nach oben

Erschienen in:

Open Access 01.12.2015 | Research article

Case-control study of ADARB1 and ADARB2 gene variants in migraine

verfasst von: Claudia F Gasparini, Heidi G Sutherland, Bridget Maher, Astrid J Rodriguez-Acevedo, Elhame Khlifi, Larisa M Haupt, Lyn R Griffiths

Erschienen in: The Journal of Headache and Pain | Ausgabe 1/2015

Abstract

Background

Migraine causes crippling attacks of severe head pain along with associated nausea, vomiting, photophobia and/or phonophobia. The aim of this study was to investigate single nucleotide polymorphisms (SNPs) in the adenosine deaminase, RNA-specific, B1 (ADARB1) and adenosine deaminase, RNA specific, B2 (ADARB2) genes in an Australian case–control Caucasian population for association with migraine. Both candidate genes are highly expressed in the central nervous system and fit criteria for migraine neuropathology. SNPs in the ADARB2 gene were previously found to be positively associated with migraine in a pedigree-based genome wide association study using the genetic isolate of Norfolk Island, Australia. The ADARB1 gene was also chosen for investigation due to its important function in editing neurotransmitter receptor transcripts.

Methods

Four SNPs in ADARB1 and nine in ADARB2 were selected by inspecting blocks of linkage disequilibrium in Haploview for genotyping using either TaqMan or Sequenom assays. These SNPs were genotyped in two-hundred and ninety one patients who satisfied the International Classification of Headache Disorders-II 2004 diagnostic criteria for migraine, and three-hundred and fourteen controls, and PLINK was used for association testing.

Results

Chi-square analysis found no significant association between any of the SNPs tested in the ADARB1 and ADARB2 genes in this study and the occurrence of migraine.

Conclusions

In contrast to findings that SNPs in the ADARB2 gene were positively associated with migraine in the Norfolk Island population, we find no evidence to support the involvement of RNA editing genes in migraine susceptibility in an Australian Caucasian population.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

CFG, EK, and HGS performed the experiments, and analysed and interpreted the data. Authors CFG, HGS, BM, AJR, EK, LMH, and LRG conceived and supervised the project and revised the manuscript for intellectual content and final approval of the completed manuscript. All authors read and approved the final manuscript.

ADARB1

Adenosine deaminase, RNA-specific, B1

ADARB2

Adenosine deaminase, RNA specific, B2

ALS

Amyotrophic lateral sclerosis

A-to-I

Adenosine-to-Inosine

CEU

Utah residents with Northern and Western European ancestry

CNS

Central Nervous System

CSD

Cortical Spreading Depression

DBH

Dopamine Beta Hydroxylase

DSH

Dyschromatosis symmetrica hereditaria

FHM

Familial Hemiplegic Migraine

GRIA2

Glutamate receptor, ionotropic, AMPA2

GRM7

Glutamate receptor, metabotropic 7

HTR7

5-hydroxytryptamine serotonin receptor 7 adenylate cyclase-coupled

HWE

Hardy-Weinberg Equilibrium

IHS

International Headache Society

Migraine with Aura

Migraine without Aura

Linkage disequilibrium

pGWAS

Pedigree-based genome wide association study

SLC6A3

Solute carrier family 6 (neurotransmitter transporter), member 3

SNPs

Single nucleotide polymorphisms

Background

The International Headache Society (IHS) defines migraine as a recurrent headache disorder typified by painful attacks lasting 4–72 hours [1]. Classification criteria recognize two types of migraine, migraine with aura (MA) and migraine without aura (MO) with the former accompanied by visual or auditory disturbances [1]. Migraine generally affects 12% of the Caucasian population showing up more often in females, a statistic correlated with instability of ovarian hormones [2]. Migraine has a major impact on the wellbeing and quality of life of sufferers and their families in part due to days missed from the workplace and higher direct health-care costs [3]. Numerous theories and models regarding migraine mechanisms have emerged; the most accepted opinion is that a combination of both vascular and neural events is involved in the initiation and perpetuation of a migraine attack [4,5]. Primarily the generation of pain is attributed to complex processes within the nervous system that activate the trigeminovascular system consisting of the trigeminal nerve and its ramifications which regulate cerebral blood flow and the release of inflammatory molecules. The fact that the diameter of cranial blood vessels along with other functions is controlled by signals transmitted by nerves is further evidence to support a neurogenic theory. The aura on the other hand, occurs in only a minority of migraineurs and has been attributed to an electrophysiological phenomenon, first reported in epilepsy, termed Cortical Spreading Depression (CSD) [6].

Interactions between the environment and the genotype are important in shaping the migraine phenotype. Population based twin studies have confirmed a genetic influence ranging from 0.34 to 0.57 [7]. Genetic studies of a rare, and more severe migraine subtype, Familial Hemiplegic Migraine (FHM), have identified mutations in three causal genes that code for ion channels involved in neuronal signalling and have provided hypotheses applicable to common migraine [8]. Functional studies in cellular and animal models of mutant alleles provide direct evidence for neuronal hyperexcitability as one cellular mechanism underlying headache or aura in FHM [9]. For the most part, genes causing more common types of migraine have been identified from neurological, vascular and hormonal pathways and in 2010 the first functional variant to show linkage to familial MA was identified in TRESK, a potassium channel involved in neuronal excitability [10]. While genome wide association studies (GWAS) have shed new light on the types of genes involved in migraine susceptibility, many candidate gene association studies have focused on neurotransmitter-related pathways, as these pathways are considered to play a significant role in the migraine process. Therefore genes affecting synthesis and activity of neurotransmitters, including RNA editing genes, are potential candidates for involvement in migraine susceptibility.

Isolated founder populations offer several advantages over mainstream (outbred) populations for genomic studies of disease, as both environmental noise and genetic heterogeneity are reduced. We have used the population of Norfolk Island, an island off the east coast of Australia, for genetic studies on migraine as it has well-documented family histories and an increased prevalence of the disorder [11]. We previously identified four SNPs forming a 22 kb haplotype block in ADARB2 (Table 1 and Figure 1) that were positively associated with migraine susceptibility in a pedigree-based GWAS (pGWAS) of the population of Norfolk Island [11]. ADARB2 is a member of the double-stranded RNA adenosine deaminase family of RNA-editing enzymes [12]. The enzymatic activity of ADARs leads to the chemical modification of Adenosine-to-Inosine (A-to-I) in specific coding regions which are then translated as guanosines by the cell’s translational machinery [13]. A-to-I RNA editing is a post-transcriptional process that permanently alters the nucleotide sequence of an RNA molecule resulting in the synthesis of proteins not encoded by the original gene sequence [14]. This is a form of chemical recoding that changes specific amino acid residues and alters the biological function of translated molecules, which is most clearly demonstrated by an alteration in channel properties including the Ca²⁺ permeability of glutamate receptors (GluRs) [15]. Perturbed A-to-I RNA editing has been implicated in human cancer, and viral infections and neurodegenerative/neurological diseases such as dyschromatosis symmetrica hereditaria (DSH), amyotrophic lateral sclerosis (ALS), Alzheimer’s disease, and Huntington’s disease epilepsy, depression and schizophrenia [16,17]. In ALS inefficient RNA editing fails to substitute an arginine for a glutamine residue in the GluR2 Q/R site of glutamate AMPA receptors in the spinal motor neurons and is proposed as a mechanism responsible for motor neuron death [18].

Table 1

SNPs in ADARB2 associated with migraine in the Norfolk Island pGWAS adapted from [11]

Locus	Gene	No. SNPs in Gene	NCBI dbSNP Ref No.	NCBI build 37.1 position (BP)	Function	Minor/Major allele	MAF	Beta	P Value
10p15	ADARB2	4	rs10903399	1227868	Downstream	C/T	0.330	0.64	7.68E − 05
			rs1046914	1228206	3Prime UTR	G/A	0.328	0.67	3.43E − 05
			rs2271275	1230968	Non-synon	G/A	0.368	0.65	2.67E − 05
			rs883248	1250184	Intronic	G/A	0.439	0.67	3.83E − 06

ADARB2 (also known as ADAR3) comprises 10 exons spanning a genomic region of 9.5 kb on chromosome 10p15.3 and encodes a catalytically inactive protein, expressed in brain, amygdala and thalamus [12]. One SNP rs2271275 confers a (Thr-Ala) amino acid change in the protein structure and has previously been associated with early-onset obsessive-compulsive disorder in some American families in a genome-wide linkage scan [19]. In addition to ADARB2 SNPs, the Norfolk Island pGWAS also found two SNPs in the glutamate receptor, metabotropic 7 (GRM7) gene and one SNP in the 5-hydroxytryptamine serotonin receptor 7 adenylate cyclase-coupled (HTR7) gene to be associated with migraine [11]. Collectively, association of variants in these neurotransmitter-related genes ADARB2; GRM7; HTR7 connected by a common neurological pathway supports current theories of a perturbed serotonin and glutamate mechanism in migraine and in the Norfolk pedigree. Previous studies have reported positive associations of SNPs in various neurotransmitter-related genes, e.g. DBH [20] and SLC6A3 [21], with migraine in a number of case–control populations.

Considering the association of ADARB2 with migraine in the Norfolk Island pGWAS we decided to investigate SNPs in this gene, as well as another RNA editing gene, ADARB1, in an Australian migraine case–control population. ADARB1 encodes an RNA editing enzyme, expressed mainly in the central nervous system (CNS), which is involved in the downstream regulation of neurotransmitters [22]. The gene is of potential interest with respect to migraine susceptibility as the glutamate and serotonin receptor gene RNAs are the predominant substrates modified by ADARB1 adenosine deamination [22]. ADARB1 (also known as ADAR2) spans a genomic region of 25 kb on chromosome 21q22.3 and comprises 16 exons and regulates its own expression through self-editing [23]. In this study we genotyped four SNPs in ADARB1 and nine SNPs in ADARB2 using either TaqMan or Sequenom assays to investigate their involvement in migraine.

Methods

Case–control population

The study was approved by the Griffith University Ethics Committee for experimentation in humans. The study population was composed of 291 cases and 314 controls and demographical characteristics of the population are reported in (Table 2). Affected individuals were diagnosed as having MA or MO by an experienced clinical neurologist based on responses provided in a validated medical questionnaire in accordance with criteria determined by the International Headache Society (IHS) [1]. The migraine population consisted of individuals of Caucasian origin, recruited from the South East Queensland Region of Australia. The control population samples were obtained via the Genomics Research Centre Clinic, Southport and had no history of personal or familial migraine. Signed informed consent was obtained from all patients before participation in the study.

Table 2

Demographical characteristics of Migraine Cases and Controls

Parameter	Cases (n = 291)	Controls (n = 314)
Age: Mean (range)	46.4 (−18-67)	44.4 (18–63)
Sex
Male	70	89
Female	221	225
MA	227	N/A
MO	64	N/A

MA - migraine with aura, MO - migraine without aura, N/A - not applicable.

SNP selection

HapMap CEU (Utah residents with Northern and Western European ancestry) SNP genotype data was downloaded for each candidate gene and a total of 8 haplotype blocks were identified in the ADARB1 gene and 56 haplotype blocks in the ADARB2 gene in the program Haploview v4.2 [24]. The SNPs genotyped in the ADARB1 and ADARB2 genes were selected in different LD block, were mostly located in intronic regions of each gene and were selected to obtain reasonable coverage across the entire length of the gene (Tables 3 and 4).

Table 3

TaqMan Assay and SNP information

TaqMan Assay ID	Gene	SNP ID	Position	SNP Type	Allele Change	^a CEU MAF
C__15831699_10	ADARB1	rs2838771	Chr.21: 46501576	Transversion Substitution	C:G	G = 0.41
C_1211569_1_	ADARB1	rs1051367	Chr.21: 46641968	Silent Mutation	A:G	G = 0.47
C_15959830_10	ADARB2	rs2271275	Chr.10: 1230968	Missense Mutation	C:T	C = 0.34
C_32118695_20	ADARB2	rs10903467	Chr.10: 1535739	Intron, Transition Substitution	C:T	T = 0.44
C__30856132_20	ADARB2	rs11250642	Chr.10: 1622644	Intron, Transition Substitution	C:T	T = 0.50

^aCEU MAF = HapMap Caucasian Minor Allele Frequency.

Table 4

SNPs genotyped in ADARB1 and ADARB2 by Sequenom

Gene	SNP ID	Forward, Reverse and Extension Primer Sequences	Position	SNP type	Allele Change	^a CEU MAF
ADARB1	rs407133	F: 5’ ACGTTGGATGCCTGCTCTGCAGTAATGAAC 3’	45396317	Intron	C:G	G 0.46
		R: 5’ ACGTTGGATGTCCTCCTCTCTTAACTCACG 3’
		E: 5’ TCGGACCAATGCTGA 3’
	rs422720	F: 5’ ACGTTGGATGGGAAGCAGTACATGTTCATTG 3’	45403382	Intron	A:C	C 0.36
		R: 5’ ACGTTGGATGGACTAATGCAGATGATCACC 3’
		E: 5’ GGGTCAGTACATGTTCATTGTAAGAATT 3’
ADARB2	rs3793733	F: 5’ ACGTTGGATGCAACTCCATGTCAAAAGTGC 3’	1411326	Missense	G:A	A 0.01
		R: 5’ ACGTTGGATGATGCCAGGACTCAGGTGCTT 3’
		E: 5’CAGGAAGCATATTGTCAACCTTCCTC 3’
	rs7070629	F: 5’ ACGTTGGATGGATGAAAAAAGGATGCCATAC 3’	1414938	Intron	G:A	A 0.37
		R: 5’ ACGTTGGATGCCTGTGATGCAGCTTCTCCT 3’
		E: 5’ ACCTTTGATGCAGCTTCTCCTGGCACA 3’
	rs10903479	F: 5’ ACGTTGGATGAGAACGCAATGCACTCTTCC 3’	1581881	Intron	A:T	T 0.40
		R: 5’ ACGTTGGATGTCGGTTTTGGAGTCTAGAGG 3’
		E: 5’ CCTCATTGTCACAGAGT 3’
	rs7094094	F: 5’ ACGTTGGATGTCTAGAAAATGCAGAAGGG 3’	1652840	Intron	T:G	G 0.38
		R: 5’ ACGTTGGATGCTTGGGCTATACTTTTTGTG 3’
		E: 5’CATTCAGTTGTTCTAATATTATATTGA 3’
	rs10903520	F: 5’ ACGTTGGATGTTACTCCTTAAGTGGAAGGG 3’	1672481	Intron	G:A	A 0.39
		R: 5’ ACGTTGGATGACCATGATATCTACCCCTCC 3’
		E: 5’ AAAGAAGCAGGCGTT 3’
	rs884861	F: 5’ ACGTTGGATGGAAAAACAGATAGACAAAGC 3’	1765662	Intron	C:G	C 0.43
		R: 5’ ACGTTGGATGCCCTGGAATAACTTCAGGGT 3’
		E: 5’ ACAGATAGACAAAGCAGAATATAT 3’

^aCEU MAF = HapMap Caucasian Minor Allele Frequency.

Genotyping methods

Genomic DNA was extracted from peripheral blood samples using a salting out method as described by Miller et al. [25]. DNA was quantified and normalised to a concentration of 20 ng/μL for genotyping experiments. Nine SNPs were genotyped as part of a Sequenom plex, which allows high throughput multiplexing of the assays into a single well. Not all SNPs are compatible with the restraints required for primer design for this method, or can be run together so therefore we also used TaqMan assays to genotype five of the SNPs. For each SNP, Sanger sequencing of a subset of samples was performed on a ABI3500 (Life Technologies, Carlsband, CA, USA) to confirm the genotypes.

Genotyping by TaqMan

SNPs rs2838771, rs1051367 in ADARB1 and SNPs rs2271275, rs10903467, rs11250642 in ADARB2 were genotyped using TaqMan® SNP Genotyping Assays from Applied Biosystems (Life Technologies, Carlsband, CA, USA). Detailed information regarding SNPs genotyped in the ADARB1 and ADARB2 genes and a summary of assay conditions for each SNP are listed in Table 3. The genotyping protocol for each marker was exactly the same except for the use of the specific Primer-Probe Mix. The final optimized PCR reaction conditions consisted of 20 ng of genomic DNA template, TaqMan Universal PCR Master Mix (1X), SNP genotyping assay probe-primer mix (20X), DNase-free water in a 5 μL reaction volume. The PCR thermocycling conditions consisted of one cycle at 95°C for 10 min, followed by 40 cycles at 95°C for 15 s, 60°C for 1 min. The data were acquired during the annealing step and analysed using the 7900 system Sequence Detection System software (Applied Biosystems, Life Technologies Corporation) in a 384-well plate format. Nuclease-free water was used as a negative control and DNA for each genotype included as positive controls.

Genotyping by Sequenom

SNPs in the ADARB1 and ADARB2 genes were genotyped using the Sequenom MassARRAY system 4 platform, and Typer 4.0 software was used to carry out all genotyping work (MALDI-TOF; MassARRAY system, Sequenom Inc., San Diego, CA, USA). The primers for PCR and iPLEX reactions were designed using the online Assay design suite 1.0 Sequenom software (available at: www.mysequenom.com/Home) and obtained from IDT (see Table 4) (Integrated DNA Technologies, Carolville, Iowa, USA). PCR and extension reactions were performed in a 96-well plate according to the manufacturer’s instructions, using Sequenom reagents. Completed genotyping reactions were spotted in nanoliter volumes onto a matrix arrayed silicon chip with 96 elements (Sequenom SpectroCHIP) using the MassARRAY Nanodispenser. Spectro CHIPs were analyzed using the Bruker Autoflex MALDI-TOF mass spectrometer and the spectra were processed using the SpectroTYPER software (Sequenom) to yield genotypes.

Statistical analysis

Hardy-Weinberg Equilibrium (HWE) was calculated for each SNP in case and control groups to detect deviation from the normal genotype distribution in the population. Chi-square (χ ²) analysis was performed on SNPs in HWE to determine if significant differences existed in the genotype and allele frequencies in the migraine population versus controls. This analysis was completed in the software PLINK v1.07 [26]. Power estimates indicated that if the SNPs were to confer at least a two-fold increase in relative risk of migraine, the case and control groups used in this study are of sufficient size to have approximately 80% power to detect an association as statistically significant at the 0.05 level.

Results

The aim of this study was to determine if SNPs in the ADARB1 and ADARB2 genes contribute to migraine susceptibility in an Australian case–control cohort. In this study, the following 4 SNPs in the ADARB1 gene: rs2838771, rs407133, rs422720, rs1051367, and the following 8 SNPs in the ADARB2 gene: rs3793733, rs7070629, rs10903467, rs10903479, rs11250642, rs7094094, rs10903520, rs884861 were in HWE and analysed for association. Genotypic and allelic distributions for all 12 SNPs genotyped are shown in Table 5. Minor Allele Frequencies (MAF) obtained in this study were consistent with expected allele frequencies in HapMap–Utah residents with Northern and Western European ancestry (CEU) populations. χ ² analysis was performed for migraine cases versus controls. As Table 5 shows, for the majority of SNPs genotype and allele frequencies do not differ significantly between migraineurs and controls. An allelic p-value of 0.05 was observed for rs884861. However, the result for rs884861 is not significant with Bonferroni correction for multiple testing which gives a corrected p-value threshold of 0.0042. Thus overall there was no significant association between migraine and the ADARB1 and ADARB2 SNPs investigated.

Table 5

Genotypic and allelic frequencies of migraine cases and controls and p-values derived from χ ² analysis for SNPs investigated in the ADARB1 and ADARB2 genes

SNP	Group	Genotypes			Total (n=)	Genotypic p-value	^a MAF	Allelic p-value	Hap-Map CEU ^a MAF
ADARB1		CC	GC	GG
rs2838771	Cases	0.429	0.441	0.130	261	0.86	0.35	0.65
	Controls	0.405	0.461	0.134	247		0.36		G allele, 0.36
		GG	GA	AA
rs407133	Cases	0.178	0.519	0.303	264	0.95	0.44	0.35
	Controls	0.179	0.529	0.292	291		0.44		G allele, 0.44
		CC	CA	AA
rs422720	Cases	0.157	0.498	0.345	255	0.64	0.42	0.35
	Controls	0.138	0.480	0.382	275		0.38		C allele, 0.38
		AA	AG	GG
rs1051367	Cases	0.277	0.530	0.193	274	0.53	0.46	0.40
	Controls	0.320	0.493	0.187	300		0.43		G allele, 0.43
ADARB2		AA	GA	GG
rs3793733	Cases	0.0	0.017	0.983	239	^b0.32	0.008	0.32
	Controls	0.0	0.031	0.969	228		0.015		A allele, 0.009
		AA	GA	GG
rs7070629	Cases	0.138	0.466	0.395	253	0.70	0.37	0.41
	Controls	0.125	0.444	0.430	279		0.35		A allele, 0.37
		TT	CT	CC
rs10903467	Cases	0.183	0.470	0.347	251	0.16	0.42	0.11
	Controls	0.205	0.524	0.271	288		0.47		T allele, 0.48
		TT	TA	AA
rs10903479	Cases	0.195	0.489	0.316	266	0.33	0.44	0.15
	Controls	0.153	0.490	0.357	294		0.40		T allele, 0.40
		TT	CT	CC
rs11250642	Cases	0.200	0.459	0.341	255	0.34	0.42	0.31
	Controls	0.200	0.500	0.300	270		0.45		T allele, 0.45
		GG	GT	TT
rs7094094	Cases	0.100	0.420	0.480	246	0.83	0.37	0.62
	Controls	0.104	0.442	0.454	269		0.33		G allele, 0.37
		AA	GA	GG
rs10903520	Cases	0.114	0.493	0.393	280	0.55	0.36	0.62
	Controls	0.144	0.476	0.380	290		0.38		A allele, 0.38
		GG	GC	CC
rs884861	Cases	0.161	0.435	0.404	248	0.16	0.38	0.05
	Controls	0.220	0.440	0.340	273		0.44		G allele, 0.43

^aMAF = Minor allele frequency.

^bHeterozygous GA genotype versus homozygous AA genotype only as no homozygous GG individuals were detected.

Discussion

Susceptibility to migraine is conferred by exposure to intrinsic and environmental triggering factors and genetics. Pinpointing SNPs associated with disease is one of the goals of GWAS and one of many approaches used to dissect the genetic basis of migraine. This study was undertaken to follow up findings from a pGWAS we previously conducted in the Norfolk Island pedigree which implicated four SNPs in the RNA editing gene ADARB2 in migraine, based on statistical significance [11]. These four SNPs, and others, in the RNA editing genes ADARB1 and ADARB2, were further investigated in an Australian migraine case–control population because they fit criteria for migraine neuropathology, i.e. a) are expressed in the brain or CNS, b) regulate neurological pathways (e.g. neurotransmitters) and c) are plausibly related to migraine neuropathology (e.g. cellular hyperexcitability, ion channel disruption). Furthermore, retyping top-ranking SNPs from GWAS data in independent case-controls cohorts is important to determine the validity of GWAS findings and ascertain risk within different population groups.

To date only a few association studies have investigated SNPs in the RNA editing genes ADARB1 and ADARB2 and none have been studied in migraine previously. Interestingly, a GWAS of US centenarians supports a role for RNA editors as important regulators of aging in humans. SNPs in ADARB2 were found to be associated with longevity and these findings were replicated in three independent cohorts of different genetic backgrounds [27]. Amore et al. [28] identified a common neutral SNP in three out of seven patients with bipolar disorder in the ADARB1 gene, but no other major alterations. In a separate study, Kostyrko et al. [29] analysed the coding sequence of ADARB1 and its association with bipolar affective disorder and did not find any mutations except one already known transition. Oguro et al. [30] identified a longevity-associated SNP in ADARB2 rs2805533, which may modulate human longevity by regulating metabolic factors such as abdominal obesity and lipid profiles.

RNA editing is a physiologically important and conserved process necessary for proper development and functioning of neuronal cells. The importance of this process is demonstrated by mice deficient in the RNA-editing enzyme ADARB1 which die approximately 20 days post-birth and show early onset epilepsy [31]. This phenotype results from under editing of a critical position that determines calcium permeability in glutamate receptors of excitatory neurons [31]. ADARB1 plays an important role in ensuring neurotransmitter receptor transcripts are properly edited at respective points [14]. The particular editing function of ADARB1 upon the AMPA glutamate receptor subunit (GRIA2) pre-mRNA makes the investigation of ADARB1 in migraine interesting, because glutamate is a major mediator in the CNS and its regulation has been studied as a possible mechanism causing migraine.

Although ADARB2 is catalytically inactive it has been shown in vitro that it can act as a competitor of ADAR (also known as ADAR1) and ADARB1 by binding to the same transcripts and thus ADARB2 can decrease the efficiency of other RNA editing enzymes by preventing them from deaminating their substrate RNAs in regions of the brain where they are co-expressed [32]. ADARB2 may therefore be reducing the total number of edited transcripts via a competitive mechanism, which in turn may lead to poor ionic conductance and synaptic dysfunction in the CNS. One example that supports this hypothesis is perturbed A-to-I editing of the mRNA encoding the GRIA2 subunit of glutamate AMPA receptors which manifests in the disease amyotrophic lateral sclerosis (ALS) [33]. Functional studies are needed to further investigate the activity of ADARB2 in vivo.

In this study we tested four SNPs in the ADARB1 gene and eight SNPs in the ADARB2 for association with migraine susceptibility. Results of χ ² analysis indicated that neither genotype nor allele frequency distributions for the migraine and control groups were significantly different after Bonferroni correction for multiple testing. Although we were unable to replicate our findings from the Norfolk Island population implicating four ADARB2 SNPs in migraine in an Australian Caucasian population, it does not exclude a role for ADARB2 in migraine in the unique Norfolk Island population isolate. This may be because rare variants that are over-represented in the unique pedigree structure of the Norfolk Island population contributed to the initial finding and that the common variants selected for this study are not relevant in the case–control population analysed here. Fine-mapping and sequencing for rare variants in the Norfolk Island samples could shed further light on this.

Conclusion

In this study we found no evidence for SNPs in the RNA editing genes ADARB1 and ADARB2 to be associated with increased risk of migraine in an Australian Caucasian population. This result is in contrast to a pGWAS study of Norfolk Island which implicated a 22 kb haploblock region in ADARB2 in migraine. Genetically isolated populations may carry unique genetic characteristics that are not always replicated in case–control cohorts. Nevertheless, both types of populations are useful to study the genetic structure underlying disease, providing direction to the investigation of susceptibility genes and genetic pathways. Considering that common migraine is caused by interactions of multiple loci, identifying and validating genetic factors that influence the disorder remains an important undertaking that may lead to improved strategies for management and treatment.

Acknowledgements

Claudia Gasparini was funded by a Griffith University Postgraduate scholarship. This research was supported by an Australian International Science Linkages grant and by infrastructure purchased with Australian Government EIF Super Science Funds as part of the Therapeutic Innovation Australia - Queensland Node project. We thank the migraine patients and their families for their participation in this research. Thank you to Rebecca Grealy and Bishakha Roy for technical advice.

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.

The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.

To view a copy of this licence, visit https://creativecommons.org/licenses/by/4.0/.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

IHS (2013) The international classification of headache disorders, 3rd edition (beta version). Cephalalgia 33(9):629–808, doi:10.1177/0333102413485658CrossRef

Lipton RB, Bigal ME, Diamond M, Freitag F, Reed ML, Stewart WF (2007) Migraine prevalence, disease burden, and the need for preventive therapy. Neurology 68(5):343–349, doi:10.1212/01.wnl.0000252808.97649.21CrossRefPubMed

Leonardi M, Steiner TJ, Scher AT, Lipton RB (2005) The global burden of migraine: measuring disability in headache disorders with WHO’s classification of functioning, disability and health (ICF). J Headache Pain 6(6):429–440, doi:10.1007/s10194-005-0252-4CrossRefPubMedCentralPubMed

Amin FM, Asghar MS, Hougaard A, Hansen AE, Larsen VA, de Koning PJH, Larsson HBW, Olesen J, Ashina M (2013) Magnetic resonance angiography of intracranial and extracranial arteries in patients with spontaneous migraine without aura: a cross-sectional study. Lan Neurol 12(5):454–461, doi:10.1016/s1474-4422 (13)70067-xCrossRef

Edvinsson L, Villalon CM, MaassenVanDenBrink A (2012) Basic mechanisms of migraine and its acute treatment. Pharmacol Ther 136(3):319–333, doi:10.1016/j.pharmthera.2012.08.011CrossRefPubMed

Dalkara T, Zervas NT, Moskowitz MA (2006) From spreading depression to the trigeminovascular system. Neurol Sci 27(Suppl 2):86–90, doi:10.1007/s10072-006-0577-zCrossRef

Mulder EJ, Van Baal C, Gaist D, Kallela M, Kaprio J, Svensson DA, Nyholt DR, Martin NG, MacGregor AJ, Cherkas LF, Boomsma DI, Palotie A (2003) Genetic and environmental influences on migraine: a twin study across six countries. Twin Res 6(5):422–431, doi:10.1375/136905203770326420CrossRefPubMed

de Vries B, Frants RR, Ferrari MD, van den Maagdenberg AM (2009) Molecular genetics of migraine. Hum Genet 126(1):115–132, doi:10.1007/s00439-009-0684-zCrossRefPubMed

Garza-Lopez E, Sandoval A, Gonzalez-Ramirez R, Gandini MA, Van den Maagdenberg A, De Waard M, Felix R (2012) Familial hemiplegic migraine type 1 mutations W1684R and V1696I alter G protein-mediated regulation of Ca (V) 2.1 voltage-gated calcium channels. Biochimica Et Biophysica Acta-Mol Basis Dis 1822(8):1238–1246, doi:10.1016/j.bbadis.2012.04.008CrossRef

10.

Lafreniere RG, Cader MZ, Poulin JF, Andres-Enguix I, Simoneau M, Gupta N, Boisvert K, Lafreniere F, McLaughlan S, Dube MP, Marcinkiewicz MM, Ramagopalan S, Ansorge O, Brais B, Sequeiros J, Pereira-Monteiro JM, Griffiths LR, Tucker SJ, Ebers G, Rouleau GA (2010) A dominant-negative mutation in the TRESK potassium channel is linked to familial migraine with aura. Nat Med 16(10):1157–1160, doi:10.1038/nm.2216CrossRefPubMed

11.

Cox HC, Lea RA, Bellis C, Carless M, Dyer TD, Curran J, Charlesworth J, Macgregor S, Nyholt D, Chasman D, Ridker PM, Schurks M, Blangero J, Griffiths LR (2012) A genome-wide analysis of ‘Bounty’ descendants implicates several novel variants in migraine susceptibility. Neurogenetics 13(3):261–266, doi:10.1007/s10048-012-0325-xCrossRefPubMedCentralPubMed

12.

Hogg M, Paro S, Keegan LP, O’Connell MA (2011) RNA editing by mammalian ADARs. Adv Genet 73:87–120, doi:10.1016/B978-0-12-380860-8.00003-3 B978-0-12-380860-8.00003-3CrossRefPubMed

13.

Brennicke A, Marchfelder A, Binder S (1999) RNA editing. FEMS Microbiol Rev 23(3):297–316CrossRefPubMed

14.

Barbon A, Barlati S (2011) Glutamate receptor RNA editing in health and disease. Biochemistry 76(8):882–889, doi:10.1134/S0006297911080037 BCM76081079PubMed

15.

Nishikura K (2010) Functions and regulation of RNA editing by ADAR deaminases. Annu Rev Biochem 79:321–349, doi:10.1146/annurev-biochem-060208-105251CrossRefPubMedCentralPubMed

16.

Paz N, Levanon EY, Amariglio N, Heimberger AB, Ram Z, Constantini S, Barbash ZS, Adamsky K, Safran M, Hirschberg A, Krupsky M, Ben-Dov I, Cazacu S, Mikkelsen T, Brodie C, Eisenberg E, Rechavi G (2007) Altered adenosine-to-inosine RNA editing in human cancer. Genome Res 17(11):1586–1595, doi:10.1101/gr.6493107CrossRefPubMedCentralPubMed

17.

Akbarian S, Smith MA, Jones EG (1995) Editing for an AMPA receptor subunit RNA in prefrontal cortex and striatum in Alzheimer’s disease, Huntington’s disease and schizophrenia. Brain Res 699(2):297–304CrossRefPubMed

18.

Foran E, Trotti D (2009) Glutamate transporters and the excitotoxic path to motor neuron degeneration in amyotrophic lateral sclerosis. Antioxid Redox Signal 11(7):1587–1602, doi:10.1089/ars.2009.2444CrossRefPubMedCentralPubMed

19.

Hanna GL, Veenstra-Vanderweele J, Cox NJ, Van Etten M, Fischer DJ, Himle JA, Bivens NC, Wu X, Roe CA, Hennessy KA, Dickel DE, Leventhal BL, Cook EH Jr (2007) Evidence for a susceptibility locus on chromosome 10p15 in early-onset obsessive-compulsive disorder. Biol Psychiatry 62(8):856–862CrossRefPubMedCentralPubMed

20.

Fernandez F, Colson N, Quinlan S, MacMillan J, Lea RA, Griffiths LR (2009) Association between migraine and a functional polymorphism at the dopamine beta-hydroxylase locus. Neurogenetics 10(3):199–208, doi:10.1007/s10048-009-0176-2CrossRefPubMed

21.

Todt U, Netzer C, Toliat M, Heinze A, Goebel I, Nurnberg P, Gobel H, Freudenberg J, Kubisch C (2009) New genetic evidence for involvement of the dopamine system in migraine with aura. Hum Genet 125(3):265–279, doi:10.1007/s00439-009-0623-zCrossRefPubMed

22.

Maas S, Kawahara Y, Tamburro KM, Nishikura K (2006) A-to-I RNA editing and human disease. RNA Biol 3(1):1–9, doi:2495CrossRefPubMedCentralPubMed

23.

Feng Y, Sansam CL, Singh M, Emeson RB (2006) Altered RNA editing in mice lacking ADAR2 autoregulation. Mol Cell Biol 26(2):480–488, doi:10.1128/mcb. 26.2.480-488.2006CrossRefPubMedCentralPubMed

24.

Barrett JC (2009) Haploview: Visualization and analysis of SNP genotype data. Cold Spring Harb Protoc 2009(10):pdb ip71, doi:10.1101/pdb.ip71CrossRefPubMed

25.

Miller SA, Dykes DD, Polesky HF (1988) A simple salting out procedure for extracting DNA from Human Nucleated cells. Nucleic Acid Res 16(3):1215CrossRefPubMedCentralPubMed

26.

Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MA, Bender D, Maller J, Sklar P, de Bakker PI, Daly MJ, Sham PC (2007) PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet 81(3):559–575, doi:10.1086/519795CrossRefPubMedCentralPubMed

27.

Sebastiani P, Montano M, Puca A, Solovieff N, Kojima T, Wang MC, Melista E, Meltzer M, Fischer SE, Andersen S, Hartley SH, Sedgewick A, Arai Y, Bergman A, Barzilai N, Terry DF, Riva A, Anselmi CV, Malovini A, Kitamoto A, Sawabe M, Arai T, Gondo Y, Steinberg MH, Hirose N, Atzmon G, Ruvkun G, Baldwin CT, Perls TT (2009) RNA editing genes associated with extreme old age in humans and with lifespan in C. elegans. PLoS One 4(12):e8210, doi:10.1371/journal.pone.0008210CrossRefPubMedCentralPubMed

28.

Amore M, Strippoli P, Laterza C, Tagariello P, Vitale L, Casadei R, Frabetti F, Canaider S, Lenzi L, D’Addabbo P, Carinci P, Torroni A, Ferrari G, Zannotti M (2004) Sequence analysis of ADARB1 gene in patients with familial bipolar disorder. J Affect Disord 81(1):79–85, doi:10.1016/j.jad.2003.08.006 S0165032703002039CrossRefPubMed

29.

Kostyrko A, Hauser J, Rybakowski JK, Trzeciak WH (2006) Screening of chromosomal region 21q22.3 for mutations in genes associated with neuronal Ca2+ signalling in bipolar affective disorder. Acta Biochim Pol 53(2):317–320, doi:20061244PubMed

30.

Oguro R, Kamide K, Katsuya T, Akasaka H, Sugimoto K, Congrains A, Arai Y, Hirose N, Saitoh S, Ohishi M, Miura T, Rakugi H (2012) A single nucleotide polymorphism of the adenosine deaminase, RNA-specific gene is associated with the serum triglyceride level, abdominal circumference, and serum adiponectin concentration. Exp Gerontol 47(2):183–187, doi:10.1016/j.exger.2011.12.004CrossRefPubMed

31.

Higuchi M, Maas S, Single FN, Hartner J, Rozov A, Burnashev N, Feldmeyer D, Sprengel R, Seeburg PH (2000) Point mutation in an AMPA receptor gene rescues lethality in mice deficient in the RNA-editing enzyme ADAR2. Nature 406(6791):78–81, doi:10.1038/35017558CrossRefPubMed

32.

Chen CX, Cho DSC, Wang QD, Lai F, Carter KC, Nishikura K (2000) A third member of the RNA-specific adenosine deaminase gene family, ADAR3, contains both single- and double-stranded RNA binding domains. Rna-a Publ Rna Soc 6(5):755–767, doi:10.1017/s1355838200000170CrossRef

33.

Rosenthal JJ, Seeburg PH (2012) A-to-I RNA editing: effects on proteins key to neural excitability. Neuron 74(3):432–439, doi:10.1016/j.neuron.2012.04.010CrossRefPubMedCentralPubMed

Titel: Case-control study of ADARB1 and ADARB2 gene variants in migraine
verfasst von: Claudia F Gasparini
Heidi G Sutherland
Bridget Maher
Astrid J Rodriguez-Acevedo
Elhame Khlifi
Larisa M Haupt
Lyn R Griffiths
Publikationsdatum: 01.12.2015
Verlag: Springer Milan
Erschienen in: The Journal of Headache and Pain / Ausgabe 1/2015
Print ISSN: 1129-2369
Elektronische ISSN: 1129-2377
DOI: https://doi.org/10.1186/s10194-015-0511-y

Update AINS

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.

hier abonnieren

Springer Medizin

Case-control study of ADARB1 and ADARB2 gene variants in migraine