Background
Gastric cancer is a common malignancy globally [
1]. Surgical resection and the eradication of
Helicobacter pylori are the important treatment methods for gastric cancer [
2,
3]. Nevertheless, the prognosis of gastric cancer patients at advanced stage remains dismal due to the metastasis and recurrence. Therefore, finding novel biomarkers with high specificity and high sensitivity is indispensable for the early diagnosis of gastric cancer.
Accumulating articles have pointed out that the type of anesthetic used in surgery might affect the long-term outcomes of diseases [
4,
5]. Clinical researches also reported that local anesthesia suppressed the recurrence and motility of cancer patients who had accepted surgical resection [
6,
7]. Bupivacaine is a local anesthetic commonly used in the resection operation of gastric cancer patients [
8]. A large amount of articles suggested that Bupivacaine triggered the death and suppressed the proliferation of multiple cancer cells [
9,
10]. Nevertheless, the underlying working mechanisms behind Bupivacaine remain to be elucidated.
Dysregulated non-coding RNAs (ncRNAs) were implicated in the initiation and progression of gastric cancer [
11,
12]. Among these ncRNAs, circular RNAs (circRNAs) are ideal biomarkers for human diseases due to their covalently closed loop structure [
13]. Li et al. claimed that circ_0008035 accelerated the progression of gastric cancer through regulating microRNA-599 (miR-599)/EIF4A1 axis [
14]. CircPIP5K1A contributed to the development of gastric cancer through targeting miR-376c-3p/ZNF146 signaling [
15]. Circ_0000376 has been reported to be significantly up-regulated in gastric cancer [
16]. Here, we intended to uncover the role of circ_0000376 and illustrate the association between circ_0000376 and Bupivacaine in gastric cancer cells.
MicroRNAs (miRNAs) are regarded as a class of short ncRNAs with 18–24 nucleotides [
17]. The abnormal expression of miRNAs was associated with the pathogenesis of multiple cancers. For instance, miR-520f-3p restrained cell proliferation of gastric cancer cells through regulating SOX9/Wnt signal pathway [
18]. MiR-1271-5p suppressed the proliferation and elevated the radiotherapy sensitivity via CDK1 in hepatocellular carcinoma [
19]. MiR-145-5p served as the downstream gene of circDUSP16 to suppress the progression of gastric cancer [
20]. However, the potential mechanism of miR-145-5p in gastric cancer is still elusive.
Bupivacaine was found to suppress the viability, metastasis and glycolysis and promote the apoptosis of gastric cancer cells. Circ_0000376 and miR-145-5p levels could be regulated by Bupivacaine, and circ_0000376/miR-145-5p axis was identified to illustrate the molecular working mechanism of Bupivacaine in the progression of gastric cancer.
Methods
Cell culture
Human gastric cancer cell lines (AGS and HGC27) purchased from BeNa Culture Collection (Beijing, China) were used to conduct cellular experiments. HGC27 cell line was cultivated using Roswell Park Memorial Institute-1640 (RPMI-1640) medium (Gibco, Carlsbad, CA, USA), while Dulbecco’s modified Eagle’s medium/Nutrient Mixture F-12 (DMEM/F12; Gibco) was used for the cultivation of AGS cell line. 10% fetal bovine serum (FBS; Gibco) and 10% 100 units/mL penicillin/100 μg/mL streptomycin mixture were added to complete the base medium. These cell lines were maintained in an 37 °C incubator containing 5% CO2.
Bupivacaine
Bupivacaine was purchased from Sigma (St. Louis, MO, USA), and it was used at the final concentration of 1 μg/mL, 5 μg/mL or 10 μg/mL to simulate clinical condition.
Cell counting kit-8 (CCK8) assay
Gastric cancer cells were plated in the 96-well plates at the concentration of 3 × 103 cells per well in sextuplicate. The next day, transfection or drug treatment was conducted, and 10 μL CCK8 reagent (Dojindo, Tokyo, Japan) was added to the culture medium to incubate with the transfected gastric cancer cells. Cells were continued to cultivate for 1 h in normal condition in the cell culture incubator, and the cell viability was examined through determining the optical density at 450 nm. The experiment was repeated for three times.
Caspase-3 activity detection assay
A commercial caspase-3 activity detection colorimetric assay kit (KeyGen, Jiangsu, China) was used in this experiment. Gastric cancer cells were disrupted and divided into two equal parts. The protein samples were mixed with 2 × reaction buffer and substrate at room temperature in a dark room for 4 h. The optical density was measured at 405 nm. The experiment was repeated for three times.
Flow cytometry
Gastric cancer cells were seeded in the 6-well plates at suitable concentration. The next day, Bupivacaine treatment or transfection was performed. The treated gastric cancer cells were rinsed using phosphate buffered saline (PBS) and re-suspended in binding buffer. Subsequently, 5 μL fluorescein isothiocynate (FITC)-conjugated Annexin V (Solarbio, Beijing, China) and 5 μL propidium iodide (PI; Solarbio) were simultaneously added to the tubes to incubate with the cells in a dark room. Finally, the apoptotic gastric cancer cells (early stage and late stage) were identified from normal or necrotic cells by the flow cytometer. The experiment was repeated for three times.
Transwell migration and invasion assays
Transwell chambers (Costar, Corning, NY, USA) along with Matrigel (BD biosciences, San Jose, CA, USA) or not were used to analyze the invasion or migration ability of gastric cancer cells, respectively. After pre-coating with Matrigel (invasion assay) or not (migration assay), 100 μL gastric cancer cell suspension (without serum) was added to the upper chambers at a concentration of 5 × 104 (invasion assay) or 1 × 104 cells (migration assay)/well. 500 μL 10% FBS-contained medium was added to the lower chambers to act as chemotactic factor. After 24-h incubation, migration and invasion gastric cancer cells were stained with 0.5% crystal violet (Sigma), and the cell number was counted at five random fields. The magnification in the images is 100. The experiment was repeated for three times.
The Seahorse XF 96 Extracellular Flux Analyzer (Agilent Technologies, Santa Clara, CA, USA) and Seahorse XF Glycolysis Stress Test Kit (Agilent Technologies) were used to detect the ECAR. Gastric cancer cells were seeded into the wells of the Seahorse XF plate at a density of 1 × 10
4 cells/well. 10 mM Glucose, 1 μM Oligomycin and 50 mM 2-deoxyglucose (2-DG) were sequentially added to the wells at the indicated time points. The cell number was analyzed through crystal violet staining. The glycolysis rate and glycolytic capacity were calculated as previously reported [
21].
Western blot assay
Protein samples were extracted using cell lysis buffer (Abcam, Cambridge, MA, USA) containing protease inhibitor. Protein samples (25 μg) were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel and transferred to the polyvinylidene difluoride (PVDF) membrane (Bio-Rad, Hercules, CA, USA). Subsequently, the membrane was blocked using 5% skimmed milk, and then incubated with specific primary antibodies overnight at 4 °C. The primary antibodies included anti-glucose transporter type 1 (anti-GLUT1; ab115730; Abcam), anti-lactic dehydrogenase A (anti-LDHA; ab226016; Abcam) and anti-β-actin (ab8227; Abcam). β-actin was used as the internal reference. The horseradish peroxidase (HRP)-conjugated secondary antibody was then incubated with the membrane for 2 h at room temperature. The protein signals were examined by the enhanced chemiluminescent visualization (ECL) system (Pierce Biotechnology, Rockford, IL, USA). The experiment was repeated for three times.
Quantitative real-time polymerase chain reaction (qRT-PCR)
RNA isolation was conducted with Trizol solution (Invitrogen, Carlsbad, CA, USA). Template DNA of circ_0000376 and miR-145-5p was synthesized using the Bio-Rad iScript kit (Bio-Rad) and TaqMan reverse transcription kit (Applied Biosystems, Rotkreuz, Switzerland), respectively. PCR reaction of circ_0000376 and miR-145-5p was conducted with iQSYBR Green SuperMix (Bio-Rad) and TaqMan MicroRNA assay kit (Applied Biosystems), respectively. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 small nuclear RNA (snRNA) were used as the internal controls for circ_0000376 and miR-145-5p, respectively. The relative expression was analyzed using the 2
-ΔΔCt method. The primers used in this experiment were listed in Table
1. The experiment was repeated for three times.
Table 1
Primer sequences used in qRT-PCR assay
circ_0000376 | TTTGGATGTGGAGGGGAATA (forward) |
GAGCCCAGGAGTTCCAGACT (reverse) |
miR-145-5p | GUCCAGUUUUCCCAGGAAUCCCU (forward) |
AGGGATTCCTGGGAAAACTGGAC (reverse) |
U6 | GCGCGTCGTGAAGCGTTC (forward) |
GTGCAGGGTCCGAGGT (reverse) |
GAPDH | GGTCGGAGTCAACGGATTTG (forward) |
ATGAGCCCCAGCCTTCTCCAT (reverse) |
Cell transfection
Gastric cancer cells were plated into 6-well plates at suitable concentration overnight. When cell confluence reached about 70%, circ_0000376 specific small interfering RNAs (si-circ_0000376#1, si-circ_0000376#2 and si-circ_0000376#3), siRNA negative control (si-NC), circ_0000376 overexpression vector (circ_0000376), pLCDH-cir (vector), miR-145-5p mimic (miR-145-5p), miR-NC, miR-145-5p inhibitor (anti-miR-145-5p) or anti-NC purchased from Sangon (Shanghai, China) and Genepharma (Shanghai, China) was transfected into gastric cancer cells with Lipofectamine™ 3000 (Thermo Fisher Scientific, Shanghai, China). The sequences of three siRNAs targeting circ_0000376 were listed as below.
Si-circ_0000376#1: 5′-AGAAUCCAACUCUCAUAUGGA-3′.
Si-circ_0000376#2: 5′-AAUCCAACUCUCAUAGGAUA-3′.
Si-circ_0000376#3: 5′-AUCCAACUCUCAUAUGGAUAG-3′.
Circular RNA Interactome database was used for seeking the direct downstream miRNA targets of circ_0000376 based on the complementary sites between circ_0000376 and miRNAs.
Dual-luciferase reporter assay
The sequence of circ_0000376 containing putative complementary sites (ACUGGA) with miR-145-5p (UGACCU) was amplified and inserted into pGL3 plasmid (Ambion, Austin, TX, USA), named as circ_0000376 wild-type (wt). Site-directed mutation in miR-145-5p binding sites of circ_0000376 sequence was also created and cloned into pGL3 plasmid (Ambion), named as circ_0000376 mut. Gastric cancer cells were seeded into 24-well plates. The next day, 120 ng circ_0000376 wt or circ_0000376 mut and 40 nM miR-145-5p or miR-NC were co-transfected into gastric cancer cells. The Firefly and Renilla fluorescence intensities were detected by the Dual-luciferase reporter assay system (Promega, Madison, WI, USA). Firefly activity was normalized to Renilla activity. The experiment was repeated for three times.
Statistical analysis
Data were displayed as mean ± standard deviation (SD) from at least three independent assays. The comparisons between two groups were conducted using Student’s t-test, while the differences among more than two groups were analyzed using one-way analysis of variance (ANOVA) followed by Tukey’s test. Statistical significance was defined when P value less than 0.05.
Discussion
Local anesthetic used during the operation benefits cancer patients with breast cancer, common cancer and gastric cancer through suppressing the metastasis and recurrence of tumors [
22,
23]. Bupivacaine is one of the amide-linked local anesthetics. Amide-linked local anesthetics have been identified to directly restrain the growth, viability and motility of tumor cells [
24,
25]. Dan et al. reported that Bupivacaine suppressed the progression of gastric cancer [
26]. However, the precise molecular mechanisms behind Bupivacaine in the progression of gastric cancer remain to be revealed. We aimed to seek the crucial molecules that were implicated in the working mechanism of Bupivacaine. Our results suggested that Bupivacaine impeded the progression of gastric cancer through down-regulating circ_0000376, thus elevating the level of miR-145-5p.
Bupivacaine dose-dependently suppressed the viability of gastric cancer cells. Furthermore, Bupivacaine at the concentration of 10 μg/mL notably induced the apoptosis while impaired the metastasis and aerobic glycolysis of gastric cancer cells. The anti-tumor role of Bupivacaine was consistent with the previous work [
26]. Circ_0000376 was found to be significantly down-regulated with the treatment of Bupivacaine in gastric cancer cells. Anesthetics have been reported to inhibit the progression of multiple cancers through regulating ncRNAs. For example, Propofol impeded the proliferation and motility of gastric cancer cells through targeting miR-29/MMP2 signaling [
27]. Sevoflurane restrained the metastasis of glioma cells through modulating miR-146b-5p/MMP16 axis [
28]. Zhang et al. found that Bupivacaine induced the apoptosis and neurotoxicity of neuroblastoma cells through regulating miR-132/IGF1R axis [
29]. As for circ_0000376, Jiang et al. found that circ_0000376 was abnormally up-regulated in gastric cancer [
16]. We wondered if Bupivacaine suppressed the progression of gastric cancer through down-regulating circ_0000376. In the current study, through conducting loss-of-function experiments, we found that circ_0000376 accelerated the viability, migration, invasion and glycolytic metabolism and impeded the apoptosis of gastric cancer cells. Through treating gastric cancer cells with Bupivacaine or co-treating with Bupivacaine and circ_0000376 ectopic expression plasmid, we found Bupivacaine suppressed the malignant behaviors of gastric cancer cells through down-regulating circ_0000376.
MiR-145-5p was identified as a tumor suppressor in a variety of cancers. For instance, Wei et al. claimed that PVT1 facilitated the proliferation, migration and invasion while suppressed the apoptosis of non-small cell lung cancer cells through sponging miR-145-5p to up-regulate ITGB8 [
30]. Chen et al. found that miR-145-5p impeded the proliferation and motility of colorectal cancer cells through targeting CDCA3 [
31]. Wang et al. found that miR-145-5p acted as a direct target of KCNQ1OT1 to suppress the progression of bladder cancer through suppressing PCBP2 [
32]. CircDUSP16 contributed to the development of gastric cancer through sponging miR-145-5p [
20]. Furthermore, miRNAs exerted crucial roles in the working mechanisms of anaesthetics in cancers [
33‐
35]. Among these reports, lidocaine, as one of the amide-linked local anaesthetics, was found to suppress the growth and metastasis of gastric cancer cells through elevating the level of miR-145 [
33]. In this study, miR-145-5p was verified as a direct target of circ_0000376 in gastric cancer cells. To test whether Bupivacaine functioned through regulating the level of miR-145-5p, we co-treated gastric cancer cells with Bupivacaine and anti-miR-145-5p. Rescue experiments showed that Bupivacaine restrained the progression of gastric cancer through up-regulating miR-145-5p.
In summary, local anesthetic Bupivacaine suppressed the viability, migration, invasion and glycolytic metabolism while induced the apoptosis of gastric cancer cells. Furthermore, the direct interaction between circ_0000376 and miR-145-5p was firstly identified in this study, and Bupivacaine was found to restrain the progression of gastric cancer through decreasing circ_0000376 level, thus up-regulating the level of miR-145-5p.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.