Introduction
Normal lymphocytes and primary tumors, as well as cell lines of the lymphoid lineage are known to be difficult to transfect efficiently. Previous attempts to transduce B and T lymphocytes using retroviruses [
1], diethylaminoethyl dextran, or liposomes [
2] have had limited success, resulting in transfection efficiencies of only 10% to 30%. This relatively low transfection efficiency is a major obstacle for siRNA strategies to efficiently test their contribution to normal biological responses in lymphocyte populations without further manipulation and cell sorting. Lentiviruses are an exciting gene delivery tool because of their ability to efficiently transduce both dividing and nondividing target cell populations. Additionally, their capacity to establish long-lasting transgene expression due to chromosomal integration of the proviral DNA makes this technique very attractive in the lymphoma research field [
3].
Intense interest in the field of RNAi (RNA interference) has facilitated its rapid transformation from a biological phenomenon to a valuable research tool used to silence target gene expression [
4,
5]. RNAi can be mediated either by small interfering RNAs (siRNAs) of about 21 nucleotides or by stably expressed short hairpin RNAs (shRNAs), which are processed by Dicer into siRNAs [
6,
7]. Two major problems are evident for studying the lymphocytes biology: first to achieve their high transfection rate and second to select the appropriate highly efficient siRNA sequence. The real challenge of RNAi technology is designing an effective siRNA sequence [
8]. Any region of mRNA can be targeted; however, sequences that are known sites for mRNA-binding proteins in the 5′ untranslated region (UTR), 3′ UTR, start codon, or exon–exon boundaries should be avoided [
9]. Many groups have demonstrated that the specific RNAi molecules targeting different regions of a transcript can vary widely in their effectiveness at inducing gene silencing [
10,
11]. Some recently published reports advised that chemically synthesized siRNAs should be employed at low concentrations in order to prevent unspecific effects, thus underlining the necessity to select highly efficient siRNAs [
12]. Not all rationally designed si/shRNAs will achieve knockdown of gene expression at the same level, and, therefore, it is very desirable to evaluate the silencing capability of several candidates before committing to the actual experiment.
Many of the proposed guidelines for specific siRNA design have been incorporated into a variety of public and commercial computational design tools following the recommendations originally described by Tuschl and coworkers [
13,
14]. Although freely available conventional siRNA design programs speed the design process, researchers are still faced with the task of testing multiple siRNAs to identify a suitable potent siRNA molecule. Although siRNA-induced gene silencing is primarily an mRNA-level event, it is recommended that both mRNA and protein levels are analyzed. The advantage of analyzing the protein expression by Western blot is the possibility to quantitate the knockdown level of the endogenous protein of interest.
The aim of this study is to develop a protocol to achieve efficient transduction of highly efficient siRNA into B and T lymphoma cells using a lentiviral vector. For this purpose, we have chosen STAT3 and cyclin D1 proteins as targets because the expression of these proteins is associated with lymphomagenesis and cancer progression [
15,
16], and they have different protein half-lives in the cells [
16‐
18].
Materials and methods
Design of shRNA constructs and cloning into pSuper vector
Specific shRNAs were designed by using bioinformatics tools publicly available from Dharmacon, Invitrogen, Qiagen, or MWG websites. We designed seven different sequences for efficient cyclin D1 targeting by shRNA. Of the four Stat3 shRNAs analyzed, one has been published [
19], and we designed three additional sequences for further detailed analysis. As a control, “control” siRNA (Dharmacon Research, Chicago, IL, USA), with the sense sequence 5′-GCCGCUUUGUAGGAUAGAG-3′ which lacks complementary sequences in the human genome, was used.
Oligonucleotides (listed in Table
1) were cloned into pSuper vector as described [
6]. In brief, the double-stranded DNA templates encoding siRNA oligonucleotides for cyclin D1 or STAT3 were synthesized. The specific oligonucleotide sequence contained a sense strand of 19 nucleotides followed by a short spacer (TTCAAGAGA) and the reverse complement of the sense strand. Five thymidines were added at the end of synthesized oligonucleotide as RNA polymerase III transcriptional stop signal. Each pair of oligos was annealed at 20 μM in annealing buffer (100 mM potassium acetate, 30 mM HEPES–KOH (pH 7.4), 2 mM magnesium acetate) at 95°C for 4 min, followed by incubation at 70°C for 10 min and slow cooling to room temperature. Forty picomolars of annealed oligos were phosphorylated by T4 polynucleotide kinase before they were ligated into pSuper vector digested by
BglII and
HindIII. All constructs were checked by
EcoRI–
HindIII digestion and by sequencing.
Table 1
Sequences of primers used in this study for shRNA constructs
5′3′—sequence of forward primers |
shM2_Fw | GATCCCCATGTGTGCAGAAGGAGGTCTTCAAGAGAGACCTCCTTCTGCACACATTTTTTGGAAA |
shDh1_Fw | GATCCCCACAAACAGATCATCCGCAATTCAAGAGATTGCGGATGATCTGTTTGTTTTTTGGAAA |
shDh2_Fw | GATCCCCCAAACAGATCATCCGCAAATTCAAGAGATTTGCGGATGATCTGTTTGTTTTTGGAAA |
shDh3_Fw | GATCCCCAACAGATCATCCGCAAACATTCAAGAGATGTTTGCGGATGATCTGTTTTTTTGGAAA |
shSA1_Fw | GATCCCCGCATGTTCGTGGCCTCTAATTCAAGAGATTAGAGGCCACGAACATGCTTTTTGGAAA |
shAS1_Fw | GATCCCCTTAGAGGCCACGAACATGCTTCAAGAGAGCATGTTCGTGGCCTCTAATTTTTGGAAA |
shGA1_Fw | GATCCCCGCATGTTCGTGGCCTCTAAGATTCAAGAGATCTTAGAGGCCACGAACATGCTTTTTGGAAA |
shGh1_Fw | GATCCCCGCAGCAGCTGAACAACATGTTTCAAGAGAACATGTTGTTCAGCTGCTGCTTTTTGGAAA |
shINV1_Fw | GATCCCCGCTGAACAACATGTCATTTTTCAAGAGAAAATGACATGTTGTTCAGCTTTTTGGAAA |
shDh353_Fw | GATCCCCAGTCGAATGTTCTCTATCATTCAAGAGATGATAGAGAACATTCGACTTTTTTGGAAA |
shDh1700_Fw | GATCCCCTGACTACACTGGCAGAGAATTCAAGAGATTCTCTGCCAGTGTAGTCATTTTTGGAAA |
5′3′—sequence of reverse primers |
shM2_Rev | AGCTTTTCCAAAAAATGTGTGCAGAAGGAGGTCTCTCTTGAAGACCTCCTTCTGCACACATGGG |
shDh1_Rev | AGCTTTTCCAAAAAACAAACAGATCATCCGCAATCTCTTGAATTGCGGATGATCTGTTTGTGGG |
shDh2_Rev | AGCTTTTCCAAAAACAAACAGATCATCCGCAAATCTCTTGAATTTGCGGATGATCTGTTTGGGG |
shDh3_Rev | AGCTTTTCCAAAAAAACAGATCATCCGCAAACATCTCTTGAATGTTTGCGGATGATCTGTTGGG |
shSA1_Rev | AGCTTTTCCAAAAAGCATGTTCGTGGCCTCTAATCTCTTGAATTAGAGGCCACGAACATGCGGG |
shAS1_Rev | AGCTTTTCCAAAAATTAGAGGCCACGAACATGCTCTCTTGAAGCATGTTCGTGGCCTCTAAGGG |
shGA1_Rev | AGCTTTTCCAAAAAGCATGTTCGTGGCCTCTAAGATCTCTTGAATCTTAGAGGCCACGAACATGCGGG |
shGh1_Rev | AGCTTTTCCAAAAAGCAGCAGCTGAACAACATGTTCTCTTGAAACATGTTGTTCAGCTGCTGCGGG |
shINV1_Rev | AGCTTTTCCAAAAAGCTGAACAACATGTCATTTTCTCTTGAAAAATGACATGTTGTTCAGCGGG |
shDh353_Rev | AGCTTTTCCAAAAAAGTCGAATGTTCTCTATCATCTCTTGAATGATAGAGAACATTCGACTGGG |
shDh1700_Rev | AGCTTTTCCAAAAATGACTACACTGGCAGAGAATCTCTTGAATTCTCTGCCAGTGTAGTCAGGG |
Generating the lacZ-cyclin D1 (pLC1) and lacZ-STAT3 (pLS3) screening construct
Ultimate hORF entry clone containing the human cyclin D1 gene (Invitrogen, ORF no. IOH 1962) and human STAT3 gene (Invitrogen, ORF no. IOH 14348), respectively, were transferred into pSCREEN-iT/lacZ-DEST vector using the LR recombination reaction with specific enzyme LR Clonase, characteristic of gateway cloning (Invitrogen, Carlsbad, CA, USA). Cloning used in this study allows in vitro recombination-based transfer of DNA from one vector to another without the use of restriction enzymes. Briefly, 150 ng of destination vector (LacZ-DEST) and 50–150 ng of entry clone (IOH 1962 or IOH 14348) were mixed in TE buffer (pH 8.0). LR Clonase enzyme mix (4 μl) was added and incubated for 1 h at room temperature. Reaction was stopped with 2 μg of proteinase K solution for 10 min at 37°C. Part of LR reaction (3 μl) was transformed into TOP10 Escherichia-coli-competent cells (Invitrogen, Carlsbad, CA, USA) and positive clones were selected on LB plates containing 100 μg/ml ampicillin (Sigma, St. Louis, MO, USA). This way, we generated the lacZ-STAT3 (pLS3) and the lacZ-cyclin D1 (pLC1) in frame fusion screening constructs.
β-galactosidase assay
Simultaneous delivery of the shRNA constructs with the pLS3 or pLC1 plasmid induces cleavage of the lacZ fusion transcript, resulting in reduction of β-galactosidase activity. The activity of β-galactosidase is directly dependent on the mRNA stability of the fusion protein. The β-galactosidase assay was performed using the FluoReporter LacZ/Galactosidase Quantitation kit according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA, USA). This kit contains a fluorogenic 3-carboxy-umbelliferyl β-D-galactopyranoside (CUG) substrate from Molecular Probes (cat. no. F-2905) that allows highly sensitive measurement of β-galactosidase activity. Briefly, 20 μl of cell lysates or 10−1 or 10−2 dilutions were used for measurements in black-walled clear-bottom 96-well microtiter plates (Costar, Corning, NY, USA) containing 100 μl of the 1.1-mM CUG substrate working solution. The reactions were incubated for 10–30 min at room temperature and stopped by adding 50 μl of stop solution (0.2 M Na2CO3). Fluorescence emission of the CUG substrate was measured using a fluorescence plate reader (Fluoroskan Ascent CF reader, Thermo Scientific, Waltham, MA, USA) equipped with the proper filter set (excitation filter centered at ∼390 nm and emission filter centered at ∼460 nm).
Cell culture and transfections
The lymphoma cell lines Granta 519 (mantle cell lymphoma), Karpas 299, and SUDHL-1 (anaplastic large cell lymphoma) were cultured in RPMI 1640 supplemented with 10% fetal bovine serum (FCS), 2 mM glutamine, 100 μg/ml penicillin, and 100 μg/ml streptomycin (Life Technologies, Inc., Gaithersburg, MD, USA). The human embryonic kidney 293 T cells were grown in Dulbecco’s modified eagles medium with 10% FCS, 100 μg/ml penicillin, and 100 μg/ml streptomycin (Invitrogen, Carlsbad, CA, USA). Transfections were performed with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Typically, cells growing on 60-mm Petri dishes were transfected with 0.5 μg reporter plasmid (pLC1 or pLS3) and 5.0 μg pSuper empty vector or pSuper with a specific siRNA sequence (shRNA vector). Cells were analyzed 48 or 72 h after transfection. To estimate the transfection efficiency, a green fluorescent protein (GFP)-coding plasmid (pEGFP, Clontech, Mountain View, CA, USA) was transfected in 293 T cells and the number of GFP-expressing cells was counted by fluorescence microscopy (Apotome, Zeiss MicroImaging GmbH, Göttingen, Germany). Transfection efficiencies for most experiments ranged from 70% to 99%.
Virus production and concentration
The pFUGW transfer vector, the corresponding packaging plasmid, and the G-protein of vesicular stomatitis virus envelope plasmid were a kind gift of Dr. Baltimore [
3]. The pFUGW lentiviral vector allows the expression of EGFP reporter gene driven by an internal ubiquitin-C promoter. To insert a specific shRNA into the lentiviral vector, shRNA together with human H1 promoter from pSuper constructs was digested with
SmaI and
HincII and ligated into pFUGW digested with
PacI, followed by blunting using T4 DNA polymerase. The orientations of the fragments were confirmed by
ClaI and
EcoRI digestion. As controls, pFUGW derivative vectors containing only an H1 promoter from pSuper plasmid or the control shRNA sequence under H1 promoter were generated and named “empty virus” and “control shRNA,” respectively.
Replication-defective lentiviral virions were produced by transient cotransfection of 7.5 μg pCMVdeltaR8.9, 5 μg pHCMV-G, and 10 μg of the pFUGW vector or its derivatives into 293 T cells with the Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) transfection system. The media was changed 6 h after transfection and supernatant containing the virus was harvested 48 h after transfection, cleared of debris by low-speed centrifugation, and filtered through 0.45-μm Stericup filters (Millipore, Billerica, MA, USA). Yields were typically 80 to 120 ml from a ten to 15 10-cm dishes. The lentivirus was concentrated by ultrafiltration using Amicon-20 100-kDa-molecular-weight cut-off columns (Millipore, Billerica, MA, USA) in accordance to the manufacturer’s guidelines. The virus was subsequently aliquoted (100 μl) and supernatants were stored at −80°C. Virus titers (multiplicity of infection—MOI) were determined by fluorescence-activated cell sorting (FACS) analysis of a known number of 293 T cells infected with serially diluted viral supernatant and GFP expression analysis.
Viral infections of suspension lymphoma cell lines
Granta 519, Karpas 299, and SUDHL-1 cells (2 × 106 per milliliter) were resuspended in lentivirus-containing supernatant in the presence of polybrene (8 μg/ml) in a six-well plate. Plates were centrifuged at 1,000 g for 90 min. After centrifugation, cells were washed, resuspended in fresh culture medium, and incubated at 37°C in a CO2 incubator for indicated time points.
Cytofluorimetric analysis (FACS) of infected cells
Three days after infection, cells were washed in phosphate-buffered saline (PBS) and resuspended in FACS buffer (PBS with 5% FCS and 1 μg/ml of propidium iodide—PI). PI was used to determine cell viability of infected cells and uninfected control. Gene transduction efficiency was determined by cytofluorimetric analysis using the BD FACSCalibur™ flow cytometer (BD Biosciences, San Jose, CA, USA) and analyzed with BD CellQuest Pro™ software. Infected cells were detected on the basis of GFP fluorescence relative to uninfected control.
Western blot analysis
Cells were washed in PBS, pelleted, and lysed, as described [
20]. The immunoreagents used for Western blot were rabbit polyclonal antibody against cyclin D1 (H-295; Santa Cruz Biotechnology, Sc-753) and mouse monoclonal anti-STAT3 antibody (Transduction Laboratories, cat. no. 610190). Mouse monoclonal antitubulin antibody (Sigma, Clone B512, cat. no. T-5168) was used as loading control. All experiments were repeated several times and gave similar results.
Real-time quantitative RT-PCR
Real-time quantitative reverse-transcription polymerase chain reaction (RT-PCR) analysis was performed with the ABI Prism 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). For the quantification of cyclin D1 and STAT3, we used gene expression assays from Applied Biosystems (cyclin D1, Hs00277039_m1; STAT3, Hs01047572_m1). TATA box-binding protein (TBP) was used as the housekeeping gene, as previously described [
16]. Target gene expression was normalized to TBP and the target gene expression was analyzed by the
\(2^{ - \Delta \Delta \operatorname{CT} } \) formula. All reactions were performed at least twice in duplicate.
Discussion
In this study, we have successfully used a combination of two techniques to achieve efficient transduction of specific shRNA with high knockdown efficiency into B and T lymphoma cells, with infection rates in the range of 80% to 99%. The first technique is a highly sensitive β-galactosidase reporter assay based on a specific
lacZ reporter fusion with the corresponding gene of interest that enables fast and easy recognition of the most efficient siRNA sequence for target knockdown. The second technique requires RNAi molecules with more than 85% of knockdown efficiency that are further cloned into a lentiviral vector (pFUGW) [
3] for virus production and successful transduction of lymphoma cell lines.
The need for a strong specific gene silencing effect by RNAi means there is an absolute requirement to test the specificity and efficiency of siRNAs before embarking on phenotype analysis [
8,
21]. Although it is expected that chemically synthesized siRNAs and corresponding hairpin-based shRNAs should have the same gene knockdown effect, it has been shown that si/shRNAs exhibit similar but not identical sequence preferences [
22]. With the approach described here, the generation of constructs is straightforward, relying on the use of synthetic oligonucleotides and a single restriction site that ensures directional cloning. The sensitivity of the LacZ reporter fusion system allows the identification of RNAi molecules that are the most potent in inducing target gene knockdown even at protein level. In this study, two proteins that have been recognized to be important in lymphomagenesis were chosen, cyclin D1 with a short half-life and STAT3 with a long half-life. In both instances, efficient knockdown activity of the fusion protein with specific shRNA was achieved. Since no preexisting pool of the LacZ fusion protein is available in the 293 T cells, the protein half-life to evaluate the shRNA efficiency is not an issue. Using this validation approach, it is very simple to identify the shRNAs that are most effective at knocking down the target gene. Nevertheless, when specific shRNA is used for knockdown of endogenous proteins, the half-life of the protein has to be taken in consideration to decide the right time of the experiment. This was evidenced in this study by STAT3 protein, where a big difference in knockdown efficiency was seen after 48 or 72 h, respectively. In addition, we demonstrated that assessment of shRNAs is not influenced by the amount of the reporter construct used for analysis since the most effective shRNA is reliably identified after cotransfection with both low (100 ng) and high (1 μg) concentration of the fusion gene.
For successful inhibition of target genes, the efficiency of the shRNA molecules and infection rate of the target cells are the two critical parameters. On one side, only shRNA molecules with more than 85% of knockdown efficiency (highly efficient) should be considered to further generate lentiviral transfer vectors and complex lentivirus production. On the other side, the optimal MOI should be established for each cell population to be analyzed [
23,
24]. Our data describe the conditions of infection required for optimal gene transduction for lymphoid cell lines, which may have to be modified for other types of target cells. The limiting factor for high transduction rate and the main difference between viral infection of adherent cells and suspension cells is the centrifugation step, during which viral infection occurs in the latter. Since there is less contact between viral particles and suspension cells as compared to adherent cells, higher infection units per cell are needed to obtain efficient transduction. The fraction of infected cells rises with increasing MOI and reaches a plateau between 35 and 45 MOI. This is the optimal point where the highest levels of gene knockdown are achieved, with a minimum of nonspecific effects. However, we have encountered lymphoma cell lines where much higher MOI (up to 80) are needed to achieve around 80% of cell transduction (data not shown). The lentiviral vectors have the advantage to remain stable within the cell for long periods of time [
25]. The monitoring of GFP expression by FACS analysis not only gives information about the amount of transduced cells but also about the stability of the transduction. GFP expression was analyzed up to 12 weeks, and its expression remained stable even after cell freezing and thawing.
In summary, we describe the use of the lentiviral vector system to obtain highly efficient and long-term repression of gene expression in lymphoid cell lines, which represents a major improvement over previously published methods [
1,
2,
25]. The high ability of lentivirus to transduce lymphoma cells and to achieve high knockdown effect through RNAi opens new avenues for genetic characterization and provides a useful tool for basic molecular studies of lymphoma cell biology and therapy regimens. The high level of transduction efficiency (85% on average) will allow RNA interference studies to be performed on transduced populations of cells without further manipulation such as cell sorting or cloning.
Acknowledgements
We are grateful to Dr. David Baltimore and to Dr. Abel Sánchez-Aguilera for donating pFUGW vector and packaging plasmids for lentivirus production. We are grateful to Mark Raffeld, MD, for donating some of the cell lines used in this study. The authors thank Dr. Ludger Hengst for donating pSuper and pS-Scramble-Control vectors and Ulrike Reich for excellent technical assistance. The authors also thank to Dr. Tim Schröder and Mrs. Andrea Hermann for assistance with FACS analysis.
Supported in part by a grant from the Deutsche Forschungsgemeinschaft (FE 597/3-1) to L.Q-M. and F.F. and the Mantle Cell Consortium of the Leukemia Research Foundation to L.Q-M.