Background
Due to the high morbidity and mortality, bladder cancer is the most common urologic malignant tumor, which is divided into two types, non-muscle-invasive bladder cancer (NMIBC) and muscle-invasive bladder cancer (MIBC) [
1]. However, NMIBC is characterized with high recurrence rate and a 20% chance of progression [
2], meanwhile, a poor 5-year survival rate of less than 60% is observed in the MIBC patients who have undergone radical cystectomy and systematic chemotherapy [
3]. Therefore, biomarkers for early detection and key elements for targeted therapy are urgently demanded for bladder cancer treatment.
Extracellular matrix (ECM) microenvironment possesses a vital role in regulating cancer cell behaviors by causing a disorder of cancer-related gene expression [
4]. Fibronectin (FN), an essential component of ECM, has been found highly expressed in several types of cancer, indicating a potential role of FN in tumorigenesis and progression [
5,
6]. Actually, evidences have shown that the levels of FN are implicated in bladder cancer stages and grades [
7,
8]. A systematic review with meta-analysis conducted by Yang et al. has revealed that urine FN has a pooled sensitivity of 81% and a pooled specificity of 80% in diagnosing bladder cancer [
9]. Moreover, an in vitro study has demonstrated that FN protects bladder cancer cells from mitomycin C-induced cell death through inhibition cell cycle arrest [
10], which implies the latent relationship between FN and cell proliferation in bladder cancer.
Unconstrained cell growth plays a key role in the initiation and progression of malignant tumors. Aberrations of various crucial signaling cascades associated with sustained proliferation is hallmarks of many malignancies [
11]. One such signaling cascade is the Wnt/β-catenin pathway, which has been confirmed to exert a profound effect on bladder cancer cell proliferation [
12]. In the Wnt pathway, β-catenin and its downstream target proteins, CyclinD1 and c-myc, are important regulators in cell proliferative activity [
13].
Cancerous inhibitor of protein phosphatase 2A (CIP2A), a human oncoprotein dysregulated in several cancer types, is supported to have prominent effects on cancer cell proliferation [
14]. CIP2A depletion reduces both in vitro malignant cellular growth and in vivo xenografted tumor formation [
15,
16]. In addition, CIP2A has been proved to regulate cell-cycle progression [
17]. Although the relationship between the overexpression of CIP2A and aberrant cell proliferation in bladder cancer has been confirmed previously [
18], the cause of CIP2A overexpression and the mechanisms though which CIP2A exerts its proliferative properties in bladder cancer are still unclear.
In this context, the present study is designed to explore the significance and therapeutic potential of FN-CIP2A-β-catenin signaling pathway in bladder cancer. Here we demonstrate the positive correlations of stromal FN with CIP2A and PCNA expression in a cohort human bladder cancer tissues. Moreover, we validate that FN promotes bladder cancer cell proliferation by increasing CIP2A expression in cell and animal models. Furthermore, our results strongly indicate that CIP2A-β-catenin interaction regulates the stability of β-catenin which is involved in the process of FN-induced bladder cancer cell proliferation.
Methods
Patients and tissue samples
Human bladder cancer samples were obtained from 68 patients who underwent transurethral resection of bladder tumor (TURBT), partial or radical cystectomy in Ruijin Hospital (Shanghai, China) and Huashan Hospital (Shanghai, China), between September 2015 and September 2016. According to the collected pathological information, a total of 39 patients were NMIBC, and 29 patients suffered from MIBC. All procedures of this study were approved by institutional ethics committees of the above two hospitals. In accordance with the Declaration of Helsinki, the research was carried out, and written informed consent was obtained from each patient.
Cell culture and chemicals
Human bladder cancer cell lines (T24 and J82), obtained from Type Culture Collection of the Chinese Academy of Science (Shanghai, China), were cultured in DMEM (HyClone, USA) containing 10% fetal bovine serum (Gibco, USA), 100 units of penicillin/mL and 100 μg of streptomycin/mL. Cells were cultured at 37 °C with 5% CO2. FN from human plasma (Sigma, Japan) was dissolved in culture media with different concentrations (0, 5, 10 and 20 μg/mL) for cell incubation. To measure endogenous β-catenin stability, cells were incubated with 100 μg/mL cycloheximide (CHX) (Sigma, Japan) for the indicated times.
RNA extraction and quantitative real-time PCR (qRT-PCR)
Total RNA was extracted by using Trizol reagent (Invitrogen, USA), and PrimeScriptTM RT Master Mix (TaKaRa, Japan) were used for the reverse-transcription reactions. The following primers were used for amplification: CIP2A, forward primer (5’-CACAAAT-CACCTCGACCCCT-3’) and reverse primer (5’-CAAAAGCTGAGTGGCGTTCG-3’), β-catenin, forward primer (5’-GCGCCATTTTAAGCCTCTCG-3’) and reverse primer (5’-GGCCATGTCCAACTCCATCA-3’), GAPDH, forward primer (5’- ACCA-CAGTCCATGCCATCAC -3’) and reverse primer (5’- CCACCACCCTGTTGCTG -3’) and β-Actin, forward primer (5’-GTGGGGCGCCCCCAGGCACCA-3’) and reverse primer (5’-CTCCTTAATGTCA-CGCACGAT-3’). QRT-PCR was carried out using SYBR Premix Ex Taq II Kit (TaKaRa, Japan) on an Applied Biosystems 7500 Real-time PCR system (Applied Biosystems, USA). GAPDH and β-Actin were used as internal control. The results were expressed as log10 (2-ΔΔCt).
Western blotting analysis
The cells were lysed in ice-cold RIPA buffer. Protein concentrations were determined using BCA Protein Assay Kit (Beyotime, China). Equal quantities of protein were separated using 10% SDS-polyacrylamide gels, transferred to a PVDF membrane and blocked with 5% bovine serum albumin (Amresco, USA). PVDF membranes were incubated overnight at 4 °C with the following antibodies: FN (Abcam, ab154210), CIP2A (Santa Cruz, sc-80662), β-catenin (CST, 9562), c-myc (CST, 5605), CyclinD1 (CST, 2922), and β-Actin (Santa Cruz, sc-47778). After washing, the membranes were then incubated with HRP-conjugated secondary antibodies followed by enhanced chemiluminescence detection.
Construction of stably transfected cells
CIP2A short hairpin RNA (sh-CIP2A) plasmid and CIP2A overexpressed plasmid (CIP2A-plasmid) which were ligated in pGV101 vector and pGV142 vector respectively, were purchased from Shanghai GeneChem Technologies Co., Ltd. (Shanghai, China). The mature antisense sequence for shRNA we used is as following: 5’GATCCCCCACAGTTTAAGTGGTGGAAACTCGAGTTTCCACCACTTAAACTGTGGTTTTTGGAT-3’. These plasmids were transfected into T24 and J82 cells. Briefly, cells were inoculated into 6-well plates and incubated overnight. sh-CIP2A plasmid (4 μg) or CIP2A-plasmid (4 μg), was transfected in bladder cancer cells in 2 mL culture medium per well by using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer's protocol. In order to get stable cell lines, both CIP2A low expressed and CIP2A overexpressed cells were selected with 500 μg/mL neomycin for 14 days.
RNA interference
The small interference RNAs (siRNAs) were purchased from GenePharma (Shanghai, China). The following sequences were used for RNA interference: β-catenin, 5’-CAG-GGGGUUGUGGUUAAGCUCUU-3’; negative control, 5’-UUCUCCGAACGUGU-CACGUTT-3’. Transfection of siRNAs (50 nmol/L) was conducted using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer's protocol.
MTT assay
Cell viability was assessed using the 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, as previously described [
19]. Cells were seeded on a 96-well plate and incubated with different concentrations of FN. At indicated time points after seeding, cell viability was determined by measuring the absorbance of MTT (Invitrogen, USA) at 490 nm using a microplate reader (MultiscanTMGO, Thermo, USA).
Cell cycle analysis
The cell cycle analysis was performed by flow cytometry. Cells were collected and fixed with 70% ice ethanol overnight at 4 °C. The fixed cells were subsequently stained with propidium iodide (Beyotime, China). Cell cycle analysis was performed on a flow cytometer with the CellQuest software (BD Biosciences, USA).
Immunohistochemical (IHC) analysis
The slides with paraffin-embedded tissues were deparaffinized in xylene and rehydrated through graded alcohols. Subsequently, 3% hydrogen peroxide was used to block the endogenous peroxidase activity for clear background staining. The slides were incubated with primary antibodies against FN (Abcam, ab154210), CIP2A (Santa Cruz, sc-80662), and PCNA (CST, 2586). The sections were washed 3 times with phosphate-buffered saline. Then, diaminobenzidine was used for signal development, and the slides were counterstained with 20% haematoxylin.
Estimation of scores for all samples was completed by the same pathologist in a blinded fashion which was performed according to the following semi-quantitative method. Slides with heavy background staining were excluded from the analysis. For the assessment of FN, each sample was scored based on the intensity of signal (negative staining = 0, weak staining = 1, moderate staining = 2, and strong staining = 3) and pattern (negative = 0, focal = 1, moderate = 2, diffuse = 3) of extracellular staining [
20]. Then, we divided the specimens into two groups according to the sum of the two scores: low FN expression group (scores 0 to 3) and high FN expression group (scores 4 to 6). Moreover, the labelling index, which represented the percentage of immunostained cells relative to the total number of cells, was adopted for evaluating the levels of CIP2A and PCNA. Ten randomly chosen 400-fold high power fields and more than 500 cells were counted in each section were observed for analyzing.
Immunofluorescence staining
Cells grown on coverslips in 24-well plates were fixed with 4% paraformaldehyde, permeabilized with 0.2% Triton X-100, and blocked with 5% bovine serum albumin (Amresco, USA). Then, the cells were incubated with antibodies against CIP2A (Santa Cruz, sc-80662) and β-catenin (CST, 9562) overnight at 4 °C, respectively. The secondary antibodies, anti-mouse Alexa Fluor 488 (Molecular Probes, A-11029) and anti-rabbit Alexa Fluor 594 (Molecular Probes, A-11037), were incubated with the cells at 37 °C for 1 h. The slips were washed 3 times, followed by staining with 4’,6-diamidino-2-phenylindole (DAPI) to visualize nucleus. Images were captured using a confocal laser-scanning microscope microscopy (Leica SP8, Germany).
Co-immunoprcipitation (co-IP) assay
Cells were lysed by NP-40 lysis buffer with protease inhibitors. Meanwhile, Protein A Sepharose CL-4B beads (Sigma, Japan) were incubated with antibodies against β-catenin (CST, 9562) and normal rabbit IgG (designated as IgG, CST, 2729) at 4 °C for 4 h, respectively. Next, the beads were washed 3 times with NP-40 lysis buffer. Subsequently, the beads were mixed with cell lysates at 4 °C overnight. Then after washing beads for 6 times with NP-40 lysis buffer again, the bound proteins were eluted with SDS-PAGE loading buffer for western blotting analysis.
Subcutaneous xenograft models
Animal experiments were performed according to the protocol approved by the Institutional Animal Care and Use Committee of Ruijin Hospital. Twenty 4-week-old female BALB/c nude mice were randomly divided into 4 equal groups. Sh-CIP2A and sh-Control T24 cells were incubated with FN (0 and 20 μg/mL) for 2 weeks, and then used for subcutaneous inoculations. Based on the various types of pretreatment, the four groups were named FN (-) sh-Control group, FN (-) sh-CIP2A group, FN (+) sh-Control group, and FN (+) sh-CIP2A group, respectively. The number of inoculated cells in each mouse was 2 × 106. The mice in the two FN (+) groups were subcutaneously injected with 0.1 ml of FN solution (20 μg/mL) around the tumors every 2 days. Correspondingly, the mice were administered equal volume culture media in the two FN (-) groups. Tumor volume was measured using calipers every 7 days and calculated with the following formula: tumor volume (mm3) = (Length × Width2)/2. On day 35, the xenograft tumor tissues were removed and weighed. Afterwards, harvested tumor tissues were subjected to further IHC staining analysis.
Statistical analysis
Data were expressed as the mean ± SD. Statistical analyses were conducted using SPSS 22.0 software (SPSS Inc., Chicago, USA). The correlation between FN and CIP2A expression in human bladder cancer tissues was analyzed using Spearman’s correlation test. The two-tailed Student t test was conducted to analyze statistical differences between groups. P values of less than 0.05 were considered statistically significant.
Discussion
Even though the overexpression and diagnostic value of FN in malignant bladder diseases have been previously reported, the biological function and its molecular mechanisms of FN in bladder cancer remain largely uncharacterized. In this study, we provided evidence on the link between stromal FN levels with cell proliferation in bladder cancer tissues. And both in vitro and in vivo experiments demonstrated that exogenous FN dramatically promoted cell proliferation and CIP2A expression in bladder cancer cells. Subsequently, we found that CIP2A interacted with β-catenin which contributing to β-catenin stabilization, and both the two proteins participated in FN-induced bladder cancer cell proliferation.
ECM presents distinct biochemical and biomechanical properties that facilitate cell growth, survival, adhesion and invasion in carcinogenesis [
25]. As an important component of ECM, FN is a promising biomarker for diagnosis and treatment of bladder cancer. Studies have reported the overexpressed FN in high-grade bladder cancer [
26], which coinciding with our IHC analysis results. In addition, FN is not only an integral feature of tumors but also actively forces cancer progression though complex signaling pathways. However, functional mechanisms of FN in bladder cancer cell biological behaviors have been little investigated. Consistent with the proliferating effects of FN in gallbladder cancer [
27], our results revealed that FN remarkably promoted T24 and J82 cell proliferation. Hence, FN could appear to be a good candidate for bladder cancer treatment. Encouragingly, Huijbers et al. have developed a vaccine against FN to reduce tumor volume significantly [
28]. Furthermore, the clinical evaluations of targeting FN have been ongoing. For example, Sauer et al. have reported that highly FN-specific radiolabeled antibody
131I-L19SIP induces a sustained partial remission in two Hodgkin lymphoma patients successfully, supporting the in vivo accessibility of this therapeutic approach in humans [
29]. Besides, as regard to the source of stromal FN, previous observations suggest that FN could be secreted by tumor parenchymal cells [
30]. And IHC results in our study identified the positive staining of FN in human bladder urothelial cells (Fig.
1A), indicating that bladder cancer parenchymal cells may be responsible for cancer-associated ECM remolding through producing and secreting FN during tumor progression. In accordance to the above evidences and assumptions, small molecules targeting intracellular FN synthesis and secretion could be effective to alter the components of tumor microenvironment.
The clinical relevance of CIP2A oncoprotein in bladder cancer aggressiveness has been established [
31]. Similarly, our data demonstrated that MIBC tissues possessed higher levels of FN than NMIBC samples, and in addition, CIP2A promoted bladder cancer cell proliferation via abrogating G0/G1 arrest, which is similar to previous studies [
21,
32]. Moreover, studies also confirm the expression of CIP2A varies with mitotic progression and is regulated by cell cycle-related factors [
17,
33]. Besides, the influence of CIP2A on the expression of CyclinD1 and c-myc which is supported by our work also strengthens the close relationship between CIP2A and cell cycle.
Apart from promoting cell proliferation, the roles that FN and CIP2A played in bladder cancer deserve for further research. Due to the short postoperative time, lack of follow-up information hinders the exploration of the linkage between prognosis and FN or CIP2A expression for bladder cancer in our study. However, the prognostic prediction of FN and CIP2A have been confirmed in several other types of cancers [
16,
34]. What’s more, studies also suggest that the two proteins are associated with anticancer drug resistance [
10,
35]. Once better understandings of these mechanisms will be gained, FN and CIP2A may serve as potential biomarkers for poor survival and promising targets for increasing chemosensitivity.
β-catenin is responsible for regulating mitotic events [
36]. Therefore, it is reasonable that β-catenin gets involved in FN-induced bladder cancer cell proliferation in our study. Meanwhile, we found that CIP2A stabilized β-catenin protein, though the exact mechanism is not yet clarified. Mechanistically, β-catenin can be phosphorylated by glycogensynthasekinase-3β (GSK-3β), but not phosphorylated GSK-3β (pGSK-3β) [
36]. Then the phosphorylated β-catenin (p-β-catenin) is presented to the proteasome for degradation [
37]. Consequently, interfering with the formation of p-β-catenin is an important approach to elevate β-catenin stabilization. We found that CIP2A stabilized β-catenin protein, though the exact mechanism was not yet clarified. With further research, we explored and validated the colocalization and interaction between CIP2A and β-catenin, indicating that the CIP2A-β-catenin interaction may repress the process of β-catenin phosphorylation. Protein phosphatase 2A (PP2A), whose catalytic phosphatase activity can be inhibited by CIP2A, has been reported to repress β-catenin abundance [
38]. Consistently, studies show that PP2A induced dephosphorylation of pGSK-3β, thereby promoting β-catenin degradation [
23]. Based on the above evidence, CIP2A may contribute to β-catenin accumulation by suppressing the phosphatase functions of PP2A to modulate GSK-3β activation in bladder cancer cells.
Acknowledgements
This work was supported by Shanghai Key Laboratory of Reproductive Medicine, School of Medicine, Shanghai Jiaotong University.