Introduction
A major challenge in neocortical development is to recruit diverse cell types into their proper layers and circuitries [
27]. This is illustrated by the fact that multiple cortical malformation disorders exhibit an altered laminar organization of the cortex [
17,
45,
54]. Neocortical development can roughly be divided into two major steps. First, diverse neocortical neurons are generated from progenitor cells within the ventricular and subventricular zones (VZ and SVZ). Radial glial progenitors (RGPs) first undergo self-renewal, before progressively switching to asymmetric division, producing one daughter RGP, and one daughter cell which is determined to become a neuron [
40]. Mitosis only occurs if the RGP nucleus has migrated down to the apical ventricular surface in a movement known as interkinetic nuclear migration (INM) [
21]. After asymmetric cell division, one of the daughter cells detaches from the ventricular surface and migrates to the SVZ. There, most become intermediate basal progenitors (iBPs) before dividing symmetrically to generate cortical projection neurons.
The second step in neocortical development is the movement of cells from their place of birth to their final destination. This process can be described as a sequence of three modes of migration, correlated with different cellular morphology of the nascent neurons [
28,
42]. First, the newborn neurons acquire a multipolar morphology and migrate in random directions in the VZ and SVZ [
38,
57], before moving towards the subplate (SP). In the upper intermediate zone (IZ), they gradually convert into bipolar cells by forming one long trailing process, which later becomes the axon. Additionally, a single leading edge is extended in the direction of the pia, giving rise to the future dominant dendrite. Following this transition, the bipolar neurons enter the CP and migrate in a locomotion mode towards the pia by using the basal processes of RGPs as a guide for radial migration [
26,
42]. During bipolar locomotion, the leading edge of the neuron grows continuously towards the pial surface, while the nucleus follows in a saltatory fashion [
59]. It has been proposed that translocation of the centrosome and subsequent nuclear movement via cytoskeleton remodeling and motor protein activity is essential for radial bipolar migration in the CP [
14,
37,
59]. Finally, neurons complete their radial migration and execute glia-independent terminal somal translocation and initiate maturation. In the last two decades, an increasing number of proteins have been found to play an essential role in these processes. One of these proteins is the dynein activating adaptor protein Bicaudal-D2 (BICD2). So far, studies have shown that BICD2 is involved in RGP-related processes such as INM. However, the role of BICD2 in the migration of post-mitotic cortical neurons remains largely unclear.
Bicaudal-D2 (BICD2) is a dynein activating adaptor protein that plays a critical role in microtubule-based minus-end-directed transport. Motor adaptors allow for cargo-specific regulation of the dynein motor complex [
44]. BICD2 activates dynein by enhancing the stability of the complex with dynactin, which leads to processive motility toward the microtubule minus end [
19,
49]. In
Drosophila, BicD was found to control nuclear positioning, endocytosis and lipid droplet transport, as well as dynein-mediated microtubule-dependent transport processes [
6‐
8,
56]. Mammals possess two BicD orthologues: BICD1 and BICD2. Both these proteins are built from several coiled coil domains, which adopt a rod-like structure [
55,
61]. The two N-terminal coiled coil domains of BICD2 bind to cytoplasmic dynein and dynactin [
20], which has been shown to be important for activating the dynein motor complex. With its third C-terminal coiled coil domain (CC3), BICD2 binds to cargoes such as the small GTPase RAB6 and nucleoporin RANBP2. RAB6 localizes to the Golgi apparatus and exocytotic/secretory vesicles, and through these interactions BICD2 can contribute to Golgi organization and vesicle transport [
16,
51]. In a cell-cycle regulated manner, BICD2 can switch from RAB6 to RANBP2 binding, which leads to dynein-dynactin recruitment to the nuclear envelope [
52].
Mutations in the human BICD2 have been linked to a spectrum of neuronal disorders, in particular to a dominant mild early onset form of spinal muscular atrophy (SMALED2A: OMIM#615290) [
35,
39,
41]. Interestingly, expressing mutant BICD2 in
Drosophila muscles has no obvious effect on motor function, while neuron-specific expression resulted in reduced neuromuscular junction size in larvae and impaired locomotion of adult flies [
30]. Combined with the observation that mutant BICD2 causes axonal aberrations and increased microtubule stability in motor neurons points to a neurological cause of the disease [
30]. More recently, a p.Arg694Cys (R694C) mutation in the C-terminal CC3 RAB6/RANBP2-binding domain of BICD2 was found to be associated with severe neuromuscular defects, but also disordered cortical development with in utero onset [
43]. This disease has been classified as the neuronal disorder SMALED2B (OMIM#618291) [
53]. As such, BICD2 seems associated with human malformations in cortical developments such as polymicrogyria (PMG), and the spectrum of BICD2-associated malformations overlaps with the wide spectrum of developmental abnormalities found in patients with DYNC1H1 mutations [
11]. This leads to the speculation that BICD2 might play a different role in dynein-mediated processes in different brain regions, as well as in mitotic versus post-mitotic cells. Although there is strong human genetic evidence that BICD2 plays an important role in the development of the nervous system, it is poorly understood which cellular and molecular function of BICD2 is altered in these patients, and particularly little is known about the role of BICD2 during cortical development. Since PMG is thought to be a late neuronal migration defect [
25], we hypothesized a pivotal role for BICD2 in neuronal migration.
Previous studies have shown that in the mouse cerebellum, depletion of BICD2 leads to severe lamination defects. The migration of cerebellar neurons is entirely dependent on
Bicd2 expression in Bergmann glia cells, while
Bicd2 is not expressed in cerebellar neurons [
24]. In the cortex, BICD2 knockdown by in utero electroporation (IUE) was reported to cause impaired neurogenesis and early migration defects. These defects, at least in part, were found to follow from disrupted INM and aberrant mitosis in RGPs [
21]. However, RGPs in the cerebral cortex give rise to both neurons and glia cells, and also act as scaffolds for radial migration [
40]. This makes it difficult to differentiate between potential glia- and neuron-specific defects, and to decipher to which extent defects in cortical organization follows from abnormal neurogenesis or from impaired cortical neuron migration.
To define the precise role of BICD2 during cortical development and in particular to dissect its specific function in excitatory neurons versus RGPs in vivo, we compared two conditional knock-out (cKO) mouse lines. Emx1-driven Bicd2 cKO mice, which are BICD2-deficient in RGPs and post-mitotic neurons, were compared with Nex-driven Bicd2 cKO mice, which are only BICD2-deficient in post-mitotic migrating neurons. We show that BICD2 is expressed in developing cortical neurons and that radial cortical migration and corticogenesis predominantly depends on BICD2 function in post-mitotic neurons. Neuron-specific BICD2-KO mice showed severely impaired radial migration of late-born upper-layer neurons, and single-neuron labeling revealed a specific role for BICD2 in bipolar locomotion during neuronal migration. BICD2 depletion in cortical neurons interfered with Golgi apparatus organization in the leading edges and caused apoptotic cell death of cortical plate neurons. Using rescue experiments with disease-related Bicd2 mutations, we found that a specific mutation in the RAB6/RANBP2-binding-domain, which is associated with human cortical malformations, fails to restore proper cortical neuron migration. Together, these findings demonstrate a novel, cell-intrinsic role of BICD2 in cortical neuron migration in vivo and provide new insights into dynein-mediated functions during cortical development, and the role of dynein in cortical malformations.
Discussion
In this study, we show that the cell-intrinsic expression and function of BICD2 in excitatory cortical neurons is essential for proper radial neuron migration and neocortical development in vivo. We generated two cell-type specific conditional Bicd2 KO mouse lines and compared the corticogenesis in the Emx1-KO with the neuron-specific Nex-KO. In contrast to the expression and function of BICD2 in the cerebellum, and to the downregulation of Bicd2 by RNAi via IUE, our results indicate that the development of the mouse neocortex in vivo mainly depends on Bicd2 expression and function in post-mitotic neurons, rather than in RGPs.
Loss of BICD2 in cortical neurons disturbs corticogenesis by impeding the radial migration of upper-layer excitatory neurons and formation of the classical mammalian inside-out cortex and interferes with the formation of well-bundled axon tracts in the IZ. Interestingly, early-born neurons which have to migrate shorter distances were much less affected in their migration in BICD2 depleted mice than late-born, far travelling neurons. It is widely accepted that early-born neurons show different radial migratory behavior than late-born neurons. These subsets of neurons are regulated by distinct cellular mechanisms [
28]. In early cortical development, neurons do not pursue a multipolar, locomotion and terminal somal translocation mode. Instead, first-born neurons inherit the long basal process from their RGPs [
32]. This process is attached to the pial surface and after detaching from the VZ, the neurons migrate upwards by continuous somal translocation [
9,
40]. Later, when the IZ starts to form, later-born neurons will first migrate while they are multipolar until they reach the top of the IZ. There, they become bipolar and change to a locomotion mode which is characterized by a continuous growth of the leading edge and the saltatory movement of the nucleus which follows the leading edge growing in the direction of the pia [
34,
46]. When the leading process reaches the pia, the tip anchors to the pia and the nucleus migrates via terminal somal translocation smoothly up the leading process. The leading process appears to function as a `grapple` for towing the soma with the nucleus [
9]. Despite the fact that the migration of upper-layer neurons in locomotion mode occurs in a RGP-guided manner [
9,
40], and slightly disorganized RGP fibers were observed in Emx1-KO, the migration defects we observed in the Emx1-KO were the same as in the neuron-specific Nex-KO. This indicates that radial migration in the cortex depends on the cell-intrinsic function of BICD2 in neurons and is not caused by non-cell-intrinsic effects via RGPs. This neuronal cause of the observed defects in the cerebral cortex corresponds to the neuronal cause shown in
Drosophila [
30], pointing to a neuronal basis for SMALED2A/B in patients.
We speculate that the long-distance movement of the nucleus in the locomotion mode is regulated by distinct cell-intrinsic molecular mechanisms, which depend much more on dynein and the coupling of the nuclear envelope to dynein via RANBP2 and BICD2 than the short-distance migration of early-born deeper-layer neurons. In line with this, TBR1+ deeper-layer neurons showed no significant impairment in their radial migration in both
Bicd2 cKO lines (Additional file
2:
Fig. S2), while upper-layer SATB2+ or CUX1+ cells were severely affected in their locomotion (Figs.
1,
2). These observed altered distributions in cKO mice suggest defects in radial migration of these neurons and raises the question whether loss of BICD2 leads to a global inversion of cortical layering, or is caused by later born neurons being unable to cross layers of previously generated neurons and thereby failing to reach more superficial destinations. If these neurons fail to reach more superficial destinations, the question remains if this is due to a failure to migrate or a delay in neuronal migration. Further studies will have to elucidate if
Bicd2 cKO mice have a global inversion of cortical layering, or if the observed defects are the result of non-migrating layer II/III neurons, or delayed radial neuronal migration. Interestingly, the upper-layer neurons that have to migrate longer distances through the cortical plate were mainly affected in their migration in cKO mice. The immuno-stained nuclei of upper-layer neurons in Nex-KO and Emx1-KO mice were found in the upper SVZ and IZ at a position in the developing cortex where migrating neurons transition from multipolar to bipolar cell morphology and switch from multipolar migration to bipolar locomotion migration mode. For the transition from multipolar to bipolar the regulation of MT and actin dynamics and the reorganization of the cytoskeleton are known to be essential and many microtubule-regulating factors are involved in the multipolar-to-bipolar transition. Interfering with these processes impairs the required morphological changes of the migration neurons before entering the CP, resulting in an accumulation of non-migratory multipolar neurons in the SVZ [
40]. Therefore, it is plausible that BICD2 is required for this morphological transition. However, the depletion of BICD2 does not appear to impede the this transition, but instead mainly impairs bipolar locomotion in the CP (Fig.
3), pointing to the different molecular regulation mechanisms at distinct steps of cortical migration and the specific role of BICD2 in dynein mediated transport mechanisms during radial migration in the neocortex. For the migration of bipolar neurons in locomotion mode in the CP, long-distance MT-based transport mechanisms of cell organelles become predominant.
Our labeling of individual neurons in
Bicd2 cKO mice via ex vivo electroporation demonstrates the essential role of BICD2 in the nuclear migration of bipolar locomoting neurons. In contrast to the unimpeded cytoskeleton-dynamic based mechanisms like outgrowth and elongation of leading edges and axons, the migration of neuronal soma was severely impaired in BICD2 depleted cortical neurons. This defect could be fully rescued by the overexpression of wildtype BICD2 in Emx1-KO and Nex-KO cortices. In addition to BICD2_FL rescue, we also attempted rescue experiments with mutant BICD2 to address the cell-intrinsic cellular and molecular function of specific BICD2 domains in cortical migration in vivo. While the full-length wildtype BICD2 fully rescued neuronal migration phenotypes, expression of BICD2_S107L, which is the most commonly found
Bicd2 mutation in SMALED2A patients and has been suggested to increase binding to dynein-dynactin only partially rescues the KO phenotype. Similar to BICD2_FL rescue, migrating neurons could reach the upper layers of the cortex, suggesting partially restored migration capabilities. While it seems that overexpression of SMALED2A mutants does not impair locomotion mode migration, we identified the SMALED2B mutation R694C as the only point mutation which could not restore neuronal migration defects in the mouse neocortex. R694C, which has recently been reported to be associated with cortical malformations in patients, was the only tested mutant BICD2 that failed to rescue neuronal migration defects in Nex-KO mice. Since endfeet positions appeared unaffected and just the soma were found at lower position than after the successful rescue with BICD2_FL, it is tempting to speculate that the mutated region in BICD2_R694C is specifically important for nuclear migration in locomoting neurons. R694C is located in the third coiled coil domain of BICD2, which is necessary for binding to RAB6 and RANBP2 [
52]. In mitotic cells, it is known that there is a cell-cycle regulated switch between RAB6 and RANPB2 binding [
52]. Future research will have to elucidate if such a switch also occurs in post-mitotic neurons, as the interaction between the nuclear envelope and dynein during neuronal migration in locomotion mode is thought to be relevant. Interestingly, the K758M and E774G mutants, which are also located in CC3 and known to have no or reduced RAB6 binding, could partially rescue the observed KO phenotype. Therefore, it seems likely that the R694C mutation has a different impact than these two mutations on the functionality of the CC3 domain.
In addition to impaired somal migration in cortical neurons of the developing cortex, we found that the depletion of BICD2 also caused severe defects in Golgi organization in CP neurons (Additional file
3:
Fig. S3). Since our single cell labeling with GFP transfection via EVE or by placing DiI crystals clearly revealed that CP neurons in the cKO mice do become bipolar and form a leading edge, we conclude that the observed Golgi disorganization is not a secondary effect of non-polarization and not forming a leading edge in radial orientation, but a specific result of
Bicd2 loss-of-function in bipolar cortical neurons. Therefore it is also possible that the interaction of BICD2 with Golgi-bound RAB6 might be relevant for proper cortical neuron migration, possibly via regulating the dynein-dependent elongation of the trans-Golgi into the leading edges. So far, it has not been determined whether alterations at amino acid 694 affect BICD2 interactions with RAB6 or RANBP2. Future studies will have to dissect these interactions and their relevance in cortical neurons, as the other two mutations in the third coiled coil domain were able to rescue neuronal migration defects. This suggests that BICD2-RAB6 interaction might not be essential to locomotion mode migration, but possibly in neuronal survival. We observed increased cell death after depletion of BICD2, and since the K758M homologue is a lethal mutation in
Drosophila, the interaction with RAB6 might be important for Golgi integrity and as such cell survival.
With the Golgi-related phenotypes of
Bicd2 cKO mice in mind, it also becomes interesting to look at minor characteristics of cKO migratory neurons which can be visualized using single cell labeling via EVE: we noticed that the endfeet of the leading edges in BICD2 deficient mice which still reached the marginal zone, showed more extensive branching (Fig.
3a,b). Initiation of neurite branching occurs randomly, and MT stabilization contributes to branch maintenance [
9]. The organization of the Golgi apparatus and MT organization and stabilization are known to influence each other [
18,
29] and MT abnormalities are known to cause Golgi fragmentation [
23]. As such, it is tempting to speculate that the observed disorganized Golgi in neurons of cKO mice might be an indication for changes in MT organization. Alternatively, the presence of Golgi fragments in leading edge branches might locally influence the branching process.
Notably, the Golgi disorganization was not a secondary effect of non-polarization or apoptosis, but was a general defect observed in most neurons in the CP of the cKO mice. BICD2 deficient neurons also acquired a bipolar morphology and the majority of neurons with disturbed Golgi organization were still negative for cleaved Caspase-3. We speculate that the increased cell death in developing
Bicd2 cKO cortices might be the result of impaired neuronal migration and Golgi disorganization rather than vice versa. Notably, the severely enhanced apoptosis in the maturing SP and CP neurons of Nex-KO and Emx1-KO does not seem to significantly alter total number of excitatory CP neurons (Figs.
1,
2). However, in view of the total amount of neurons in the CP, the relatively small number of cell affected by increased cell death may fail to illicit a significant reduction in this total number.
While cortical malformations seem to be caused by the loss of BICD2 function in post-mitotic neurons, we observed notable mitotic defects in Emx1-KO mice. In agreement with previously reported effects of
Bicd2 knockdown [
21], reduced progenitor division at the VS of Emx1-KO mice in vivo was observed: we found that the spatiotemporal regulation of the RGP cell cycle was affected in Emx1-KO mice (Figs.
6,
7) and that an increased amount of RGPs failed to undergo INM. Interestingly however, the number of cells undergoing mitosis was not reduced: we found that RGPs still underwent mitosis, but at an ectopic position. This KO-phenotype is a novel finding and appears to be specific for BICD2 function in progenitor proliferation and differentiation
. The changed morphology, chromatin condensation and location of the nucleus and centrosome of sub-apical PH3+ progenitors in Emx1-KO mice hint at the presence of two distinct progenitor populations. One population of PH3+ progenitors retains a radial morphology but is impaired in mitotic progression, possibly because the nucleus is stuck in the upper VZ and not able to reach the centrosome. In the second population of progenitors, in which the centrosome lies adjacent to the nucleus, mitotic progression is not impaired. This might be caused by a detachment from the VS, which is supported by the more basal position of their nuclei and lack of radial morphology. Since we observe that centrosomes localized within apical processes of sub-apical mitotic cells, it is possible that the centrosome migrates towards the nucleus when apical nuclear migration is impaired. This could cause a subsequent detachment from the VS, since centrioles at the VS are required for apical attachment by forming the basal body of the primary cilium at the apical end feet [
5,
22,
60].
In summary, our comparative studies of cell-type specific Bicd2 conditional knock-out mice show for the first time that dynein-adaptor protein BICD2 has an essential cell-intrinsic role in radial neuronal migration and neuronal survival in the mammalian neocortex. Systematic comparison between Nex- and Emx1-driven knock-out mice allows us to confidently state that neuron-specific function of BICD2, rather than function of BICD2 in neurogenesis, is important for proper cortical development. The fact that we could rescue neuronal migration defects by overexpressing BICD2, but not by overexpressing mutant BICD2_R694C – associated with cortical malformations in humans – in cKO background, might provide an explanation for the cortical defects observed in patients. As such, loss of cell-intrinsic BICD2 functions in radially migrating cortical neurons might explain PMG-like malformations in humans.
Materials and methods
Animals
All applicable international, national, and institutional guidelines for the care and use of animals were followed. All experiments with material from mice were performed in compliance with the guidelines for the welfare of experimental animals issued by the Government of The Netherlands, and were approved by the Animal Ethical Review Committee (DEC) of Utrecht University (permit number 2014.I.03.020 and AVD1080020173404).
Generation of conditional knock-out mice
To generate the conditional BICD2 KO mouse lines
Bicd2fl/fl;Nex-Cre+/− mice and
Bicd2fl/fl;Emx1-Cre+/− homozygous floxed BICD2 mice [
24] were first crossed with heterozygous Nex-Cre or Emx1-Cre mice. The
Bicd2fl/+;Nex-Cre+/− or Bicd2fl/+;Emx1-Cre+/− offspring was crossed or backcrossed with
Bicd2fl/fl mice to establish
Bicd2fl/fl;Nex-Cre+/− and
Bicd2fl/fl;Emx1-Cre+/− cKO mouse lines. For all experiments
Bicd2fl/fl;Nex-Cre+/− or
Bicd2fl/fl;Emx1-Cre+/− mice were backcrossed with
Bicd2fl/fl mice and
Bicd2fl/fl;Nex-Cre+/− (referred to as Nex-KO) and
Bicd2fl/fl;Nex-Cre−/− mice (referred to as Nex-WT) or
Bicd2fl/fl;Emx1-Cre+/− (referred to as Emx1-KO) and
Bicd2fl/fl;Emx1-Cre−/− (referred to as Emx1-WT) from the same litter were analyzed.
Genotyping of cKO mice
DNA was isolated from earclips (adult mice) or tail tissue (embryos) and standard or touchdown genotyping-PCRs were performed using DreamTaq DNA polymerase (ThermoScientific) and the following primers for detecting the Bicd2 floxed allele: Primer 75 CGGCGGCATCAGAGCAGCCG; Primer 76 GTAGCACTTCAGGAACATCCATGC; Primer 77 GGAGAAGATCTCATCTTGGCAGG, for detecting the Nex-Cre allele: Primer Nex_as 3132 AGAATGTGGAGTAGGGTGAC; Primer Nex148_s 3131 GAGTCCTGGAATCAGTCTTTTTC; Primer Cre_a 2409 CCGCATAACCAGTGAAACAG, for detecting the Emx1-Cre allele: Primer 1084 GCGGTCTGGCAGTAAAAACTATC; Primer 1085 GTG AAACAGCAT TGCTGTCACTT; Primer 4170 AAGGTGTGGTTCCAGAATCG; Primer 4171 CTCTCCACCAGAAGGCTGAG.
DNA constructs
BICD2 mutant constructs were generated from wildtype mouse BICD2 (annotated under the accession number AJ250106). Mouse and human BICD2 sequences were aligned and residues corresponding to human mutations were identified. Mutations were introduced using PCR-based strategies (primer list: Additional file
6: Table S1). Constructs were cloned into the pGW1-CMV (British Biotechnology) expression vector. In addition, we used the following plasmids that were previously described: pGW1-GFP-BICD2 [
48], pGW1-GFP-BICD2-K758M [
49], MARCKS-GFP [
47].
All constructs were generated by PCR amplification using primers mentioned above (Additional file
6: Table S1). Additional information available on request.
Antibodies and reagents
Antibodies used in this study: Mouse anti-Actin (clone nr. C4, MAB1501R, Chemicon); Rabbit anti-BICD2 (HPA023013, Atlas Antibodies); Rabbit anti-BICD2 #2293 (homemade, [
24]); Rabbit anti-BICD1/2 #2294 (homemade, [
24]); Rabbit anti-Caspase-3 (clone nr. Asp715, 9661S, Lot 43, Cell Signalling); Rat anti-CTIP2 (ab18465, Abcam); Rabbit anti-CUX1 (Santa Cruz); Chicken anti-DCX (anti-doublecortin, ab153668, Abcam), Rabbit anti-GFP (598, MBL; ab290. Abcam); Mouse anti-GM130 (610823, BD), Mouse anti-Nestin (611658, BD), Mouse anti-Nestin (rat 401, MAB535, Millipore); Mouse anti-NeuN (MAB377, Millipore); Rabbit anti-NeuN (ab177487, Abcam); Chicken anti-Neurofilament_heavy_200kD (ab72996, Abcam); Rabbit anti-PAX6 (ab5790, Abcam); Rabbit anti-PAX6 (clone nr. Poly19013, 901301, ITK Diagnostics); Mouse anti-PAX6 (clone nr. AD2.38, ab78545, Abcam); Rabbit anti-Pericentrin (923701, ITK Diagnostics); Mouse anti-Pericentrin (611815, BD), Mouse anti-Phospho-Histone H3 (Ser10) (clone nr. 6G3, 9706, Cell Signaling); Rabbit anti-Phospho-Histone H3 (Ser10); Mouse anti-Satb2 (clone nr. SATBA4B10, ab51502, Abcam); Rabbit anti-TBR1 (ab31940, Abcam); Rabbit anti-TBR2 (ab23345, Abcam); Mouse anti-Tubulin-alpha (clone nr. B-5-1-2, T-5168, Sigma); Mouse IgG2b anti-Vimentin phospho S55 (clone 4A4, ab22651, Abcam); Alexa405-, Alexa488-, Alexa568- Alexa594 and Alexa647-conjugated secondary antibodies (Life Technologies); IRdye800CW-conjugated secondary antibodies (LI-COR Biosciences). Other reagents used in this study include: DAPI (Sigma); Fast Green FCF (F7252, Sigma): NeuroTrace™ DiI Tissue-Labeling Paste (N22880, ThermoFisher).
Immunoblotting
Whole cortical extracts were made by isolating cortices from E17.5 brains from individual embryos and homogenizing and lysing the cortices in modified RIPA buffer (50 mM HEPES, pH 7.4, 1% Sodium deoxycholate, 20 mM Na4P2O7, 0.1% SDS, 150 mM NaCl, 10% Glycerol, 1.5 mM MgCl2 and complete protease inhibitor (Roche)). Extracts were centrifuged and the supernatants were boiled in SDS-page sample buffer containing DTT and 15 mg loaded on a Tris-Glycine SDS-polyacrylamide gel and blotted on nitrocellulose membranes. Blots were blocked in 4% milk in PBS-T (0.05% Tween20) followed by primary and secondary antibody incubation prior scanning with an Odyssey infrared imaging system (Li-COR Biosciences).
Immunohistochemistry
Brains were isolated at embryonic day 14.5 or 17.5, shortly rinsed with PBS, fixed in paraformaldehyde for 2.5 or 4.5 h at 4 °C respectively, washed with PBS and transferred to 30% sucrose overnight for cryoprotection prior to freezing in Jung Tissue freezing medium (Leica). Brains were cut in 12 μm coronal sections on a freezing microtome (Leica) and collected on Thermo Scientific Superfrost Plus™ microscope slides. Sections were washed in PBS, heated in a microwave for antigen retrieval for 10 min in Sodium Citrate buffer (10 mM, pH 6) at 97o C, washed in PBS and blocked for 1 h using 10% normal goat serum with 0.2% Triton X-100 in PBS followed by primary and secondary antibody incubation in blocking solution, both at 4o C ON. Slides were mounted using Vectashield mounting medium with DAPI (Vectorlabs) and sealed with nail polish prior to confocal microscopy.
Ex vivo electroporation
Embryonic heads were isolated at E14.5, and brains were electroporated with 1.5µl DNA mixture containing MARCKS-GFP vector and the indicated BICD2 constructs dissolved in Milli-Q water with 0.05% Fast Green FCF dye (Sigma). DNA mixture was injected in the lateral ventricles of the embryonic brains using borosilicate glass micro-pipettes (World Precision Instruments) and a PLI-100A Pico-liter injector (Warner Instruments). Brains were electroporated with platinum plated tweezer-electrodes (Nepagene) using an ECM 830 Electro-Square-Porator (Harvard Apparatus) set to three unipolar pulses at 30 V (100 ms interval and pulse length). Embryonic brains were then isolated and collected in ice-cold cHBSS, embedded in 3% SeaPlaque GTG Agarose (Lonza) in cHBSS and sectioned coronally in 300 µm slices using a VT1000 S Vibratome (Leica). Slices were collected on poly-L-lysine and laminin-coated culture membrane inserts (Falcon), placed on top of slice culture medium (70% v/v Basal Medium Eagle, 26% v/v cHBSS, 20 mM D-Glucose, 1 mM L-Glutamine, 0.1 mg/mL penicillin/streptomycin) and cultured for 4 days prior to fixation with 4% paraformaldehyde in PBS. Slices were then blocked and permeabilized in 10% Normal Goat Serum with 0.2% Triton X-100 in PBS followed by primary (anti-GFP) and secondary antibody incubation (containing DAPI) in blocking solution. Slides were mounted using Vectashield mounting medium with DAPI (Vectorlabs) and sealed with nail polish prior to confocal microscopy.
DiI labeling
At embryonic day 17.5 brains were isolated, shortly rinsed with PBS, fixed in paraformaldehyde for 1 h at 4 °C, washed with PBS and embedded in low melting agarose. Brains were cut in 200 μm coronal sections on a vibratome (Leica), collected on frosted microscope slides and covered with PBS. Gel containing DiI crystals (NeuroTrace™ DiI Tissue-Labeling Paste, N22880, ThermoFisher) was placed with a needle in the IZ. Sections were incubated for 30 h at 37 °C in a wet chamber to label the membranes of the DiI-targeted contra-lateral and cortico-fugal projecting neurons in the developing cortex. Z-stack acquisitions were taken within 4 h after incubation using conventional laser confocal microscopy.
Immunohistochemistry microscopy
Immunohistochemistry microscopy of cryosections: Confocal laser scanning microscopy was performed using a LSM-700 system (Zeiss) with a Plan-Apochromat 20x NA 0.8, an EC Plan-Neofluar 40x NA1.30 Oil DIC Plan-Apochromat, or a Plan-Apochromat 63x NA 1.40 oil DIC. Z-stacks were selected to cover the entire section and taken in software (ZEN) suggested optimal size steps.
Immunohistochemistry microscopy of fixed organotypical slice cultures after ex vivo electroporation: Confocal laser scanning microscopy was performed using a LSM-700 system (Zeiss) with a Plan-Apochromat 20x NA 0.8 objective or using a SP8 system (Leica) with a HCX PL FLUOTAR L 20x objective. Z-stacks were selected to cover the entire section and taken in software (ZEN) suggested optimal size steps.
Image analysis and quantification
Analysis and linear image processing was performed in FIJI. All quantifications (unless differently indicated) were performed using the same microscope settings across experiments.
Cell positioning
Numbers of, and positions of different kinds of cells (e.g. TBR2+, NeuN+ or mitotic cells) were determined using the FIJI cell counter plug-in. Cell positions were transformed from absolute locations to relative positions on an x and y-axis where the y-axis goes from 0% (ventricular surface) to 100% (pial surface), and the x-axis goes from 0 to 100% in width (specific crops, figure specific; see figure legends).
Neurofilament band
Location and width of neurofilament band was determined using background substracted values obtained by drawing a linescan across the cortex (VS - > PS). A specific threshold was applied on relative immunofluorescent signal intensity to determine the start and end of the NF band.
Ex vivo electroporation
Positions of migrating neuronal soma and corresponding endfeet were determined using the FIJI cell counter plug-in. All GFP+ cells located above 30% relative position (on the y-, VS-PS, axis) were counted as migrating and included in this analysis. Cell positions were transformed from absolute locations to relative positions on an x and y-axis where the y-axis goes from 0% (ventricular surface) to 100% (pial surface), and the x-axis goes from 0 to 100% in width (specific crops; see figure legend). Length of the leading edge was determined by substracting relative somatic postion from relative endfeet position.
Mitotic progression
The condensation state of chromatin was allocated to counted cells using DAPI staining and the presence of perinuclear centrosomes was determined by Pericentrin staining within the phospho-vimentin positive area surrounding the nucleus. Mitotic cells were counted as apical when the nucleus was within 30 μm of the Ventricular surface and as sub-apical otherwise. Centrosomes were counted using cell-counter in the centrosome poor regions in the outer ventricular zone. Cleavage plane orientation was determined using the angle tool and measuring the angle between a line connecting the two centrosomes and a line in the radial direction of the cortex.
Statistical analysis
All statistical details of experiments, including the definitions and exact values of N & n, and statistical tests performed, can be found in figure legends. All data was checked for normality by Shapiro–Wilk test. We define the number of mice as N (e.g. three mice used for Nex-WT and four mice used for Nex-KO would be given as N = 3–4), and the number of counted cells/individual data points as n (e.g. sample with lowest numbers of positive cells has 200 cells, sample with highest number has 300 cells would be given as n = 200–300). For each genotype, mice come from at least two different litters. Data processing and statistical analysis were done in Excel and GraphPad Prism 7. Significance was defined as: ns = not significant or p > 0.05, * for p < 0.05, ** for p < 0.005, *** for p < 0.001. Error bars are ±SEM.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.