Furthermore, we identified the prophages that contain zot genes in Campylobacter species.

Methods

Examination of the presence of Zot proteins in Campylobacter species

The presence of Zot proteins in Campylobacter species was examined by searching for proteins in Campylobacter species that have the Zot family domain in multiple protein databases including NCBI protein database, InterPro and Pfam [2224]. The Zot proteins in these databases were annotated based on the presence of Zot family domain.

Examination of the presence of Walker A and Walker B in Campylobacter Zot proteins

It is shown in the InterPro database that the Zot family proteins (InterPro entry identity: IPR008900) belong to p-loop containing nucleoside triphosphate hydrolase (p-loop NTPase) superfamily. The proteins of p-loop NTPase superfamily have Walker A and Walker B motifs [25]. In this study, we examined the presence of Walker A and Walker B motifs in Campylobacter Zot proteins by protein alignment using Clustal Omega software [26]. The Walker A motif has a sequence of GxxxxGK[S/T], where x is any residue and the Walker B motif has a sequence of hhhh[D/E], where h is a hydrophobic residue [25].

Generation of a phylogenetic tree based on zot genes in Campylobacter species

To examine the genetic relationship between the zot genes in different Campylobacter species, the nucleotide sequences of the zot genes in Campylobacter species identified above were obtained from NCBI genome database. These sequences were used to generate a phylogenetic tree using the maximum likelihood method implemented in molecular evolutionary genetics analysis software version 6.0 [27]. In order to differentiate the zot genes in different Campylobacter species, the zot genes found in different Campylobacter species were indicated by the last four digits of their locus tag numbers.

Comparison of zot-containing prophages in Campylobacter species

To examine whether the zot genes in different Campylobacter species are carried by prophages similar to that in C. concisus, the zot-containing prophages in these Campylobacter species were identified by examination of the genes adjacent to their zot genes. The prophages were defined based on the presence of integrase, hypothetical proteins and attachment sites [28]. The attachment sites were identified by the presence of repetitive sequences located at both ends of the prophages [28].
The proteins in the identified Campylobacter prophages in this study were compared with the corresponding proteins in C. concisus prophages CON_phi2 and CON_phi3. The comparison was performed using Clustal Omega [26]. Proteins sharing more than 40 % sequence identity were considered to have high similarities and were recorded [29].

Comparison of the proteins of zot-containing prophages in Campylobacter species with other viral proteins

To examine whether the zot containing prophages identified in Campylobacter species are similar to previously reported prophages, proteins of Campylobacter prophages were compared with viral proteins in the NCBI non-redundant protein sequence database (taxonomy identity for viruses: 10,239) using protein BLAST with default settings [22]. The identified viral proteins with E-values lower than 10 were noted. For prophage proteins which shared sequence similarities with multiple viral proteins, the viral proteins with the lowest E-values were noted. The full length sequences of the identified viral proteins were then aligned with the Campylobacter prophage proteins using Clustal Omega [26]. The protein identities were calculated by dividing the number of identical amino acids by the total number of amino acids in proteins from Campylobacter prophages. The Campylobacter prophage proteins were also compared with viral proteins in the virus pathogen database and analysis resource (ViPR) using BLAST with a cut-off E-value of 10. In addition to C. concisus, the zot gene was also found in other bacterial species such as Vibrio cholerae and Neisseria meningitis [30, 31]. The identities between Campylobacter Zot, V. cholerae Zot and N. meningitidis Zot proteins were also compared in this study.

Prediction of secreted proteins and transmembrane proteins in Campylobacter prophages

Secreted proteins in zot-containing prophages in different Campylobacter species were predicted using SignalP 4.1 and SecretomeP 2.0. The software SignalP 4.1 predicts secreted proteins based on the presence of the signal peptide at the N-terminus [32]. The software SecretomeP 2.0 predicts non-classical (not signal peptide triggered) protein secretion based on analysis of post-translational and localizational aspects of the proteins [33]. Transmembrane proteins were predicted using the software Phobius [34].

Results

The Zot proteins in different Campylobacter species and their Walker A and Walker B motifs

Twelve Zot proteins were found in nine Campylobacter species/subspecies. Three Campylobacter species including C. concisus, C. ureolyticus and C. corcagiensis had two Zot proteins and the remaining six Campylobacter species/subspecies including C. gracilis, Campylobacter jejuni subsp. doylei, Campylobacter jejuni subsp. jejuni, Campylobacter hyointestinalis subsp. hyointestinalis, C. hyointestinalis subsp. lawsonii and C. iguaniorum had one Zot protein (Table 1).
Table 1
Zot proteins in Campylobacter species/subspecies
Campylobacter species/subspecies
Strain
Number of Zot proteins
Locus tag
Source of isolation
Reference
C. concisus
13826
2
CCC13826_2276
CCC13826_0191
Human faeces
Gb0000058a
C. ureolyticus
DSM 20703
2
C512_RS0103935
C512_RS0100745
Human amniotic fluid
[35]
C. corcagiensis
CIT045
2
BG71_RS0106485
BG71_RS0104620
Lion-tailed macaques faeces
[36]
C. gracilis
RM3268
1
CAMGR0001_2456
Human oral cavity
Gb0003988a
C. jejuni ssp. doylei
269.97
1
JJD26997_0348
Human blood
Gb0000076a
C. jejuni ssp. jejuni
60004
1
CJE11_RS08060
Chicken
SAMN02429007@
C. hyointestinalis ssp. hyointestinalis
DSM 19053
1
CR67_01870
Porcine intestine
SAMN01176354@
C. hyointestinalis ssp. lawsonii
CCUG 27631
1
CHL_RS06765
Porcine intestine
[37]
C. iguaniorum
RM11343
1
CIG11343_RS03950
Alpaca faeces
[21]
aGenome online database project ID. @NCBI Biosample ID
The Zot family domains were localized at the N-terminal side of the identified Campylobacter Zot proteins, prior to the transmembrane domains. The Zot family proteins had p-loop NTPase domains and the entry identity for p-loop NTPase domain was IPR027417 in InterPro database. We identified the Walker A and Walker B motifs in Campylobacter Zot proteins, which were at the N-terminal side of the Zot proteins (Fig. 1).

The phylogenetic tree formed based on zot genes in Campylobacter species

The Campylobacter zot genes formed two clusters. Cluster 1 contained three zot genes, including C. concisus zot2276, C. ureolyticus zot3935 and C. corcagiensis zot6485. Cluster 2 contained nine Campylobacter zot genes (Fig. 2).

Comparison of ZotCampyType_1 and ZotCampyType_2 proteins

The Zot proteins encoded by Cluster 1 and Cluster 2 Campylobacter zot genes were referred to as ZotCampyType_1 and ZotCampyType_2 proteins respectively. The three ZotCampyType_1 proteins had high similarities; they shared 171 identical amino acids and 77 conservative mutations (Fig. 3). The ZotCampyType_2 proteins were less similar to each other as compared to ZotCampyType_1 proteins; they had 71 identical amino acids and 65 conservative mutations (Fig. 4).

The zot-containing prophages in different Campylobacter species and their similarities to C. concisus prophages CON_phi2 or CON_phi3

We identified the zot-containing prophages in different Campylobacter species. Each of these prophages began with an integrase and had a number of hypothetical proteins (Fig. 5; Additional file 1). The attachment sites were found (Table 2). These prophages were inserted within either tRNA-Met or tRNA-Ser genes, except for URE_phiZB, which was inserted into tRNA-Leu gene (Table 2). For the prophage in C. iguaniorum, two tRNA genes were found after the integrase, suggesting that multiple insertions have occurred.
Table 2
The attachment sites of zot-containing Campylobacter prophages
Prophage
Starta
Enda
Attachment gene sequenceb
tRNA (locus_tag)
CON_phi1, CON_phi2 and CON_phi3
(C. concisus 13826)c
1582286
1582311
TTCAAATCCCTCTCTGTCCGCCACCA
tRNA-Ser (CCC13826_RS07905)
1587508
1587533
TTCAAATCCCTCTCTGTCCGCCACCA
 
1597113
1597138
TTCAAATCCCTCTCTGTCCGCCACCA
 
1606718
1606743
TTCAAATCCCTCTCTGTCCGCCACCA
 
1616160
1616185
TTCAAATCCCTCTCTGTCCGCCACCA
 
CON_phi4
(C. concisus 13826)
946941
946993
CTCATAACCCGAAGGTCGGCGGTTCAA
ATCCGTCCTCCGCAACCAAATACCGA
tRNA-Met (CCC13826_RS04780)
937290
937342
CTCATAACCCGAAGGTCGGCGGTTCAA
ATCCGTCCTCCGCAACCAAATACCGA
 
URE_phiZA
(C. ureolyticus
DSM 20703)
68067
68122
ATAACCCGAAGGTCGGAGGTTCAAGTCCT
TCCTCTGCAACCAAATCACCATTTTAC
tRNA-Met (C512_RS0103965)
57811
57866
ATAACCCGAAGGTCGGAGGTTCAAGTCCT
TCCTCTGCAACCAAATCACCATTTTAC
 
URE_phiZB
(C. ureolyticus
DSM 20703)
139564
139610
GTTCAAGTCTCGCTGATCGCACCATTA
AAGAAAAAATTAAGAATACT
tRNA-Leu (C512_RS0100765)
130103
130149
GTTCAAGTCTCGCTGATCGCACCATTA
AAGAAAAAATTAAGAATACT
 
COR_phiZA
(C. corcagiensis
CIT045)
254051
254088
CGAAGGTCAGGGGTTCAAGTCCCTTCT
CTGCAACCAAA
tRNA-Met
(SA94_RS06290)
265302
265339
CGAAGGTCAGGGGTTCAAGTCCCTTCT
CTGCAACCAAA
 
COR_phiZB
(C. corcagiensis
CIT045)
257240
257264
GTTCAAATCCCTCTCTGTCCGCCAC
tRNA-Ser
(SA94_RS04510)
247319
247343
GTTCAAATCCCTCTCTGTCCGCCAC
 
GRACI_phiZ
(C. gracilis
RM3268)
112826
112871
CTCATAACCCGAAGGTCGGTGGTTCAA
ATCCACCCTCTGCAACCAA
tRNA-Met (CAMGR0001_2931)
102518
102563
CTCATAACCCGAAGGTCGGTGGTTCAA
ATCCACCCTCTGCAACCAA
 
DOYLEI_phiZ
(C. jejuni subsp. doylei 269.97)
303215
303241
AGGGTTCAAATCCCTCTCTGTCCGCCA
tRNA-Ser (JJD26997_RS01570)
313165
313191
AGGGTTCAAATCCCTCTCTGTCCGCCA
 
HYO_phiZ
(C. hyointestinalis subsp. hyointestinalis
DSM 19053)
360409
360446
CTCATAACCCGAAGGTCGGAGGTTCAA
GTCCTTCTCTC
tRNA-Met
(CR67_RS01810)
369716
369753
CTCATAACCCGAAGGTCGGAGGTTCAA
GTCCTTCTCTC
 
HYO_phiZ
(C. hyointestinalis subsp. lawsonii
CCUG 27631)
1283134
1283238
CTCATAACCCGAAGGTCGGAGGTTCAAGT
CCTTCTCTCGCAACCAAATAAGCATAAAA
TCATCTTTTAAAGCACATTGTTTTAAAGCT
TAAAATAATCTTACTTT
tRNA-Met
(CHL_RS06785)
1273720
1273824
CTCATAACCCGAAGGTCGGAGGTTCAAGT
CCTTCTCTCGCAACCAAATAAGCATAAAA
TCATCTTTTAAAGCACATTGTTTTAAAGCT
TAAAATAATCTTACTTT
 
aThe start and end positions for the attachment sites refer to the nucleotide position within the contig containing the prophage genomes, except for C. concisus strains 13826, C. jejuni subsp. doylei 269.97 and C. hyointestinalis subsp. lawsonii CCUG 27631 which refer to the nucleotide position in the full genome
bAttachment sites overlapped with 3′ end of tRNA, the overlapped sequences were italic
cMultiple insertion sites for CON_phi prophages in C. concisus 13826 in which only the first attachment site (for CON_phi1) overlapped with tRNA. In NCBI database, the contig encoding JEJUNI_phiZ did not cover the full prophage genome; therefore it was unable to locate the attachment sites. No attachment site was identified in IGUA_phiZ
Prophages containing ZotCampyType_1 proteins had high similarities to CON_phi2. Eight proteins in URE_phiZA and nine proteins in COR_phiZA were found to have more than 40 % identities (41-73 %) with proteins in CON_phi2 (Fig. 5a; Additional file 1). Proteins in prophages containing ZotCampyType_2 proteins were more diverse. However, three to five proteins in these prophages had more than 40 % identities with that in CON_phi3 (40–72 %) (Fig. 5b; Additional file 1).

The similarities between proteins in Campylobacter prophages and viral proteins

The zot-containing Campylobacter were compared with known viral proteins in NCBI non-redundant protein sequence database. The proteins within each individual prophage showed low similarities to multiple phage proteins, except for CCC13826_0188 in CON_phi3 that shared 43 % identity with a phage transferase from an uncultured phage (Additional file 2). The Zot proteins in Campylobacter prophages had low similarities with the Zot proteins in V. cholerae and N. meningitidis (15–21 %) (Additional files 3, 4). None of the Campylobacter prophage proteins shared significant similarities with viral proteins in ViPR database. These data suggest that the zot-containing prophages in Campylobacter species are new prophages that have not been previously characterized.

Secreted and transmembrane proteins in Campylobacter prophages

Proteins secreted via both classical secretory pathway (with signal peptides) and non-classical secretory pathway (without signal peptides), as well as transmembrane proteins were found in all Campylobacter prophages (Fig. 5).

Discussion

In addition to C. concisus, a number of other Campylobacter species were recently reported to have the zot genes [1721]. In this study, we found that Campylobacter zot genes formed two clusters (Fig. 2). Most of the Campylobacter zot genes were in Cluster 2, and Cluster 1 contained only three zot genes. The three Campylobacter species that had Cluster 1 zot genes also contained Cluster 2 zot genes. The remaining six Campylobacter species/subspecies contained Cluster 2 zot genes only. These data show that Cluster 2 zot gene is more prevalent in Campylobacter species as compared to Cluster 1 zot genes.
ZotCampyType_1 proteins, which were encoded by Cluster 1 zot genes, were highly similar to each other. However they were less similar to ZotCampyType_2 proteins that were encoded by Cluster 2 Campylobacter zot genes. The zot gene in CON_phi2 prophage in C. concisus belongs to ZotCampyType_1. Using cell culture models, we previously showed that ZotCampyType_1 in C. concisus encoded by zot 808T polymorphism damaged intestinal epithelial barrier by induction of epithelial apoptosis and induced production of proinflammatory cytokines such as TNF-α in HT-29 cells and THP-1 macrophage-like cells, supporting its role as a potential virulence factor [16]. The high similarities between ZotCampyType_1 proteins in the three different Campylobacter species suggest that they may have similar effects on human cells. Great variations in protein sequences between ZotCampyType_1 and ZotCampyType_2 proteins as well as within ZotCampyType_2 proteins were observed in this study. Given this, the effects of ZotCampyType_2 proteins on human cells, if any, require to be examined individually.
A transmembrane domain was found in all Zot proteins, showing that Zot proteins are transmembrane proteins. Furthermore, all Zot proteins contained Walker A and Walker B motifs, which are conserved motifs of p-loop NTPase superfamily [25]. P-loop NTPase bind to NTP typically ATP or GTP through the Walker A and B motifs, which are involved in diverse cellular functions [25]. Future studies should be conducted to examine whether Campylobacter Zot proteins have NTPase activities.
In this study, we identified a number of zot-containing prophages in other Campylobacter species in additional to previous reported prophages in C. concisus (Fig. 5). These prophages have an integrase, a number of hypothetical proteins and attachment sites (Fig. 5; Table 2; Additional file 1), which satisfy the previously defined criteria for prophages [28]. The proteins in individual Campylobacter prophages identified in this study have low similarities with multiple viral proteins, suggesting that they are new prophages that have not being characterized previously (Additional file 2).
Campylobacter Zot proteins had very low similarities to V. cholerae Zot and N. meningitis Zot proteins (Additional files 3, 4). These data showed that despite having a common name, the amino acid sequences of Zot proteins in different bacterial species vary greatly. Thus, they may not necessarily exhibit the same effects on human cells.

Conclusions

This study reports the identification of two types of Campylobacter Zot proteins. The high similarities of ZotCampyType_1 proteins suggest that they are likely to have similar virulence. ZotCampyType_2 proteins were less similar to each other and their virulent properties, if any, remain to be examined individually. This study provides useful information for further examination of Campylobacter Zot proteins as potential virulence factors.

Authors’ contributions

FL and HL conducted the bioinformatics analysis. LZ conceived the project. RL provided critical feedback on bioinformatics analysis. FL, LZ, HL and RL wrote the manuscript. All authors read and approved the final manuscript.

Acknowledgements

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

The dataset supporting the conclusions of this article is included within the article (and its additional files).

Funding

This work is supported by a Faculty Research Grant awarded to Dr. Li Zhang from the University of New South Wales (Grant No: PS35329).
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Anhänge

Additional files

Literatur
1.
Zurück zum Zitat Lastovica AJ, On SL, Zhang L. The family Campylobacteraceae—the prokaryotes. New York: Springer; 2014. p. 307–35.CrossRef Lastovica AJ, On SL, Zhang L. The family Campylobacteraceae—the prokaryotes. New York: Springer; 2014. p. 307–35.CrossRef
2.
Zurück zum Zitat Lee H, Ma R, Grimm MC, Riordan SM, Lan R, Zhong L, Raftery M, Zhang L. Examination of the anaerobic growth of Campylobacter concisus strains. Int J Microbiol. 2014;2014:476047.CrossRefPubMedPubMedCentral Lee H, Ma R, Grimm MC, Riordan SM, Lan R, Zhong L, Raftery M, Zhang L. Examination of the anaerobic growth of Campylobacter concisus strains. Int J Microbiol. 2014;2014:476047.CrossRefPubMedPubMedCentral
3.
Zurück zum Zitat Zhang L, Budiman V, Day AS, Mitchell H, Lemberg DA, Riordan SM, Grimm M, Leach ST, Ismail Y. Isolation and detection of Campylobacter concisus from saliva of healthy individuals and patients with inflammatory bowel disease. J Clin Microbiol. 2010;48:2965–7.CrossRefPubMedPubMedCentral Zhang L, Budiman V, Day AS, Mitchell H, Lemberg DA, Riordan SM, Grimm M, Leach ST, Ismail Y. Isolation and detection of Campylobacter concisus from saliva of healthy individuals and patients with inflammatory bowel disease. J Clin Microbiol. 2010;48:2965–7.CrossRefPubMedPubMedCentral
4.
Zurück zum Zitat Tanner ACR, Badger S, Lai C, Listgarten MA, Visconti RA, Socransky SS. Wolinella gen. nov., WoZinella succinogenes (Vibrio succinogenes Wolin et al.) comb. nov., and Description of bacteroides gracilis sp. nov., Wolinella recta sp. nov., Campylobacter concisus sp. nov., and Eikenella corrodens from humans with periodontal disease. Int J Syst Bacteriol. 1981;31(4):432–45.CrossRef Tanner ACR, Badger S, Lai C, Listgarten MA, Visconti RA, Socransky SS. Wolinella gen. nov., WoZinella succinogenes (Vibrio succinogenes Wolin et al.) comb. nov., and Description of bacteroides gracilis sp. nov., Wolinella recta sp. nov., Campylobacter concisus sp. nov., and Eikenella corrodens from humans with periodontal disease. Int J Syst Bacteriol. 1981;31(4):432–45.CrossRef
5.
Zurück zum Zitat Zhang L, Man SM, Day AS, Leach ST, Lemberg DA, Dutt S, Stormon M, Otley A, O’Loughlin EV, Magoffin A, et al. Detection and isolation of Campylobacter species other than C. jejuni from children with Crohn’s disease. J Clin Microbiol. 2009;47:453–5.CrossRefPubMed Zhang L, Man SM, Day AS, Leach ST, Lemberg DA, Dutt S, Stormon M, Otley A, O’Loughlin EV, Magoffin A, et al. Detection and isolation of Campylobacter species other than C. jejuni from children with Crohn’s disease. J Clin Microbiol. 2009;47:453–5.CrossRefPubMed
6.
Zurück zum Zitat Mukhopadhya I, Thomson JM, Hansen R, Berry SH, El-Omar EM, Hold GL. Detection of Campylobacter concisus and other Campylobacter species in colonic biopsies from adults with ulcerative colitis. PLoS ONE. 2011;6:e21490–1.CrossRefPubMedPubMedCentral Mukhopadhya I, Thomson JM, Hansen R, Berry SH, El-Omar EM, Hold GL. Detection of Campylobacter concisus and other Campylobacter species in colonic biopsies from adults with ulcerative colitis. PLoS ONE. 2011;6:e21490–1.CrossRefPubMedPubMedCentral
7.
Zurück zum Zitat Mahendran V, Riordan SM, Grimm MC, Tran TA, Major J, Kaakoush NO, Mitchell H, Zhang L. Prevalence of Campylobacter species in adult Crohn’s disease and the preferential colonization sites of Campylobacter species in the human intestine. PLoS ONE. 2011;6:e25417.CrossRefPubMedPubMedCentral Mahendran V, Riordan SM, Grimm MC, Tran TA, Major J, Kaakoush NO, Mitchell H, Zhang L. Prevalence of Campylobacter species in adult Crohn’s disease and the preferential colonization sites of Campylobacter species in the human intestine. PLoS ONE. 2011;6:e25417.CrossRefPubMedPubMedCentral
8.
Zurück zum Zitat Lastovica AJ. Emerging Campylobacter spp.: the tip of the iceberg. Clin Microbiol Newsl. 2006;28:49–56.CrossRef Lastovica AJ. Emerging Campylobacter spp.: the tip of the iceberg. Clin Microbiol Newsl. 2006;28:49–56.CrossRef
9.
Zurück zum Zitat Kirk KF, Nielsen HL, Thorlacius-Ussing O, Nielsen H. Optimized cultivation of Campylobacter concisus from gut mucosal biopsies in inflammatory bowel disease. Gut Pathog. 2016;8:27.CrossRefPubMedPubMedCentral Kirk KF, Nielsen HL, Thorlacius-Ussing O, Nielsen H. Optimized cultivation of Campylobacter concisus from gut mucosal biopsies in inflammatory bowel disease. Gut Pathog. 2016;8:27.CrossRefPubMedPubMedCentral
10.
11.
Zurück zum Zitat Lindblom G, Sjogren E, Hansson-Westerberg J, Kaijser B. Campylobacter upsaliensis, C. sputorum sputorum and C. concisus as common causes of diarrhoea in Swedish children. Scand J Infect Dis. 1995;27:187–8.CrossRefPubMed Lindblom G, Sjogren E, Hansson-Westerberg J, Kaijser B. Campylobacter upsaliensis, C. sputorum sputorum and C. concisus as common causes of diarrhoea in Swedish children. Scand J Infect Dis. 1995;27:187–8.CrossRefPubMed
12.
Zurück zum Zitat Nielsen H, Ejlertsen T, Engberg J, Nielsen H. High incidence of Campylobacter concisus in gastroenteritis in North Jutland, Denmark: a population-based study. Clin Microbiol Infect. 2013;19:445–50.CrossRefPubMed Nielsen H, Ejlertsen T, Engberg J, Nielsen H. High incidence of Campylobacter concisus in gastroenteritis in North Jutland, Denmark: a population-based study. Clin Microbiol Infect. 2013;19:445–50.CrossRefPubMed
13.
Zurück zum Zitat Kalischuk L, Inglis G. Comparative genotypic and pathogenic examination of Campylobacter concisus isolates from diarrheic and non-diarrheic humans. BMC Microbiol. 2011;11:53.CrossRefPubMedPubMedCentral Kalischuk L, Inglis G. Comparative genotypic and pathogenic examination of Campylobacter concisus isolates from diarrheic and non-diarrheic humans. BMC Microbiol. 2011;11:53.CrossRefPubMedPubMedCentral
14.
Zurück zum Zitat Mahendran V, Tan YS, Riordan SM, Grimm MC, Day AS, Lemberg DA, Octavia S, Lan R, Zhang L. The prevalence and polymorphisms of zonula occluden toxin gene in multiple Campylobacter concisus strains isolated from saliva of patients with inflammatory bowel disease and controls. PLoS ONE. 2013;8:e75525.CrossRefPubMedPubMedCentral Mahendran V, Tan YS, Riordan SM, Grimm MC, Day AS, Lemberg DA, Octavia S, Lan R, Zhang L. The prevalence and polymorphisms of zonula occluden toxin gene in multiple Campylobacter concisus strains isolated from saliva of patients with inflammatory bowel disease and controls. PLoS ONE. 2013;8:e75525.CrossRefPubMedPubMedCentral
15.
Zurück zum Zitat Zhang L, Lee H, Grimm MC, Riordan SM, Day AS, Lemberg DA. Campylobacter concisus and inflammatory bowel disease. World J Gastroenterol. 2014;20:1259–67.CrossRefPubMedPubMedCentral Zhang L, Lee H, Grimm MC, Riordan SM, Day AS, Lemberg DA. Campylobacter concisus and inflammatory bowel disease. World J Gastroenterol. 2014;20:1259–67.CrossRefPubMedPubMedCentral
16.
Zurück zum Zitat Mahendran V, Liu F, Riordan S, Grimm M, Tanaka M, Zhang L. Examination of the effects of Campylobacter concisus zonula occludens toxin on intestinal epithelial cells and macrophages. Gut Pathog. 2016;8:18.CrossRefPubMedPubMedCentral Mahendran V, Liu F, Riordan S, Grimm M, Tanaka M, Zhang L. Examination of the effects of Campylobacter concisus zonula occludens toxin on intestinal epithelial cells and macrophages. Gut Pathog. 2016;8:18.CrossRefPubMedPubMedCentral
17.
Zurück zum Zitat Bullman S, Lucid A, Corcoran D, Sleator RD, Lucey B. Genomic investigation into strain heterogeneity and pathogenic potential of the emerging gastrointestinal pathogen Campylobacter ureolyticus. PLoS ONE. 2013;8:1.CrossRef Bullman S, Lucid A, Corcoran D, Sleator RD, Lucey B. Genomic investigation into strain heterogeneity and pathogenic potential of the emerging gastrointestinal pathogen Campylobacter ureolyticus. PLoS ONE. 2013;8:1.CrossRef
18.
Zurück zum Zitat Koziel M, Lucid A, Bullman S, Corcoran GD, Lucey B, Sleator RD. Draft genome sequence of Campylobacter corcagiensis strain CIT045T, a representative of a novel Campylobacter species isolated from lion-tailed macaques (Macaca silenus). Genome Announc. 2014;2:00248–314.CrossRef Koziel M, Lucid A, Bullman S, Corcoran GD, Lucey B, Sleator RD. Draft genome sequence of Campylobacter corcagiensis strain CIT045T, a representative of a novel Campylobacter species isolated from lion-tailed macaques (Macaca silenus). Genome Announc. 2014;2:00248–314.CrossRef
19.
Zurück zum Zitat Miller WG, Yee E, On SL, Andersen LP, Bono JL. Complete genome sequence of the Campylobacter ureolyticus clinical isolate RIGS 9880. Genome Announc. 2015;3(6):01291–315.CrossRef Miller WG, Yee E, On SL, Andersen LP, Bono JL. Complete genome sequence of the Campylobacter ureolyticus clinical isolate RIGS 9880. Genome Announc. 2015;3(6):01291–315.CrossRef
21.
Zurück zum Zitat Miller WG, Yee E, Huynh S, Chapman MH, Parker CT. Complete genome sequence of Campylobacter iguaniorum strain RM11343, isolated from an alpaca. Genome Announc. 2016;4(3):646–716.CrossRef Miller WG, Yee E, Huynh S, Chapman MH, Parker CT. Complete genome sequence of Campylobacter iguaniorum strain RM11343, isolated from an alpaca. Genome Announc. 2016;4(3):646–716.CrossRef
22.
23.
Zurück zum Zitat Mitchell A, Chang HY, Daugherty L, Fraser M, Hunter S, Lopez R, McAnulla C, McMenamin C, Nuka G, Pesseat S, et al. The InterPro protein families database: the classification resource after 15 years. Nucleic Acids Res. 2015;43:D213–21.CrossRefPubMed Mitchell A, Chang HY, Daugherty L, Fraser M, Hunter S, Lopez R, McAnulla C, McMenamin C, Nuka G, Pesseat S, et al. The InterPro protein families database: the classification resource after 15 years. Nucleic Acids Res. 2015;43:D213–21.CrossRefPubMed
24.
Zurück zum Zitat Finn RD, Coggill P, Eberhardt RY, Eddy SR, Mistry J, Mitchell AL, Potter SC, Punta M, Qureshi M, Sangrador-Vegas A, et al. The Pfam protein families database: towards a more sustainable future. Nucleic Acids Res. 2016;44:D279–85.CrossRefPubMed Finn RD, Coggill P, Eberhardt RY, Eddy SR, Mistry J, Mitchell AL, Potter SC, Punta M, Qureshi M, Sangrador-Vegas A, et al. The Pfam protein families database: towards a more sustainable future. Nucleic Acids Res. 2016;44:D279–85.CrossRefPubMed
25.
Zurück zum Zitat Hanson PI, Whiteheart SW. AAA+ proteins: have engine, will work. Nat Rev Mol Cell Biol. 2005;6:519–29.CrossRefPubMed Hanson PI, Whiteheart SW. AAA+ proteins: have engine, will work. Nat Rev Mol Cell Biol. 2005;6:519–29.CrossRefPubMed
26.
Zurück zum Zitat Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Liii WZ, Lopez R, McWilliam H, Remmert M, Soding J, et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol. 2011;7(1):539.CrossRefPubMedPubMedCentral Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Liii WZ, Lopez R, McWilliam H, Remmert M, Soding J, et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol. 2011;7(1):539.CrossRefPubMedPubMedCentral
27.
Zurück zum Zitat Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2013;30:2725–9.CrossRefPubMedPubMedCentral Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2013;30:2725–9.CrossRefPubMedPubMedCentral
29.
Zurück zum Zitat Pearson WR. An introduction to sequence similarity (“homology”) searching. Current Protocols in Bioinformatics. Hoboken: John Wiley & Sons Inc; 2013. p. 311–8. Pearson WR. An introduction to sequence similarity (“homology”) searching. Current Protocols in Bioinformatics. Hoboken: John Wiley & Sons Inc; 2013. p. 311–8.
30.
Zurück zum Zitat Kaakoush NO, Man SM, Lamb S, Raftery MJ, Wilkins MR, Kovach Z, Mitchell H. The secretome of Campylobacter concisus. FEBS J. 2010;277:1606–17.CrossRefPubMed Kaakoush NO, Man SM, Lamb S, Raftery MJ, Wilkins MR, Kovach Z, Mitchell H. The secretome of Campylobacter concisus. FEBS J. 2010;277:1606–17.CrossRefPubMed
31.
Zurück zum Zitat Fasano A, Baudry B, Pumplin DW, Wasserman SS, Tall BD, Ketley JM, Kaper JB. Vibrio cholerae produces a second enterotoxin, which affects intestinal tight junctions. Proc Natl Acad Sci USA. 1991;88:5242–6.CrossRefPubMedPubMedCentral Fasano A, Baudry B, Pumplin DW, Wasserman SS, Tall BD, Ketley JM, Kaper JB. Vibrio cholerae produces a second enterotoxin, which affects intestinal tight junctions. Proc Natl Acad Sci USA. 1991;88:5242–6.CrossRefPubMedPubMedCentral
32.
Zurück zum Zitat Petersen TN, Brunak S, von Heijne G, Nielsen H. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat Methods. 2011;8:785–6.CrossRefPubMed Petersen TN, Brunak S, von Heijne G, Nielsen H. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat Methods. 2011;8:785–6.CrossRefPubMed
34.
Zurück zum Zitat Kall L, Krogh A, Sonnhammer EL. Advantages of combined transmembrane topology and signal peptide prediction-the Phobius web server. Nucleic Acids Res. 2007;35:W429–32.CrossRefPubMedPubMedCentral Kall L, Krogh A, Sonnhammer EL. Advantages of combined transmembrane topology and signal peptide prediction-the Phobius web server. Nucleic Acids Res. 2007;35:W429–32.CrossRefPubMedPubMedCentral
35.
Zurück zum Zitat Jackson FL, Goodman YE. Bacteroides ureolyticus, a new species to accommodate strains previously identified as “Bacteroides corrodens, anaerobic”. Int J Syst Bacteriol. 1978;28:197–200.CrossRef Jackson FL, Goodman YE. Bacteroides ureolyticus, a new species to accommodate strains previously identified as “Bacteroides corrodens, anaerobic”. Int J Syst Bacteriol. 1978;28:197–200.CrossRef
36.
Zurück zum Zitat Koziel M, O’Doherty P, Vandamme P, Corcoran GD, Sleator RD, Lucey B. Campylobacter corcagiensis sp. nov., isolated from faeces of captive lion-tailed macaques (Macaca silenus). Int J Syst Evol Microbiol. 2014;64:2878–83.CrossRefPubMed Koziel M, O’Doherty P, Vandamme P, Corcoran GD, Sleator RD, Lucey B. Campylobacter corcagiensis sp. nov., isolated from faeces of captive lion-tailed macaques (Macaca silenus). Int J Syst Evol Microbiol. 2014;64:2878–83.CrossRefPubMed
37.
Zurück zum Zitat Miller WG, Yee E, Chapman MH. Complete genome sequences of Campylobacter hyointestinalis subsp. hyointestinalis strain LMG 9260 and C. hyointestinalis subsp. lawsonii strain LMG 15993. Genome Announc. 2016;4:00665–716. Miller WG, Yee E, Chapman MH. Complete genome sequences of Campylobacter hyointestinalis subsp. hyointestinalis strain LMG 9260 and C. hyointestinalis subsp. lawsonii strain LMG 15993. Genome Announc. 2016;4:00665–716.
Metadaten
Titel
Zonula occludens toxins and their prophages in Campylobacter species
verfasst von
Fang Liu
Hoyul Lee
Ruiting Lan
Li Zhang
Publikationsdatum
01.12.2016
Verlag
BioMed Central
Erschienen in
Gut Pathogens / Ausgabe 1/2016
Elektronische ISSN: 1757-4749
DOI
https://doi.org/10.1186/s13099-016-0125-1

Weitere Artikel der Ausgabe 1/2016

Gut Pathogens 1/2016 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Bei Herzinsuffizienz muss „Eisenmangel“ neu definiert werden!

16.05.2024 Herzinsuffizienz Nachrichten

Bei chronischer Herzinsuffizienz macht es einem internationalen Expertenteam zufolge wenig Sinn, die Diagnose „Eisenmangel“ am Serumferritin festzumachen. Das Team schlägt vor, sich lieber an die Transferrinsättigung zu halten.

Herzinfarkt mit 85 – trotzdem noch intensive Lipidsenkung?

16.05.2024 Hypercholesterinämie Nachrichten

Profitieren nach einem akuten Myokardinfarkt auch Betroffene über 80 Jahre noch von einer intensiven Lipidsenkung zur Sekundärprävention? Um diese Frage zu beantworten, wurden jetzt Registerdaten aus Frankreich ausgewertet.

ADHS-Medikation erhöht das kardiovaskuläre Risiko

16.05.2024 Herzinsuffizienz Nachrichten

Erwachsene, die Medikamente gegen das Aufmerksamkeitsdefizit-Hyperaktivitätssyndrom einnehmen, laufen offenbar erhöhte Gefahr, an Herzschwäche zu erkranken oder einen Schlaganfall zu erleiden. Es scheint eine Dosis-Wirkungs-Beziehung zu bestehen.

Erstmanifestation eines Diabetes-Typ-1 bei Kindern: Ein Notfall!

16.05.2024 DDG-Jahrestagung 2024 Kongressbericht

Manifestiert sich ein Typ-1-Diabetes bei Kindern, ist das ein Notfall – ebenso wie eine diabetische Ketoazidose. Die Grundsäulen der Therapie bestehen aus Rehydratation, Insulin und Kaliumgabe. Insulin ist das Medikament der Wahl zur Behandlung der Ketoazidose.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.