Background
The main function of adult stem cells is to maintain tissue homeostasis and to perform repairs after injury [
1]. In the lungs, the integrity of the epithelial barrier is essential to prevent pathogen invasion and effective gas exchange. In homeostasis, lung epithelial cells renew slowly but contain region-specific stem cells, which mobilize rapidly to replenish epithelial cells after tissue injury [
2]. Functionally defined stem or progenitor cells that have unlimited self-renewal and clonal, pluripotent differentiation in cell hierarchy may be essential for the homeostasis and repair of the lungs [
3]. The biology of lung maintenance may be more similar to the organs of endothelial-derived epithelial cells, such as the pancreas and liver. Mature, differentiated or facultative progenitor or stem cells are the main regenerative cells [
4].
The distal lung performs essential respiratory functions that can be impaired by inflammation, tumors or infectious diseases. The distal alveolar epithelium is not only crucial for gas exchange but also an important barrier to protect the body from external hazards. For acute injury, alveoli can rapidly repair and regenerate to restore the complete epithelial barrier. The alveolar epithelium contains two main types of epithelial cells: AEC1s and AEC2s. AEC1s are terminally differentiated epithelial cells, and their contribution to alveolar epithelial regeneration is very limited [
5]. One of the functions of AEC2s is to release pulmonary surfactant, thus reducing alveolar surface tension to maintain lung morphology during breathing [
6]. However, AEC2s are crucial cells in the maintenance of pulmonary homeostasis and regenerate after injury by proliferating and differentiating AEC1s in alveoli [
7,
8]. The self-renewal and differentiation of AEC2s must be closely coordinated to maintain tissue integrity and effective repair. This imbalance can lead to severe lung disease [
9]. Only a small fraction of mature AEC2s express stem cell function, and their doubling time is approximately 40 days. This stem cell function is induced by alveolar injury and can be activated by dying AEC1s [
3,
10]. Recently, with the development of multiomics analysis and single-cell sequencing technology, it has been found that a variety of AEC2 subpopulations participate in the repair and regeneration of lung epithelial cells after acute lung injury and virus infection. A recently identified Axin2
+ AEC2 subpopulation with constitutive Wnt pathway activity comprises a Wnt signaling niche with fibroblasts near each stem cell. When the alveolar epithelium is severely injured, the Axin2
+ AEC2 subpopulation proliferates rapidly and participates in the regeneration and repair of the epithelium [
11]. Axin2
+ AEC2s have also been identified in human lungs and are responsible for the growth of AEC2s in alveolar organoids [
12]. During alveolar damage, macrophage-derived IL-1β primes a subpopulation of AEC2s expressing Il1r1 via the HIF1a pathway, which is essential for the differentiation of mature AEC1s. Il1r1
+ AEC2s are another distinct AEC2 lineage population that plays a crucial role in alveolar repair and regeneration [
13]. SFTPC
+ AEC2s may be a heterogeneous population composed of cell subpopulations with different proliferation and differentiation abilities.
After acute lung injury (ALI)/acute respiratory distress syndrome (ARDS), regeneration is crucial for restoring normal lung structure and function. Thus, promoting endogenous regeneration by progenitor or stem cells to restore lung structure and function may be a new therapeutic perspective for the future therapy of pulmonary diseases [
9,
14]. This highlight needs to better understand the molecular mechanisms of lung regeneration after lung damage. AEC2s are the main stem / progenitor cells participating in lung repair and regeneration after lipopolysaccharide (LPS) induced ALI [
15]. To observe the changes in proteins in the repair microenvironment of AEC2s after ALI, we observed the changes in protein expression in alveoli after acute lung injury by protein mass spectrometry. AEC2s proliferated significantly from 3 days to 5 days post-LPS-induced ALI. During this process, the Hippo-YAP1 signaling pathway was significantly activated, and the pathway inhibitor blocked the proliferation of AEC2s. Therefore, the Hippo-YAP1 pathway plays a crucial role in the proliferation of AEC2s [
16]. However, the mechanism is still not well elucidated. The Hippo signaling pathway plays a role in the regulation of cell proliferation, apoptosis and organ size. Mutations or imbalanced regulation of its key proteins will lead to organ dysplasia, multiple cancers, autoimmune diseases and neurodegenerative diseases. Therefore, we speculated that Hippo-YAP1 might be a key signaling pathway for alveolar repair and regeneration after ALI.
Here, we found that the expression of connective tissue growth factor (CTGF), a downstream effector of the Hippo-Yap1 signaling pathway, increased significantly at different time points after acute lung injury. CTGF can promote the proliferation of a subpopulation of AEC2s which expressing Krt5, both in vitro and in vivo. Therefore, we used SFTPC+ AEC2 lineage tracking mice to further elucidate the molecular mechanism by which CTGF regulates AEC2s subpopulation proliferation and participates in the repair and regeneration of alveoli after ALI. Our study verifies that CTGF contributes to the regeneration of AEC2s subpopulation to enhance alveolar regeneration and that AEC2s subpopulation are stem cells for alveolar regeneration after acute lung injury.
Methods
ALI animal model
Sftpc-CreER
T2 (Strain #:028054, RRID:IMSR_JAX:028054) and Rosa26-RFP (Strain #:007914, RRID:IMSR_JAX:007914) mouse strains were purchased from the Jackson Laboratory. All mice were maintained in the Daping Hospital animal care facility. We constructed an ALI model according to a protocol described previously [
17]. 6 to 8 week-old mice were anesthetized with 60 mg/kg pentobarbital sodium by intraperitoneal injection. Mice were treated with 4.5 mg/kg LPS (Escherichia coli O55:B5, Sigma, L4005) through intratracheal instillation. CTGF (#9237-CT; R&D Systems) treatment was administered via tail vein injection (20 μg/kg) at 24 h after ALI. Mouse experiments were performed on both male and female mice in all conditions, and mice were chosen at random from the cohort but not formally randomized. Animal experiments were carried out under pathogen-free conditions and with randomly chosen littermates of the same sex and matched age and body weight. We conducted all animal care and experimentation in accordance with the Association for Assessment and Accreditation of Laboratory Animal Care guidelines and with approval from the University of Army Medical Animal Care and Use Committees.
In vivo transfection of AEC2-specific Krt5 knockout virus
The Cre-on adeno-associated Cas9 vector (Cre-on AAV-9) was generated for Krt5 gene knockout. Single guide RNAs (sgRNA-F: CACCGGTACAATGTGGGGGGCTCCAA; sgRNA-R:AAACTTGGAGCCCCCCACATTGTACC) targeting the mouse Krt5 gene were designed and cloned into AAV9-GV725 (flex(CMV)-NLS-SaCas9-NLS-3xHA-bGHpA-U6-sgRNA) by BsaI (Shanghai Genechem Co., Ltd.). After packaging, Cre-on AAV-9 was administered via tail vein injection of Sftpc-CreERT2 and Rosa26-RFP mice from Day 1 (100 μl, 1.5 × 1011 v.g./ml). Fourteen days later, the mice were sacrificed, and lung tissue was harvested and used for Krt5 knockdown in AEC2 detection. A negative AAV-9 vector control was also performed.
QRT-PCR analysis
ReliaPrep RNA Cell Miniprep kit (Promega, # Z6010) was used to isolate RNA from freshly sorted Krt5+AEC2s or Krt5−AEC2s from alveolar lavage fluid of patients. cDNA was synthesized using Superscript III (Invitrogen, #18,080,085). PCR reaction and analysis was run on Eppendorf Mastercycler ep realplex2. GAPDH was used as internal controls. Forward Sequence for Krt5: GCTGCCTACATGAACAAGGTGG; Reverse Sequence for Krt5: ATGGAGAGGACCACTGAGGTGT.
FACS analysis and FACS sorting
For FACS sorting, lungs from WT or Sftpc-CreER; tdTomato
+ mice were collected at 6 to 8 weeks of age and processed into a single-cell suspension using dispase, DNase I and collagenase I, as previously described [
15]. The AEC2 population (Sftpc
+ AEC2 cells) was isolated from the lungs of 6–8-week-old Sftpc-CreER; tdTomato
+ mice 5 days after induction with 200 μg/g body weight tamoxifen. Krt5
+ AEC2s and Krt5
− AEC2s were sorted by MoFlo SX (Beckman Coulter, Miami FL). Data were analyzed in Summit 5.2 (Beckman). For FACS analysis and sorting of mouse, the following antibodies were used: CD45 (Biolegend, 103,116, 1:100), LysoTracker (Invitrogen, L7526, 1:14000), EpCAM (Biolegend, 118,206, 1:100), Krt5 (Abcam, ab193895, 1:300), and Edu (50 mg/kg, E10187, Life Technologies). For the FACS analysis and sorting of patients, the following antibodies were used: LysoTracker (Invitrogen, #L7526, 1:14000), CD45 (Biolegend, #368,530, 1:1000), KRT5 (ABcam, #ab193895, 1:1000); EpCAM (Biolegend, #324,220, 1:1000).
Cell culture
AEC2s were cultured in MTEC/Plus, which contained DMEM/F12, 15 mM HEPES, 3.6 mM NaHCO
3, 4 mM L-glutamine, 10 μg/mL insulin, 5 μg/mL transferrin, 0.1 μg/ml cholera toxin, 5% FBS, 0.01 μm retinoic acid and penicillin/streptomycin [
18]. For three-dimensional culture, sorted AEC2s and PDGFRA-GFP
hi fibroblasts (1:200) were seeded in a 24-well 0.4-μm Transwell insert (Falcon). Mixed cells were resuspended in MTEC/Plus mixed with 1:1 growth factor–reduced Matrigel (CAT:356,230, BD Biosciences). Then, 500 μL of MTEC/Plus was placed in the lower chamber, and the medium was changed every other day.
Lineage tracing AEC2s were isolated from mice treated with or without CTGF administration. Total RNA was extracted using a RNeasy Plus Kit (Qiagen, Germany), and 1 μg of RNA was used as input material for the RNA sample preparations. RNA-seq strand-specific libraries were constructed using the VAHTS Total RNA seq (H/M/R) Library Prep Kit (Vazyme, China) according to the manufacturer’s instructions. Cluster was generated by cBot after the library was diluted to 10 pM and then sequenced on the Illumina NovaSeq 6000 platform (Illumina, USA). Library construction and sequencing were performed by Sinotech Genomics Co., Ltd. (Shanghai, China).
We performed a Gene Ontology (GO) analysis for biological processes, cellular components and molecular function and a KEGG pathway analysis (Kyoto Encyclopedia of Genes and Genomes
http://www.genome.ad.jp/kegg) via the enrich R package. We classified DEGs according to the official classification of KEGG annotation results and enriched the path function with Phyper. DIAMOND [
19] was used to map the DEGs onto the STRING [
20] database to determine the interaction between DEG-encoded proteins using homology with known proteins. For the whole interaction result, we provide an input file that can be directly imported into Cytoscape for network analysis.
Image cytometry
LysoTracker green DND-26 (Invitrogen) was added and incubated with the total lung cell suspension at 37 °C for 30 min. After washing with 2% serum HbSS, the cells were incubated with a mixture of primary antibodies, including anti-CD45 (103,116, Biolegend), anti-EpCAM (118,206, Biolegend) and anti-Krt5 (ab193895, Abcam), in PBS for 30 min on ice. After washing, 20,000 cells of each sample were analyzed by ImageStream®X Mark II. CD45−EpCAM+LysoTracker+Krt5+ and CD45−EpCAM+LysoTracker+Krt5− were detected by flow cytometry and image acquisition. Data were analyzed with the IDEAS (Amnis Seattle, USA). Gates for focused and single cells were set according to the manufacturer’s recommendations. All graphs (dot plots, histograms and cell images) and statistics (cell counts and relative amounts) were generated with IDEAS software.
Quantitative western blotting
Automatic western blots were performed using a Wes automated system (ProteinSimple, California, USA). Purified recombinant proteins were used as calibration standards. Serial dilutions of both the sample and standard were used to determine the linear dynamic range of the assay. According to the ProteinSimple kit (SM-W004), the loading order was: ladder and Experimental protein samples; antibody Diluent II; antibody Diluent II and Primary Antibody; streptavidin-HRP and Secondary HRP Conjugate; luminol-Peroxide mix. SW software was used for data generation and analysis. Antibodies against p-LRP6 (ab226758, 1:50), LRP6 (ab134146, 1:10), p-GSK3b (ab68476, 1:100), GSK3b (ab185141, 1:100), β-catenin (ab16051, 1:50), LEF1 (ab137872, 1:10), and β-actin (ab6276, 1:100) were obtained from Abcam. Antibodies against p-β-catenin (4176, 1:100) were obtained from Cell Signaling Technology.
RNAscope
The slides were dewaxed, treated with 100% ethanol and then air dried. Then, specimens were processed according to the protocol of the RNAscope Multiplex Fluorescent Reagent Kit v2 (ACD, 323100, USA). After adding the preheated probe, Sftpc (ACD, 314101, USA), Aqp5 (ACD, 430021-C2, USA), Ki67 (ACD, 416771-C3, USA), Krt5 (ACD, 415041-C4, USA), and P63 (ACD, 472561-C3, USA), we pretreated 1 solution for 10 minutes at room temperature and then pretreated 2 for 15 minutes at 99°C. Tissues were pretreated at 40°C for 30 minutes to increase permeability. The preheated Prox1 mRNA probe was incubated with tissue at 40°C for 2 hours. Signal amplification was achieved by continuously applying six amplifiers at 40°C (Amp 1, 2, 3) and room temperature (Amp 4, 5, 6). The signal was detected using a diaminobenzidine mixture on tissue samples for 10 minutes. Then, opal 520, opal 570, opal 690, and opal 620 fluorescent dyes were added to label the probe signal. Nuclear restaining followed the RNAscope procedure and was performed with modified Lille’ hematoxylin (Dako, Carpineria, USA).
Fluorescence resonance energy transfer detection
Fluorescence resonance energy transfer (FRET) efficiency was assessed by acceptor bleaching. Purified AEC2s were treated with CTGF (10 ng/mL). After droplet formation, imaging was performed on a Leica STELLARIS 5 confocal laser scanning microscope with the LAS X FRET AB module. Briefly, droplets of interest were zoomed in upon, a region in which the Krt5-LRP6 interaction occurred was highlighted and the program was initiated. For photodestruction of the interaction, cells were photobleached with a 488-nm laser line. Images were captured in these channels before and after photobleaching. Approximately 10 droplets were measured in the experiments. The FRET efficiency was calculated as E = (1- Pre/Post) 3100%, where Pre and Post represent the intensity of donor fluorescence before and after photobleaching.
PCR panel assay of wnt signaling pathway gene expression
The QuantiNova LNA PCR Focus Panel Mouse WNT Signaling Pathway (Qiagen, #249,950 SBMM-043ZA) enables quick gene expression analysis of the WNT signaling pathway using SYBR Green-based qPCR. Total RNA was extracted using a QIAGEN RNeasy Plus Kit. First-strand cDNA was synthesized from 1 μg of RNA using the iScript cDNA Synthesis kit (#1,708,890, Bio–Rad). Briefly, 20-μl reactions were prepared by combining 4 μl of iScript Select reaction mix, 2 μl of gene-specific enhancer solution, 1 μl of reverse transcriptase, 1 μl of gene-specific assay pool (20×, 2 μM), and 12 μl of RNA diluted in RNase-free water. Quantitative real-time PCR was carried out using synthesized cDNA, primers, and SsoFast EvaGreen Supermix (#172–5204, Bio–Rad). The expression levels of target genes were calculated using the ddCt method relative to the expression of a housekeeping gene, β-actin. The data shown are the relative quantity (RQ), with the RQ of the control cells set to one.
Histology and immunostaining
Lungs were fixed with 4% paraformaldehyde in phosphate-buffered saline. Immunofluorescence staining was performed on cryosections or paraffin sections. Primary antibodies and dilutions were as follows: Sftpc (Millipore, Ab3786, 1:1,000), Aquaporin 5, AQP5 (Abcam, ab78486, 1:1,000), T1a (Sigma, P995, 1:400), Edu (Beyotime, C0081S), Ki67 (Abcam, ab231172, 1:400), Krt5 (Abcam, ab193895, 1:300), EpCAM (Abcam, ab221552, 1:200), CD45 (Biolegend, 103,116, 1:100), Lysotracker (Invitrogen, L7526), and p63 (Abcam, ab735, 1:200). The secondary antibodies were Alexa Fluor 488 (Abcam, ab150081, 1:400) and Alexa Fluor 594 (Abcam, ab150120, 1:400). Images were obtained using a Zeiss confocal microscope and Delta Vision Elite (Applied Precision).
Patient samples
The BALF samples of 30 ARDS patients were collected from Daping Hospital of the Army Medical University. The collection of samples was approved by the institutional review board. Basic demographic and clinical data, including age, sex, partial pressure of arterial oxygen/fraction of inspired oxygen (PaO
2/FiO
2), timing of the diagnosis of ARDS and clinical outcomes, were retrieved from the registry (Table
S1). Patients were excluded if they had preexisting respiratory, cardiovascular, renal, hepatic, immunologic or hematologic diseases. Thirty ARDS patients were stratified into mild, moderate, and severe ARDS according to chest imaging, origin of edema and PaO
2/FiO
2[
21].
Data analysis and statistics
Unpaired Student’s t tests were used to compare the means of two groups. One-way analysis of variance (ANOVA) was used for comparisons among several groups. When ANOVA yielded significant differences, post hoc testing of differences between groups was performed using the least significant difference (LSD) test. The Kaplan–Meier method was used to comparedifferences in mortality rates between groups. Statistical significance was set at P values < 0.05. GraphPad Prism 7.0 software was used for statistical analysis, and statistical charts were generated. Adobe Illustrator CC (version 18.0.0, 32-bit) and Adobe Photoshop CS6 software (version 13.0.1, 64-bit) were used to construct mechanism diagrams and reasonably adjusted pictures.
Discussion
The pathological basis of ALI/ARDS is diffuse alveolar injury. The severity of alveolar injury directly affects gas exchange function and determines the prognosis of patients with ALI/ARDS. Therefore, ameliorating alveolar tissue repair and regeneration after ALI and restoring the normal structure and function of the blood-air barrier is an effective strategy to treat ALI/ARDS. The lung is an organ with certain self-repairing potential, and injury is an essential factor to activate the self-repairing potential of lung tissue [
30]. Systematically revealing the self-repair mechanism and regulation of alveolar epithelial cells after ALI may provide prevention and treatment measures for ALI/ARDS.
Therefore, many studies have focused on exploring the stem/progenitor cell populations involved in alveolar repair and regeneration. Zuo et al. elucidated a group of distal airway basal stem cells of Krt5
+p63
+ (distal airway stem cells, DASCs), which give rise to collections of Krt5
+ basal cells (or pods) in severely damaged areas of H1N1 influenza-injured mouse lungs and then proliferate and differentiate and participate in alveolar repair and regeneration [
25,
31,
32]. In this study, we found that there were almost no Krt5 positive cells in the alveoli when the lung was in homeostasis. However, after ALI induced alveolar damage, a group of Krt5
+SPC
+ cells appeared in the alveoli. They did not express p63 at either the transcriptional or protein level. One of the limitations of our study is that we did not use the Krt5 lineage mice to track the origin of this subgroup of Krt5 and SPC positive cells in vivo. Therefore, it is unclear whether this subgroup of cells originated from the airways. They might also be p63
+Krt5
+SPC
− airway cells that migrated to the alveoli and might be mobilized to acquire SPC expression. Then these cells are stimulated by residual tamoxifen in mice to obtain SPC lineage markers. So they were not AEC2s in the beginning, but lose p63 expression after acute lung injury and acquire SPC. It is also possible that p63
−Krt5
+airway cells might migrate to the alveoli and express SPC.
Effective and coordinated tissue repair is crucial to maintain the integrity and function of the lung. When responding to inflammatory assault, it is critical to perceive the changes in the inflammatory environment and start repair and solve the damage according to the corresponding inflammatory factor microenvironment. Here, we elucidated some new findings related to endogenous stem/progenitor cells in lung repair after acute lung injury. First, we provide evidence by protein mass spectrometry analysis that CTGF treatment can significantly promote the repair and regeneration of alveoli after ALI and improve the survival rate of mice post ALI. Organoid analysis showed that CTGF can strongly promote the proliferation of AEC2s in vivo. CTGF is a double-edged sword for lung development and the maintenance of homeostasis. It plays an important role in the proliferation and differentiation of AEC2s. However, when excessive, it may cause pulmonary fibrosis [
33‐
35]. We observed a dose-dependent effect between CTGF and pulmonary fibrosis after ALI. Twenty μg/kg is a safe dose and can promote alveolar repair after ALI without causing pulmonary fibrosis. Doses greater than 100 μg/kg can cause pulmonary fibrosis.
Then, we found that a group of SPC
+ cells also expressed Krt5 through RNA-seq analysis of AEC2 treated with CTGF after ALI. Image flow cytometry confirmed the expression of Krt5 in SPC
+ subpopulation and found that they are important stem / progenitor cells involved in mouse alveolar repair and regeneration after ALI. The proportion of proliferated Krt5
+SPC
+ cells in AEC2s increased after CTGF administration, and they had stronger proliferation potential than Krt5
−SPC
+ cells, indicating that CTGF administration promoted the increase in Krt5 expressing AEC2s in mouse lungs after ALI and that Krt5
+SPC
+ cells are an important subpopulation of stems / progenitors in lung regeneration after ALI. LRP6 is a co-receptor with the CTGF and Wnt signaling pathways. Wnt signaling is a key pathway in modulating the AEC2-to-AEC1 transition and regulates the proliferation of AEC2s [
12,
36]. CTGF can regulate the proliferation of Krt5
+SPC
+ cells by activating LRP6 phosphorylation and the Wnt signaling pathway can then promote the repair and regeneration of alveoli. Krt5
+SPC
+ cells are a crucial subpopulation that promote the regeneration of functional alveolar epithelium by regeneration of AEC2s after acute lung injury. We also confirmed the presence of Krt5
+SPC
+ cells in human bronchoalveolar lavage fluid and human distal lung tissue. The preservation and accessibility of mouse and human Krt5
+SPC
+ cells provide an opportunity to elucidate the mechanism of human lung stem/progenitor cell biology and contribute to the development of new therapies for acute lung injury. The proportion of Krt5
+SPC
+ cells in severe ARDS patients was higher than those in moderate and mild ARDS patients, further supporting an essential role of Krt5
+SPC
+ cells in human acute lung injury and suggesting that Krt5
+SPC
+ cells may be a potential biomarker for ARDS severity. In summary, our study verifies that CTGF promotes the repair and regeneration of alveoli after acute lung injury by promoting the proliferation of Krt5
+SPC
+ cells which are stem cells in alveolar repair and regeneration.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.