Skip to main content
Erschienen in: Cardiovascular Diabetology 1/2012

Open Access 01.12.2012 | Original investigation

GLUT4, GLUT1, and GLUT8 are the dominant GLUT transcripts expressed in the murine left ventricle

verfasst von: Lauren Aerni-Flessner, Melissa Abi-Jaoude, Amanda Koenig, Maria Payne, Paul W Hruz

Erschienen in: Cardiovascular Diabetology | Ausgabe 1/2012

Abstract

Background

The heart derives energy from a wide variety of substrates including fatty acids, carbohydrates, ketones, and amino acids. The healthy heart generates up to 30% of its ATP from glucose. Under conditions of cardiac injury or stress, the heart relies even more heavily on glucose as a source of fuel. Glucose is transported into the heart by members of the family of facilitative glucose transporters (GLUTs). While research examining the transport of glucose into the heart has primarily focused on the roles of the classical glucose transporters GLUT1 and GLUT4, little is known about the functions of more newly identified GLUT isoforms in the myocardium.

Methods

In this study the presence and relative RNA message abundance of each of the known GLUT isoforms was determined in left ventricular tissue from two commonly used inbred laboratory mouse strains (C57BL/6J and FVB/NJ) by quantitative real time PCR. Relative message abundance was also determined in GLUT4 null mice and in murine models of dilated and hypertrophic cardiomyopathy.

Results

GLUT4, GLUT1, and GLUT8 were found to be the most abundant GLUT transcripts in the normal heart, while GLUT3, GLUT10, and GLUT12 are present at relatively lower levels. Assessment of relative GLUT expression in left ventricular myocardium from mice with dilated cardiomyopathy revealed increased expression of GLUT1 with reduced levels of GLUT4, GLUT8, and GLUT12. Compensatory increase in the expression of GLUT12 was observed in genetically altered mice lacking GLUT4.

Conclusions

Glucose transporter expression varies significantly among murine models of cardiac dysfunction and involves several of the class III GLUT isoforms. Understanding how these more newly identified GLUT isoforms contribute to regulating myocardial glucose transport will enhance our comprehension of the normal physiology and pathophysiology of the heart.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1475-2840-11-63) contains supplementary material, which is available to authorized users.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

LAF conceived the study, assisted in the design, execution and interpretation of experiments, and drafted the manuscript. MA, MP and AK assisted in performing experiments. PH provided guidance in experimental design, performed data analysis and interpretation, and assisted in writing and editing the manuscript. All authors read and approved the final manuscript.
Abkürzungen
PCR
Polymerase chain reaction
GLUT
Facilitative glucose transport protein
HMIT
(H+) myo-inositol transporter
LV
Left ventricle
TAC
Transverse aortic constriction
GAPDH
Glyceraldehyde 3-phosphate dehydrogenase
HPRT
Hypoxanthine-guanine phosphoribosyl-transferase
PBS
Phosphate buffered saline.

Introduction

The mammalian heart demands a constant supply of ATP in order to perform its vital role in delivering oxygen, metabolic substrates, and hormones to peripheral tissues. In order to generate an adequate supply of ATP to meet this high energy demand, the heart requires a continuous supply of metabolic fuel. The healthy heart derives its energy from a wide variety of carbon based substrates including fatty acids, carbohydrates, ketones, and amino acids [1]. The flexibility that the healthy heart displays in its metabolic machinery enables it to alter substrate use depending on substrate availability and circulating hormone levels. While the healthy heart derives a majority of its energy from fatty acids, up to 30% of myocardial ATP is derived from glucose and lactate [2]. Furthermore, under conditions of myocardial injury or stress, such as during ischemia or during pressure overload hypertrophy, the heart displays reduced substrate flexibility with an increased dependence on glucose [3]. The transport of glucose into the myocardium is mediated by members of the facilitative glucose transporter (GLUT) family.
There are fourteen known members of the GLUT family: the Class I transporters GLUTs-1, -2, -3, -4, and −14, the Class II transporters GLUTs-5, -7, -9, and −11, and the Class III transporters GLUTs-6, -8, -10, -12, and HMIT [4, 5]. These GLUT isoforms differ in their substrate specificity, kinetics of transport, and tissue distribution and localization. Many of the Class II and Class III isoforms in the GLUT family have been discovered only in recent years, and the specific role that the newly identified GLUTs play in mediating the transport of hexoses across the membranes of mammalian cells remains poorly understood.
The Class I transporters GLUT1 and GLUT4 are the most extensively studied GLUTs in mammalian tissues. GLUT4, the canonical insulin-responsive glucose transporter, is the predominant GLUT expressed in the adult heart [6]. GLUT1 is a major GLUT transporter expressed in the fetal heart [7]. GLUT1 also increases in abundance in the adult heart in response to myocardial injury or stress [8, 9]. In addition to GLUTs-1 and −4, several of the newly identified GLUT transporters, including the Class III isoforms GLUTs-8, -10, and −12, have been detected in cardiac tissue [1014]. These isoforms may represent additional insulin-responsive GLUTs, as GLUT8 has been identified as an insulin-responsive GLUT in blastocysts [15] and GLUT12 overexpression in mice has been shown to improve whole body insulin-sensitivity [16]. However, the functional role of these transporters in regulating myocardial glucose uptake remains largely unexplored. In addition, little quantitative data in regards to the expression or function of these GLUTs in the myocardium are available. To better understand the role for these newly identified GLUTs in the heart, we set out to identify which isoforms of the facilitative glucose transporter family are present in the left ventricle of mice. Furthermore, we have used real time PCR to determine quantitatively which GLUTs transcripts are most highly abundant in the heart. Identifying the GLUT isoforms that are most highly expressed in the heart under healthy settings, and determining how the expression levels of these GLUTs change under pathological circumstances provides novel insight into the potential functional roles of these newly identified GLUTs in the normal physiology and pathophysiology of the heart.

Materials and methods

Animal care

All mouse studies were approved by the Animal Studies Committee at Washington University School of Medicine and conform to the Guide for the Care and Use of Laboratory Animals published by the National Institute of Health. Mice were housed in the animal facility at Washington University under standard light/dark cycles and fed standard mouse chow diet and water ad libitum. Ten-week-old male FVB/NJ mice and C57BL/6J mice (The Jackson Laboratory) were used for the identification and quantification of GLUT transcripts in the left ventricle myocardium. Six-month-old male GLUT4 null mice and age matched C57BL/6J controls were used to identify the relative GLUT transcript levels in the murine left ventricle following genetic ablation of GLUT4. Twelve-week-old male TG9 mice and wild type (FVB/NJ) littermate controls were used to determine the relative abundance of GLUT transcripts in the left ventricle in a genetic model of dilated cardiomyopathy. Male C57BL/6J mice were used in the aortic banding studies described below in order to examine the relative abundance of GLUTs in the left ventricle during pathophysiological hypertrophy.

Transverse aortic constriction

Ten-week-old C57BL/6J male mice were randomly assigned to either a sham-operated or a transverse aortic constriction (TAC) group. TAC was performed as described previously [17]. Sham-operated mice endured the same surgical procedure but the aortic constriction was not placed. After seven days, surviving animals were sacrificed and the left ventricles were dissected out and weighed. The left ventricles were then frozen and RNA was isolated as described below.

RNA isolation and real-time PCR

Total RNA was isolated using the Trizol® Plus RNA Purification System (Invitrogen, Carlsbad, CA), and one microgram of RNA was reverse transcribed using the SuperScript® III First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA). PCR was performed using Klentaq1 (DNA Polymerase Technology, St. Louis, MO) to identify the GLUT RNA transcripts that are present in the left ventricles of male FVB/NJ and C57BL/6J mice. Quantitative RT-PCR was performed using Power SYBR® Green PCR Master Mix (Applied Biosystems, Foster City, CA). Each reaction was run in triplicate using the validated primers listed in Table 1. Quantifications were performed with standard curves generated using pCR 2.1-TOPO plasmids (Invitrogen, Carlsbad, CA) that contain each GLUT cDNA amplicon. To control for the intrinsic variability in the efficiency of the reverse transcription reactions for the RNA samples used in this study, the results were normalized to β-Actin as described previously [18]. Briefly, the cycle threshold (Ct) values for β-Actin that were obtained from running individual cDNA samples in triplicate were averaged. The average β-Actin Ct values for the entire pool of left ventricle samples was then determined and this value was used as a baseline with the ΔΔCt method in order to create a normalization factor for each individual left ventricle sample. The GLUT copy numbers that were generated using the standard curve described above for each left ventricle sample were then normalized to the value obtained using β-Actin as a normalization factor. Since β-Actin transcript levels can change in heart failure [19], the relative changes in GLUT expression in murine models of cardiac hypertrophy compared to controls animals were determined using the ΔΔCt method with HPRT serving as an internal control.
Table 1
Murine glucose transporter primers
 
Forward primer
Reverse primer
Amplicon(bp)
Glut1
TCAACACGGCCTTCACTG
CACGATGCTCAGATAGGACATC
164
Glut2
TGTGCTGCTGGATAAATTCGCCTG
AACCATGAACCAAGGGATTGGACC
109
Glut3
TTCTGGTCGGAATGCTCTTC
AATGTCCTCGAAAGTCCTGC
143
Glut4
GTAACTTCATTGTCGGCATGG
AGCTGAGATCTGGTCAAACG
155
Glut5
GGCTCATCTTCCCCTTCATTC
ATGAATGTCCTGCCCTTGG
145
Glut6
TTGGTGCTGTGAGGCT
TGGCACAAACTGGACGTA
140
Glut8
TTCATGGCCTTTCTAGTGACC
GAGTCCTGCCTTTAGTCTCAG
145
Glut9
TGCTTCCTCGTCTTCGCCACAATA
CTCTTGGCAAATGCCTGGCTGATT
113
Glut10
ACCAAAGGACAGTCTTTAGCTG
ATCTTCCAAGCAGACGGATG
148
Glut12
GGGTGTCAACCTTCTCATCTC
CCAAAGAGCATCCCTTAGTCTC
149
Actin
GATTACTGCTCTGGCTCCTAG
GACTCATCGTACTCCTGCTTG
147
HPRT
CCCCAAAATGGTTAAGGTTGC
AACAAAGTCTGGCCTGTATCC
76

Western blotting

Left ventricular myocardium was harvested from mice immediately following euthanasia and was flash frozen in liquid nitrogen. Lysates were prepared by homogenizing the frozen ventricles in lysis buffer containing 1% triton X100, 1 mM sodium vanadate, 50 mM sodium fluoride, 10 mM sodium pyrophosphate, and protease inhibitor cocktail (Sigma, Saint Louis, MO) in PBS. Lysates were incubated on ice for 30 minutes and cleared by centrifugation at 1500xg for 10 minutes at 4°C. Protein concentration was determined using the Pierce BCA Protein Assay Kit (Pierce biotechnology, Rockford, IL). The GLUT8 and GLUT12 antibodies were a kind gift from Dr. Kelle Moley. Western blot analysis was then performed using 10 μg of total protein per lane. GLUT1, GLUT4, and GLUT12 antibodies recognizing the COOH-terminus of the transporters were used at a 1:1000 dilution in 5% milk in TBS-T. A GLUT8 antibody recognizing the NH2-terminus of the transporter was used at a 1:1000 dilution in 5% milk in TBS-T. Monoclonal GAPDH (Sigma, Saint Louis, MO) was used as an internal control for loading variability. Blots were imaged and relative protein levels were determined using the Odyssey Infrared Imaging System Version 3.0 (LI-COR Biosciences, Lincoln, NE).

Statistical analyses

The data are reported as means ± SEM. Differences between control and experimental values were determined by Student’s t test. Statistical significance is set as P < 0.05.

Results

GLUT expression in left ventricle

To determine the relative expression of glucose transporters in healthy hearts, two inbred strains of mice that are most commonly used in laboratory investigation of cardiac function (C57BL/6J and FVB/NJ) were selected for initial characterization of cardiac GLUT expression. Analysis of RNA obtained from left ventricle myocardium of ten-week-old male mice from both strains identified transcripts encoding GLUT1, GLUT3, GLUT4, GLUT8, GLUT10, and GLUT12 (Figure 1A and Additional file 1: Figure S1). A faint band that is the appropriate size to be GLUT5 was detected in a few but not all left ventricle cDNA samples in both C57BL/6J and FVB/NJ mice. We were not, however, able to subclone the GLUT5 amplicon derived from left ventricle cDNA into a pCR2.1-TOPO plasmid for use in the quantitative real time PCR described below, and therefore for the purposes of this study we consider the expression of GLUT5 in the murine left ventricle to be below detectable levels. We were unable to detect GLUT6 in the left ventricle of C57BL/6J mice. However, a band for GLUT6 in the left ventricle of FVB/NJ mice was observed. Transcripts for GLUT2 or GLUT9 in either C57BL/6J or FVB/NJ mice were not detected. PCRs were also run on cDNA isolated from liver, intestine, and brain (Figure 1B) to confirm the specificity of the primers for use in amplifying GLUT2 (liver), GLUT5 (intestine), GLUT6 (brain), and GLUT9 (liver). The identity of each GLUT amplicon was confirmed by sequencing.

GLUT mRNA levels in murine left ventricles

Most of the current research investigating the role of glucose transporters in the myocardium has focused on the ‘classical’ Class I glucose transporters GLUT1 and GLUT4. Other facilitative GLUTs, including the more recently identified Class III GLUTs-8, -10, and −12, are also present in the heart. Several of these GLUTs are not yet well characterized, and it is possible that they also play a significant role in regulating glucose uptake in the heart. To understand better the extent to which these facilitative glucose transporters contribute to cardiac glucose utilization, we quantified the absolute levels of GLUT mRNA in left ventricles derived from C57BL/6J and FVB/NJ mice, two of the commonly used strains in genetic and surgical studies of cardiac hypertrophy. Tables 2 and 3 display the copy numbers of GLUT mRNA transcripts per nanogram of total RNA derived from murine left ventricles. We found that GLUT4, followed by GLUT1, is the predominant GLUT expressed in the murine left ventricle myocardia (Tables 2 and 3). mRNAs for GLUTs-3, -8, -10, and −12 are present in the left ventricle, but in considerably lower abundance. GLUT8 has the next highest mRNA level following GLUT4 and GLUT1. However, it is still not clear whether GLUT8 preferentially transports glucose or other hexoses in vivo, as well as if GLUT8’s primary role is at the cell surface or in an intracellular compartment, and thus its role in energy production in the heart is currently unclear. In FVB/NJ mice, GLUT12 is the fourth most abundant GLUT transcript in the LV after GLUT8. GLUT12 is currently hypothesized to act as a second insulin-responsive GLUT in addition to GLUT4. The functional role of GLUT12 in facilitating insulin-responsive glucose transport in this organ, however, has not been fully elucidated [16, 20]. GLUT6 was expressed at almost undetectable levels in LVs from FVB/NJ mice.
Table 2
Glut mRNA quantification in murine left ventricle (copy number/ng total RNA)
 
C57BL/6J males (n = 8)
GLUT1
982 ± 139
GLUT2
NA
GLUT3
62 ± 8
GLUT4
8878 ± 1532
GLUT5
NA
GLUT6
NA
GLUT8
360 ± 67
GLUT9
NA
GLUT10
73 ± 26
GLUT12
44 ± 5
ACTIN
15998 ± 2582
NA, Not applicable. Unable to detect transcript levels.
Table 3
Glut mRNA quantification in murine left ventricle (copy number/ng total RNA)
 
FVB/NJ males (n = 8)
GLUT1
457 ± 75
GLUT2
NA
GLUT3
26 ± 2
GLUT4
3202 ± 447
GLUT5
NA
GLUT6
8 ± 2
GLUT8
268 ± 34
GLUT9
NA
GLUT10
18 ± 2
GLUT12
170 ± 22
ACTIN
9020 ± 1212
NA, Not applicable. Unable to detect transcript levels.

GLUT transcript expression in GLUT4 null myocardium

GLUT4 is the predominant facilitative GLUT in insulin sensitive tissues including the heart, skeletal muscle, and adipose tissue. Quantitative data from this study shows that GLUT4 mRNA is roughly ten-fold more abundant than any other GLUT in the left ventricle. In spite of its major role in regulating glucose utilization in insulin-sensitive tissues, genetic ablation of GLUT4 does not result in overt diabetes but instead GLUT4 null mice exhibit a range of metabolic abnormalities including marked cardiac hypertrophy [21]. Even with the absence of the major glucose transporter, however, GLUT4 null hearts transport normal levels of glucose and synthesize normal levels of glycogen [22]. To determine whether other facilitative GLUTs are upregulated in the absence of GLUT4 in order to enable GLUT4 null hearts to maintain a high level of glucose metabolism, we examined the fold change in GLUT transcripts in RNA isolated from the left ventricles of six-month-old GLUT4 null males and age matched controls. As expected, our primers detected a 94% decrease in GLUT4 mRNA levels in the left ventricle of the GLUT4 null mouse. We did not observe a significant change in the transcript levels of GLUTs-1, -3, -8, or −10 in the left ventricles of GLUT4 null mice compared to wild type C57BL/6J controls (Figure 2). While GLUT1 levels were elevated in the left ventricles of GLUT4 null mice, this increase in transcript levels did not reach significance (p = 0.05). We did however observe a significant increase in the transcript levels of GLUT12 in the left ventricles of GLUT4 null mice.

GLUT protein expression in GLUT4 null mice

To determine whether changes in GLUT transcript levels correlate with changes in protein level in the GLUT4 null myocardium, we used western blotting to examine the protein expression of GLUT1, GLUT4, GLUT8, and GLUT12 in GLUT4 null mice and in wild type controls. Our data show that GLUT1, GLUT4, and GLUT8 are the most abundant GLUT transcripts in the left ventricle. Furthermore, GLUT12 mRNA levels are elevated in the left ventricle of GLUT4 null mice compared to wild type controls. As predicted, GLUT4 protein expression was dramatically diminished in the GLUT4 null myocardium (Figure 3). Our western blot data also show that the expression levels of GLUTs-1, -8, and −12 were significantly elevated in the GLUT4 null myocardium compared to wild type controls.

GLUT transcript expression in genetic and surgical murine models of cardiomyopathy

To determine whether the myocardial expression levels of the more recently identified glucose transporters modulate in situations of chronic cardiac stress, we measured the fold change in GLUT transcripts in the left ventricle of a genetic murine model of dilated cardiomyopathy. TG9 mice develop echocardiographic evidence of left ventricular dilatation and systolic dysfunction by 8 weeks of age followed by a steady increase in chamber size and decrease of contractile function leading to decompensated heart failure and death between 11–13 and weeks [23]. Eighty-five day old male TG9 mice that were in advanced stages of heart failure were sacrificed and the left ventricle was harvested. RNA was isolated from the left ventricle and cDNA was synthesized as described above. Real time PCR showed that significant differences exist between GLUT transcript levels in the left ventricles of TG9 mice compared to age matched controls (Figure 4). At 70 days of age, which is just prior to the development of overt cardiac dysfunction [23], GLUT1 and GLUT10 transcript levels were comparable to wild-type control mice whereas message for the insulin-responsive GLUTs −4, -8 and −12 were significantly lower (Figure 4A). By 85 days of age, GLUT1 transcript levels were significantly elevated in the TG9 ventricles compared to age-matched wild-type controls (Figure 4B). GLUT3 transcript levels also increased, but differences in relative transcript levels between wild-type and TG9 mice did not reach significance (p = 0.08). Relative transcript levels of GLUTs −4, -8, and −12 remained lower in the TG9 left ventricle compared to wild type controls.
To determine whether mRNA expression levels of the GLUTs similarly varies in a murine model of pathological hypertrophy induced by cardiac pressure overload, C57BL/6J male mice were subjected to aortic banding (or sham) surgeries. One week following surgery, RNA was isolated from left ventricles of surviving animals. As expected, the aortic banding surgery induced a significant degree of hypertrophy in the left ventricles (Figure 5A). Real time PCR showed that relative transcript levels were decreased for GLUTs −3 and 12 and unchanged for GLUTs −1, -4, -8 and −10 in mice one week following aortic banding (Figure 5B).

Discussion

The uptake and metabolism of glucose significantly contributes to the production of myocardial ATP under normal conditions. Glucose assumes an even greater role in energy production in the heart during increased workload, ischemia, and pressure overload hypertrophy [1, 2]. Because alterations in myocardial glucose utilization occur under conditions of cardiac injury or stress, better understanding of the factors that control the transport of glucose into the myocardium is vitally important for efforts to improve clinical outcomes in affected patients. The entry of glucose into the heart is mediated by members of the GLUT family of facilitative transporter proteins. While prior research has focused primarily on understanding the roles of the ubiquitous glucose transporter GLUT1 and the insulin-sensitive glucose transporter GLUT4 in regulating myocardial glucose uptake [21, 22, 2426], less attention has been devoted to elucidating the roles of other GLUT isoforms in both the normal heart and in pathological states. To this end, we set out to define and characterize the presence and relative abundance of GLUT isoforms in the healthy adult murine left ventricle. Furthermore, we examined how the expression levels of each of these isoforms change under pathophysiological conditions.

Functional implications of GLUT expression in the healthy heart

The current data show that mRNA encoding GLUTs-1, -3, -4, -8, -10, and −12 are present in the left ventricles of adult male FVB/NJ and C57BL/6J mice, two common strains of mice used for generating both genetic and surgical models of heart failure and stress. The presence of these isoforms in the murine left ventricle is in agreement with previous studies detecting these GLUTs in mammalian hearts [1013, 20, 27]. GLUT6 was also detected in the left ventricles of FVB/NJ mice, which has not been previously reported. GLUT5 was detectable in some but not all of the left ventricles derived from adult male FVB/NJ and C57BL/6J mice. Due to the inability to subclone a GLUT5 amplicon derived from left ventricular cDNA into a pCR2.1-TOPO cloning vector to be used as a template for a standard curve, the presence of this transporter isoform in left ventricular myocardium could not be confirmed and relative expression levels could not be quantified. While trace levels of GLUT5 mRNA may be present in the myocardium, because the total RNA in this study was isolated from whole tissue rather than isolated cardiomyocytes, it is possible that the low level detection of GLUTs 5 and 6 may have been derived from small amounts of other cell types harvested along with the left ventricle.
Due to a diversity of detectable GLUTs in the heart, characterization of the relative abundance of each of these GLUTs in the heart is an important step towards understanding how each of these GLUTs may contribute towards maintaining myocardial glucose transport under healthy settings. Based on their relative transcript abundance in the left ventricles of both FVB/NJ and C57BL/6J mice, GLUT4, GLUT1, and GLUT8 likely serve important physiological roles in the healthy heart. The mRNA levels of GLUT3, GLUT6, GLUT10 and GLUT12 are comparatively less abundant. This may point to a more limited role for these isoforms in regulating myocardial glucose uptake under healthy circumstances. It is important to note, however, that the relative abundance of GLUT mRNAs in the LV may not directly correlate with the relative abundance of GLUT protein. Clearly, more research is needed to determine the precise roles that each of these transporters play in the heart and in other mammalian tissues. It is possible that several of the expressed GLUT isoforms have significant functions in this tissue that are distinct from their putative roles as glucose transporters.
The relative abundance of GLUT8 mRNA in the left ventricles of adult FVB/NJ and C57BL/6J mice suggests that this isoform may play a role in facilitating hexose transport across the membranes of myocardial cells. The functional significance of GLUT8-mediated transport in normal heart physiology is unclear. While GLUT8 has been reported to act as an insulin-responsive GLUT isoform in murine blastocysts [15], in other many mammalian cell types GLUT8 localizes primarily to lysosomal compartments and does not translocate to the cell surface in response to insulin. Additionally, unlike the genetic ablation of GLUT4, which results in severe cardiac hypertrophy in mice [21], the genetic ablation of GLUT8 does not influence cardiac size or morphology [28]. The GLUT8 null heart does however display an increased P-wave duration in electrocardiogram analysis, suggesting that this transporter isoform may influence atrial contraction [28]. Further investigation is warranted to determine whether GLUT8 directly influences myocardial glucose utilization or has a separate role in influencing normal cardiac physiology.

Compensatory changes in myocardial GLUT expression following GLUT4 ablation

Our data show that GLUT4 mRNA in the left ventricle is more abundant than mRNA for every other GLUT isoform combined. Genetic ablation of GLUT4 in the heart has been shown to result in pronounced cardiac hypertrophy that is similar to hypertrophy that is induced by hypertension [21]. While the molecular mechanisms leading to hypertrophy in GLUT4 null mice are likely complex, hyperinsulinemia, hypertension and oxidative stress have been implicated as contributing factors [29, 24]. Interestingly, despite the absence of the most abundant GLUT isoform in the heart, GLUT4 null mice continue to transport glucose into the heart at normal levels [22]. Previous studies have suggested that upregulation of the GLUT1 isoform is responsible for maintaining normal levels of glucose transport into the heart. Our study shows that in addition to GLUT1, the protein levels of the GLUT8 and GLUT12 isoforms and the transcript levels of the GLUT12 isoform are also elevated in the left ventricles of GLUT4 null mice. The observed discrepancies between GLUT gene and protein expression, which have been previously observed with GLUT1 and GLUT4, can be due to changes in translational regulation and/or protein stability [30, 31].
The compensatory increase in the expression levels of other GLUT isoforms in the left ventricles of GLUT4 null mice complicates efforts to isolate the effect of GLUT4 ablation on cardiac function. Because the GLUT4 null heart transports glucose at normal levels, it can be inferred that alternate GLUT isoforms that are upregulated in the absence of GLUT4 serve a compensatory role in facilitating glucose uptake into the heart. These changes may influence glucose flux directly through increased levels of transporter protein within the plasma membrane or indirectly via alterations in cellular signaling pathways [32]. Similar alterations in GLUT isoform expression may also contribute to the observed dissociation between changes in GLUT4 expression and insulin sensitivity in other models such as exercise detraining [33].
Since the normal functions of the newer members of the GLUT family remain poorly characterized, it is possible that elevated GLUT8 and GLUT12 expression contributes to the hypertrophic phenotype observed in GLUT4 null hearts. The ability to disrupt glucose transport in an isoform-selective manner would provide a means to better clarify how each GLUT isoform participates in normal and pathological cardiac function in the absence of compensatory changes in GLUT expression. Our laboratory has previously demonstrated that the HIV protease inhibitor (PI) indinavir can acutely, selectively, and reversibly inhibit GLUT4 activity in vitro and in vivo[3436]. Ongoing efforts to identify the structural basis for PI binding to GLUTs will aide in the development of novel pharmacological agents that specifically inhibit other GLUT isoforms. This development would enrich our ability to explore how each GLUT isoform affects energy homeostasis in specific mammalian tissues.
Previous studies have demonstrated that isolated soleus muscle of female GLUT4 null mice displays augmented glucose uptake in response to insulin stimulation [37]. This demonstrates that an additional isoform is able to compensate at least partially for the genetic ablation of GLUT4 by acting as an insulin-responsive GLUT. At the time that this observation was made, several GLUTs including GLUT12 had not yet been identified. The increased expression of GLUT12 in GLUT4 null mice provides evidence that GLUT12 mediates the observed increased glucose uptake. Recent studies have demonstrated that GLUT12 traffics to the cell surface of skeletal muscle in response to insulin-stimulation [38] and that GLUT12 overexpression in mice improves insulin sensitivity [16]. The increase in GLUT12 mRNA expression in the GLUT4 null LVs suggests that GLUT12 may be playing a role as a second insulin responsive GLUT in the myocardium. It is still unclear whether GLUT12 translocates to the cell surface in response to contractile stimulation. Because the expression level of GLUT4 is normally significantly greater than GLUT12, it is unclear how much GLUT12 contributes to maintaining myocardial glucose homeostasis in the healthy heart.

Changes in myocardial GLUT expression under pathophysiologic conditions

Although mRNAs for GLUTs-3, -8, -10, and −12 are present in the LV at comparatively lower levels than GLUTs-1 and −4, it is possible that these isoforms play a greater role in regulating myocardial glucose uptake under pathological circumstances. We therefore examined the expression levels of each GLUT isoform in TG9 mice in advanced stages of dilated cardiomyopathy, and in murine surgical model of pressure overload hypertrophy. We found that the transcripts for GLUT1 and GLUT3 increased as heart failure developed in TG9 mice while transcripts for GLUT4, GLUT8, and GLUT12 were all decreased. The upregulation of both GLUT1 and GLUT3 in TG9 mice is consistent with prior reports of altered gene transcription during heart failure [39]. Both GLUT1 as well as GLUT3 are commonly found in high abundance in fetal tissues [40] and GLUT1 is the major GLUT expressed in the fetal heart [7]. The relative changes in mRNA transcript levels observed in the aortic banding model, however, demonstrate that pathologic cardiac hypertrophy is not necessarily accompanied by an increase in GLUT1 mRNA expression.
The decreased expression of GLUT12 in both the TG9 and aortic banding model in our study contrasts with a previous report of increased GLUT12 mRNA levels in a canine tachypacing heart failure model [20]. It is possible that this discrepancy reflects differences between species and specific molecular mechanisms for heart failure. This underscores the need for caution against overgeneralization of the findings from unique heart failure models. Clearly, continued efforts to more extensively identify and characterize the complex cellular changes that occur during heart failure development will allow greater insight into the mechanisms and functional consequences of altered myocardial GLUT expression.

Conclusions

Our data show that at least six members of the facilitative GLUT family are detectable in murine left ventricular tissue. Significant changes occur in mRNA message levels in mice with heart disease induced by different mechanisms. It remains to be determined whether these changes are adaptive or maladaptive. Continuing efforts to identify and characterize the functional significance of each of these isoforms in the myocardium will further enhance our understanding of myocardial energy dynamics under both healthy conditions and pathological circumstances. This work will serve as a basis for future efforts to investigate the individual roles of these newly identified GLUT isoforms in regulating myocardial energy dynamics.

Acknowledgements

We thank Dr. Maureen Charron for providing us with GLUT4KO mice. This work was supported in part by grants from the NIH (DK064572 and HL092798) and the Washington University NORC (P30DK056341).
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://​creativecommons.​org/​licenses/​by/​2.​0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

LAF conceived the study, assisted in the design, execution and interpretation of experiments, and drafted the manuscript. MA, MP and AK assisted in performing experiments. PH provided guidance in experimental design, performed data analysis and interpretation, and assisted in writing and editing the manuscript. All authors read and approved the final manuscript.
Literatur
1.
Zurück zum Zitat Kolwicz SC, Tian R: Metabolic therapy at the crossroad: how to optimize myocardial substrate utilization?. Trends Cardiovasc Med. 2009, 19 (6): 201-207. 10.1016/j.tcm.2009.12.005.PubMedCentralCrossRefPubMed Kolwicz SC, Tian R: Metabolic therapy at the crossroad: how to optimize myocardial substrate utilization?. Trends Cardiovasc Med. 2009, 19 (6): 201-207. 10.1016/j.tcm.2009.12.005.PubMedCentralCrossRefPubMed
2.
Zurück zum Zitat Stanley WC, Recchia FA, Lopaschuk GD: Myocardial substrate metabolism in the normal and failing heart. Physiol Rev. 2005, 85 (3): 1093-1129. 10.1152/physrev.00006.2004.CrossRefPubMed Stanley WC, Recchia FA, Lopaschuk GD: Myocardial substrate metabolism in the normal and failing heart. Physiol Rev. 2005, 85 (3): 1093-1129. 10.1152/physrev.00006.2004.CrossRefPubMed
3.
Zurück zum Zitat Ingwall JS, Weiss RG: Is the failing heart energy starved? On using chemical energy to support cardiac function. Circ Res. 2004, 95 (2): 135-145. 10.1161/01.RES.0000137170.41939.d9.CrossRefPubMed Ingwall JS, Weiss RG: Is the failing heart energy starved? On using chemical energy to support cardiac function. Circ Res. 2004, 95 (2): 135-145. 10.1161/01.RES.0000137170.41939.d9.CrossRefPubMed
4.
Zurück zum Zitat Wood IS, Trayhurn P: Glucose transporters (GLUT and SGLT): expanded families of sugar transport proteins. Br J Nutr. 2003, 89 (1): 3-9. 10.1079/BJN2002763.CrossRefPubMed Wood IS, Trayhurn P: Glucose transporters (GLUT and SGLT): expanded families of sugar transport proteins. Br J Nutr. 2003, 89 (1): 3-9. 10.1079/BJN2002763.CrossRefPubMed
5.
Zurück zum Zitat Thorens B, Mueckler M: Glucose transporters in the 21st Century. Am J Physiol Endocrinol Metab. 2010, 298 (2): E141-E145. 10.1152/ajpendo.00712.2009.PubMedCentralCrossRefPubMed Thorens B, Mueckler M: Glucose transporters in the 21st Century. Am J Physiol Endocrinol Metab. 2010, 298 (2): E141-E145. 10.1152/ajpendo.00712.2009.PubMedCentralCrossRefPubMed
6.
Zurück zum Zitat Studelska DR, Campbell C, Pang S, Rodnick KJ, James DE: Developmental expression of insulin-regulatable glucose transporter GLUT-4. Am J Physiol. 1992, 263 (1 Pt 1): E102-E106.PubMed Studelska DR, Campbell C, Pang S, Rodnick KJ, James DE: Developmental expression of insulin-regulatable glucose transporter GLUT-4. Am J Physiol. 1992, 263 (1 Pt 1): E102-E106.PubMed
7.
Zurück zum Zitat Smoak IW, Branch S: Glut-1 expression and its response to hypoglycemia in the embryonic mouse heart. Anat Embryol (Berl). 2000, 201 (5): 327-333. 10.1007/s004290050321.CrossRef Smoak IW, Branch S: Glut-1 expression and its response to hypoglycemia in the embryonic mouse heart. Anat Embryol (Berl). 2000, 201 (5): 327-333. 10.1007/s004290050321.CrossRef
8.
Zurück zum Zitat Brosius FC, Schwaiger M, Bartlett J, Sun D, Nguyen N, Liu Y: Persistent myocardial ischemia increases GLUT1 glucose transporter expression in both ischemic and non-ischemic heart regions. J Mol Cell Cardiol. 1997, 29 (6): 1675-1685. 10.1006/jmcc.1997.0405.CrossRefPubMed Brosius FC, Schwaiger M, Bartlett J, Sun D, Nguyen N, Liu Y: Persistent myocardial ischemia increases GLUT1 glucose transporter expression in both ischemic and non-ischemic heart regions. J Mol Cell Cardiol. 1997, 29 (6): 1675-1685. 10.1006/jmcc.1997.0405.CrossRefPubMed
9.
Zurück zum Zitat Razeghi P, Young ME, Alcorn JL, Moravec CS, Frazier OH, Taegtmeyer H: Metabolic gene expression in fetal and failing human heart. Circulation. 2001, 104 (24): 2923-2931. 10.1161/hc4901.100526.CrossRefPubMed Razeghi P, Young ME, Alcorn JL, Moravec CS, Frazier OH, Taegtmeyer H: Metabolic gene expression in fetal and failing human heart. Circulation. 2001, 104 (24): 2923-2931. 10.1161/hc4901.100526.CrossRefPubMed
10.
11.
Zurück zum Zitat Grover-McKay M, Walsh SA, Thompson SA: Glucose transporter 3 (GLUT3) protein is present in human myocardium. Biochim Biophys Acta. 1999, 1416 (1–2): 145-154.CrossRefPubMed Grover-McKay M, Walsh SA, Thompson SA: Glucose transporter 3 (GLUT3) protein is present in human myocardium. Biochim Biophys Acta. 1999, 1416 (1–2): 145-154.CrossRefPubMed
12.
Zurück zum Zitat Doege H, Schurmann A, Bahrenberg G, Brauers A, Joost HG: GLUT8, a novel member of the sugar transport facilitator family with glucose transport activity. J Biol Chem. 2000, 275 (21): 16275-16280. 10.1074/jbc.275.21.16275.CrossRefPubMed Doege H, Schurmann A, Bahrenberg G, Brauers A, Joost HG: GLUT8, a novel member of the sugar transport facilitator family with glucose transport activity. J Biol Chem. 2000, 275 (21): 16275-16280. 10.1074/jbc.275.21.16275.CrossRefPubMed
13.
Zurück zum Zitat Dawson PA, Mychaleckyj JC, Fossey SC, Mihic SJ, Craddock AL, Bowden DW: Sequence and functional analysis of GLUT10: a glucose transporter in the Type 2 diabetes-linked region of chromosome 20q12–13.1. Mol Genet Metab. 2001, 74 (1–2): 186-199.CrossRefPubMed Dawson PA, Mychaleckyj JC, Fossey SC, Mihic SJ, Craddock AL, Bowden DW: Sequence and functional analysis of GLUT10: a glucose transporter in the Type 2 diabetes-linked region of chromosome 20q12–13.1. Mol Genet Metab. 2001, 74 (1–2): 186-199.CrossRefPubMed
14.
Zurück zum Zitat Macheda ML, Kelly DJ, Best JD, Rogers S: Expression during rat fetal development of GLUT12–a member of the class III hexose transporter family. Anat Embryol Berl. 2002, 205 (5–6): 441-452.CrossRefPubMed Macheda ML, Kelly DJ, Best JD, Rogers S: Expression during rat fetal development of GLUT12–a member of the class III hexose transporter family. Anat Embryol Berl. 2002, 205 (5–6): 441-452.CrossRefPubMed
15.
Zurück zum Zitat Carayannopoulos MO, Chi MM, Cui Y, Pingsterhaus JM, McKnight RA, Mueckler M, Devaskar SU, Moley KH: GLUT8 is a glucose transporter responsible for insulin-stimulated glucose uptake in the blastocyst. Proc Natl Acad Sci U S A. 2000, 97 (13): 7313-7318. 10.1073/pnas.97.13.7313.PubMedCentralCrossRefPubMed Carayannopoulos MO, Chi MM, Cui Y, Pingsterhaus JM, McKnight RA, Mueckler M, Devaskar SU, Moley KH: GLUT8 is a glucose transporter responsible for insulin-stimulated glucose uptake in the blastocyst. Proc Natl Acad Sci U S A. 2000, 97 (13): 7313-7318. 10.1073/pnas.97.13.7313.PubMedCentralCrossRefPubMed
16.
Zurück zum Zitat Purcell SH, Aerni-Flessner LB, Willcockson AR, Diggs-Andrews KA, Fisher SJ, Moley KH: Improved insulin sensitivity by GLUT12 overexpression in mice. Diabetes. 2011, 60 (5): 1478-1482. 10.2337/db11-0033.PubMedCentralCrossRefPubMed Purcell SH, Aerni-Flessner LB, Willcockson AR, Diggs-Andrews KA, Fisher SJ, Moley KH: Improved insulin sensitivity by GLUT12 overexpression in mice. Diabetes. 2011, 60 (5): 1478-1482. 10.2337/db11-0033.PubMedCentralCrossRefPubMed
17.
Zurück zum Zitat Rogers JH, Tamirisa P, Kovacs A, Weinheimer C, Courtois M, Blumer KJ, Kelly DP, Muslin AJ: RGS4 causes increased mortality and reduced cardiac hypertrophy in response to pressure overload. J Clin Invest. 1999, 104 (5): 567-576. 10.1172/JCI6713.PubMedCentralCrossRefPubMed Rogers JH, Tamirisa P, Kovacs A, Weinheimer C, Courtois M, Blumer KJ, Kelly DP, Muslin AJ: RGS4 causes increased mortality and reduced cardiac hypertrophy in response to pressure overload. J Clin Invest. 1999, 104 (5): 567-576. 10.1172/JCI6713.PubMedCentralCrossRefPubMed
18.
Zurück zum Zitat Frolova AI, Moley KH: Quantitative analysis of glucose transporter mRNAs in endometrial stromal cells reveals critical role of GLUT1 in uterine receptivity. Endocrinology. 2011, 152 (5): 2123-2128. 10.1210/en.2010-1266.PubMedCentralCrossRefPubMed Frolova AI, Moley KH: Quantitative analysis of glucose transporter mRNAs in endometrial stromal cells reveals critical role of GLUT1 in uterine receptivity. Endocrinology. 2011, 152 (5): 2123-2128. 10.1210/en.2010-1266.PubMedCentralCrossRefPubMed
19.
Zurück zum Zitat Feldman A, Ray P, Silan C, Mercer J, Minobe W, Bristow M: Selective gene expression in failing human heart. Quantification of steady-state levels of messenger RNA in endomyocardial biopsies using the polymerase chain reaction. Circulation. 1991, 83 (6): 1866-1872. 10.1161/01.CIR.83.6.1866.CrossRefPubMed Feldman A, Ray P, Silan C, Mercer J, Minobe W, Bristow M: Selective gene expression in failing human heart. Quantification of steady-state levels of messenger RNA in endomyocardial biopsies using the polymerase chain reaction. Circulation. 1991, 83 (6): 1866-1872. 10.1161/01.CIR.83.6.1866.CrossRefPubMed
20.
Zurück zum Zitat Ware B, Bevier M, Nishijima Y, Rogers S, Carnes CA, Lacombe VA: Chronic heart failure selectively induces regional heterogeneity of insulin-responsive glucose transporters. Am J Physiol Regul Integr Comp Physiol. 2011, 301 (5): R1300-R1306. 10.1152/ajpregu.00822.2010.PubMedCentralCrossRefPubMed Ware B, Bevier M, Nishijima Y, Rogers S, Carnes CA, Lacombe VA: Chronic heart failure selectively induces regional heterogeneity of insulin-responsive glucose transporters. Am J Physiol Regul Integr Comp Physiol. 2011, 301 (5): R1300-R1306. 10.1152/ajpregu.00822.2010.PubMedCentralCrossRefPubMed
21.
Zurück zum Zitat Katz EB, Stenbit AE, Hatton K, DePinho R, Charron MJ: Cardiac and adipose tissue abnormalities but not diabetes in mice deficient in GLUT4. Nature. 1995, 377 (6545): 151-155. 10.1038/377151a0.CrossRefPubMed Katz EB, Stenbit AE, Hatton K, DePinho R, Charron MJ: Cardiac and adipose tissue abnormalities but not diabetes in mice deficient in GLUT4. Nature. 1995, 377 (6545): 151-155. 10.1038/377151a0.CrossRefPubMed
22.
Zurück zum Zitat Stenbit AE, Katz EB, Chatham JC, Geenen DL, Factor SM, Weiss RG, Tsao TS, Malhotra A, Chacko VP, Ocampo C: Preservation of glucose metabolism in hypertrophic GLUT4-null hearts. Am J Physiol Heart Circ Physiol. 2000, 279 (1): H313-H318.PubMed Stenbit AE, Katz EB, Chatham JC, Geenen DL, Factor SM, Weiss RG, Tsao TS, Malhotra A, Chacko VP, Ocampo C: Preservation of glucose metabolism in hypertrophic GLUT4-null hearts. Am J Physiol Heart Circ Physiol. 2000, 279 (1): H313-H318.PubMed
23.
Zurück zum Zitat Buerger A, Rozhitskaya O, Sherwood MC, Dorfman AL, Bisping E, Abel ED, Pu WT, Izumo S, Jay PY: Dilated cardiomyopathy resulting from high-level myocardial expression of Cre-recombinase. J Card Fail. 2006, 12 (5): 392-398. 10.1016/j.cardfail.2006.03.002.CrossRefPubMed Buerger A, Rozhitskaya O, Sherwood MC, Dorfman AL, Bisping E, Abel ED, Pu WT, Izumo S, Jay PY: Dilated cardiomyopathy resulting from high-level myocardial expression of Cre-recombinase. J Card Fail. 2006, 12 (5): 392-398. 10.1016/j.cardfail.2006.03.002.CrossRefPubMed
24.
Zurück zum Zitat Abel ED, Kaulbach HC, Tian R, Hopkins JC, Duffy J, Doetschman T, Minnemann T, Boers ME, Hadro E, Oberste-Berghaus C: Cardiac hypertrophy with preserved contractile function after selective deletion of GLUT4 from the heart. J Clin Invest. 1999, 104 (12): 1703-1714. 10.1172/JCI7605.PubMedCentralCrossRefPubMed Abel ED, Kaulbach HC, Tian R, Hopkins JC, Duffy J, Doetschman T, Minnemann T, Boers ME, Hadro E, Oberste-Berghaus C: Cardiac hypertrophy with preserved contractile function after selective deletion of GLUT4 from the heart. J Clin Invest. 1999, 104 (12): 1703-1714. 10.1172/JCI7605.PubMedCentralCrossRefPubMed
25.
Zurück zum Zitat Liao R, Jain M, Cui L, D'Agostino J, Aiello F, Luptak I, Ngoy S, Mortensen RM, Tian R: Cardiac-specific overexpression of GLUT1 prevents the development of heart failure attributable to pressure overload in mice. Circulation. 2002, 106 (16): 2125-2131. 10.1161/01.CIR.0000034049.61181.F3.CrossRefPubMed Liao R, Jain M, Cui L, D'Agostino J, Aiello F, Luptak I, Ngoy S, Mortensen RM, Tian R: Cardiac-specific overexpression of GLUT1 prevents the development of heart failure attributable to pressure overload in mice. Circulation. 2002, 106 (16): 2125-2131. 10.1161/01.CIR.0000034049.61181.F3.CrossRefPubMed
26.
Zurück zum Zitat Luptak I, Yan J, Cui L, Jain M, Liao R, Tian R: Long-term effects of increased glucose entry on mouse hearts during normal aging and ischemic stress. Circulation. 2007, 116 (8): 901-909. 10.1161/CIRCULATIONAHA.107.691253.CrossRefPubMed Luptak I, Yan J, Cui L, Jain M, Liao R, Tian R: Long-term effects of increased glucose entry on mouse hearts during normal aging and ischemic stress. Circulation. 2007, 116 (8): 901-909. 10.1161/CIRCULATIONAHA.107.691253.CrossRefPubMed
27.
Zurück zum Zitat Machado UF, Shimizu I, Saito M: Reduced content and preserved translocation of glucose transporter (GLUT 4) in white adipose tissue of obese mice. Physiol Behav. 1994, 55 (4): 621-625. 10.1016/0031-9384(94)90035-3.CrossRefPubMed Machado UF, Shimizu I, Saito M: Reduced content and preserved translocation of glucose transporter (GLUT 4) in white adipose tissue of obese mice. Physiol Behav. 1994, 55 (4): 621-625. 10.1016/0031-9384(94)90035-3.CrossRefPubMed
28.
Zurück zum Zitat Membrez M, Hummler E, Beermann F, Haefliger JA, Savioz R, Pedrazzini T, Thorens B: GLUT8 is dispensable for embryonic development but influences hippocampal neurogenesis and heart function. Mol Cell Biol. 2006, 26 (11): 4268-4276. 10.1128/MCB.00081-06.PubMedCentralCrossRefPubMed Membrez M, Hummler E, Beermann F, Haefliger JA, Savioz R, Pedrazzini T, Thorens B: GLUT8 is dispensable for embryonic development but influences hippocampal neurogenesis and heart function. Mol Cell Biol. 2006, 26 (11): 4268-4276. 10.1128/MCB.00081-06.PubMedCentralCrossRefPubMed
29.
Zurück zum Zitat Li Y, Wende AR, Nunthakungwan O, Huang Y, Hu E, Jin H, Boudina S, Abel ED, Jalili T: Cytosolic, but not mitochondrial, oxidative stress is a likely contributor to cardiac hypertrophy resulting from cardiac specific GLUT4 deletion in mice. FEBS J. 2012, 279 (4): 599-611. 10.1111/j.1742-4658.2011.08450.x.PubMedCentralCrossRefPubMed Li Y, Wende AR, Nunthakungwan O, Huang Y, Hu E, Jin H, Boudina S, Abel ED, Jalili T: Cytosolic, but not mitochondrial, oxidative stress is a likely contributor to cardiac hypertrophy resulting from cardiac specific GLUT4 deletion in mice. FEBS J. 2012, 279 (4): 599-611. 10.1111/j.1742-4658.2011.08450.x.PubMedCentralCrossRefPubMed
30.
Zurück zum Zitat Santalucía T, Camps M, Castelló A, Muñoz P, Nuel A, Testar X, Palacin M, Zorzano A: Developmental regulation of GLUT-1 (erythroid/Hep G2) and GLUT-4 (muscle/fat) glucose transporter expression in rat heart, skeletal muscle, and brown adipose tissue. Endocrinology. 1992, 130 (2): 837-846. 10.1210/en.130.2.837.PubMed Santalucía T, Camps M, Castelló A, Muñoz P, Nuel A, Testar X, Palacin M, Zorzano A: Developmental regulation of GLUT-1 (erythroid/Hep G2) and GLUT-4 (muscle/fat) glucose transporter expression in rat heart, skeletal muscle, and brown adipose tissue. Endocrinology. 1992, 130 (2): 837-846. 10.1210/en.130.2.837.PubMed
31.
Zurück zum Zitat Bourey RE, Koranyi L, James DE, Mueckler M, Permutt MA: Effects of altered glucose homeostasis on glucose transporter expression in skeletal muscle of the rat. J Clin Invest. 1990, 86 (2): 542-547. 10.1172/JCI114742.PubMedCentralCrossRefPubMed Bourey RE, Koranyi L, James DE, Mueckler M, Permutt MA: Effects of altered glucose homeostasis on glucose transporter expression in skeletal muscle of the rat. J Clin Invest. 1990, 86 (2): 542-547. 10.1172/JCI114742.PubMedCentralCrossRefPubMed
32.
Zurück zum Zitat Buller CL, Heilig CW, Brosius FC: GLUT1 enhances mTOR activity independently of TSC2 and AMPK. Am J Physiol Renal Physiol. 2011, 301 (3): F588-F596. 10.1152/ajprenal.00472.2010.PubMedCentralCrossRefPubMed Buller CL, Heilig CW, Brosius FC: GLUT1 enhances mTOR activity independently of TSC2 and AMPK. Am J Physiol Renal Physiol. 2011, 301 (3): F588-F596. 10.1152/ajprenal.00472.2010.PubMedCentralCrossRefPubMed
33.
Zurück zum Zitat Lehnen AM, Leguisamo NM, Pinto GH, Markoski MM, De Angelis K, Machado UF, Schaan B: The beneficial effects of exercise in rodents are preserved after detraining: a phenomenon unrelated to GLUT4 expression. Cardiovasc Diabetol. 2010, 9: 67-10.1186/1475-2840-9-67.PubMedCentralCrossRefPubMed Lehnen AM, Leguisamo NM, Pinto GH, Markoski MM, De Angelis K, Machado UF, Schaan B: The beneficial effects of exercise in rodents are preserved after detraining: a phenomenon unrelated to GLUT4 expression. Cardiovasc Diabetol. 2010, 9: 67-10.1186/1475-2840-9-67.PubMedCentralCrossRefPubMed
34.
Zurück zum Zitat Murata H, Hruz PW, Mueckler M: The mechanism of insulin resistance caused by HIV protease inhibitor therapy. J Biol Chem. 2000, 275 (27): 20251-20254. 10.1074/jbc.C000228200.CrossRefPubMed Murata H, Hruz PW, Mueckler M: The mechanism of insulin resistance caused by HIV protease inhibitor therapy. J Biol Chem. 2000, 275 (27): 20251-20254. 10.1074/jbc.C000228200.CrossRefPubMed
35.
Zurück zum Zitat Murata H, Hruz PW, Mueckler M: Indinavir inhibits the glucose transporter isoform Glut4 at physiologic concentrations. AIDS. 2002, 16 (6): 859-863. 10.1097/00002030-200204120-00005.CrossRefPubMed Murata H, Hruz PW, Mueckler M: Indinavir inhibits the glucose transporter isoform Glut4 at physiologic concentrations. AIDS. 2002, 16 (6): 859-863. 10.1097/00002030-200204120-00005.CrossRefPubMed
36.
Zurück zum Zitat Hresko RC, Hruz PW: HIV Protease Inhibitors Act as Competitive Inhibitors of the Cytoplasmic Glucose Binding Site of GLUTs with Differing Affinities for GLUT1 and GLUT4. PLoS One. 2011, 6 (9): e25237-10.1371/journal.pone.0025237.PubMedCentralCrossRefPubMed Hresko RC, Hruz PW: HIV Protease Inhibitors Act as Competitive Inhibitors of the Cytoplasmic Glucose Binding Site of GLUTs with Differing Affinities for GLUT1 and GLUT4. PLoS One. 2011, 6 (9): e25237-10.1371/journal.pone.0025237.PubMedCentralCrossRefPubMed
37.
Zurück zum Zitat Stenbit AE, Burcelin R, Katz EB, Tsao TS, Gautier N, Charron MJ, Le Marchand-Brustel Y: Diverse effects of Glut 4 ablation on glucose uptake and glycogen synthesis in red and white skeletal muscle. J Clin Invest. 1996, 98 (3): 629-634. 10.1172/JCI118833.PubMedCentralCrossRefPubMed Stenbit AE, Burcelin R, Katz EB, Tsao TS, Gautier N, Charron MJ, Le Marchand-Brustel Y: Diverse effects of Glut 4 ablation on glucose uptake and glycogen synthesis in red and white skeletal muscle. J Clin Invest. 1996, 98 (3): 629-634. 10.1172/JCI118833.PubMedCentralCrossRefPubMed
38.
Zurück zum Zitat Stuart CA, Howell ME, Zhang Y, Yin D: Insulin-stimulated translocation of glucose transporter (GLUT) 12 parallels that of GLUT4 in normal muscle. J Clin Endocrinol Metab. 2009, 94 (9): 3535-3542. 10.1210/jc.2009-0162.PubMedCentralCrossRefPubMed Stuart CA, Howell ME, Zhang Y, Yin D: Insulin-stimulated translocation of glucose transporter (GLUT) 12 parallels that of GLUT4 in normal muscle. J Clin Endocrinol Metab. 2009, 94 (9): 3535-3542. 10.1210/jc.2009-0162.PubMedCentralCrossRefPubMed
39.
Zurück zum Zitat Rosenblatt-Velin N, Montessuit C, Papageorgiou I, Terrand J, Lerch R: Postinfarction heart failure in rats is associated with upregulation of GLUT-1 and downregulation of genes of fatty acid metabolism. Cardiovasc Res. 2001, 52 (3): 407-416. 10.1016/S0008-6363(01)00393-5.CrossRefPubMed Rosenblatt-Velin N, Montessuit C, Papageorgiou I, Terrand J, Lerch R: Postinfarction heart failure in rats is associated with upregulation of GLUT-1 and downregulation of genes of fatty acid metabolism. Cardiovasc Res. 2001, 52 (3): 407-416. 10.1016/S0008-6363(01)00393-5.CrossRefPubMed
40.
Zurück zum Zitat Matsumoto K, Akazawa S, Ishibashi M, Trocino RA, Matsuo H, Yamasaki H, Yamaguchi Y, Nagamatsu S, Nagataki S: Abundant expression of GLUT1 and GLUT3 in rat embryo during the early organogenesis period. Biochem Biophys Res Commun. 1995, 209 (1): 95-102. 10.1006/bbrc.1995.1475.CrossRefPubMed Matsumoto K, Akazawa S, Ishibashi M, Trocino RA, Matsuo H, Yamasaki H, Yamaguchi Y, Nagamatsu S, Nagataki S: Abundant expression of GLUT1 and GLUT3 in rat embryo during the early organogenesis period. Biochem Biophys Res Commun. 1995, 209 (1): 95-102. 10.1006/bbrc.1995.1475.CrossRefPubMed
Metadaten
Titel
GLUT4, GLUT1, and GLUT8 are the dominant GLUT transcripts expressed in the murine left ventricle
verfasst von
Lauren Aerni-Flessner
Melissa Abi-Jaoude
Amanda Koenig
Maria Payne
Paul W Hruz
Publikationsdatum
01.12.2012
Verlag
BioMed Central
Erschienen in
Cardiovascular Diabetology / Ausgabe 1/2012
Elektronische ISSN: 1475-2840
DOI
https://doi.org/10.1186/1475-2840-11-63

Weitere Artikel der Ausgabe 1/2012

Cardiovascular Diabetology 1/2012 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Erhöhte Mortalität bei postpartalem Brustkrebs

07.05.2024 Mammakarzinom Nachrichten

Auch für Trägerinnen von BRCA-Varianten gilt: Erkranken sie fünf bis zehn Jahre nach der letzten Schwangerschaft an Brustkrebs, ist das Sterberisiko besonders hoch.

Hypertherme Chemotherapie bietet Chance auf Blasenerhalt

07.05.2024 Harnblasenkarzinom Nachrichten

Eine hypertherme intravesikale Chemotherapie mit Mitomycin kann für Patienten mit hochriskantem nicht muskelinvasivem Blasenkrebs eine Alternative zur radikalen Zystektomie darstellen. Kölner Urologen berichten über ihre Erfahrungen.

Ein Drittel der jungen Ärztinnen und Ärzte erwägt abzuwandern

07.05.2024 Medizinstudium Nachrichten

Extreme Arbeitsverdichtung und kaum Supervision: Dr. Andrea Martini, Sprecherin des Bündnisses Junge Ärztinnen und Ärzte (BJÄ) über den Frust des ärztlichen Nachwuchses und die Vorteile des Rucksack-Modells.

Vorhofflimmern bei Jüngeren gefährlicher als gedacht

06.05.2024 Vorhofflimmern Nachrichten

Immer mehr jüngere Menschen leiden unter Vorhofflimmern. Betroffene unter 65 Jahren haben viele Risikofaktoren und ein signifikant erhöhtes Sterberisiko verglichen mit Gleichaltrigen ohne die Erkrankung.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.