Introduction
Pancreatic cancer (PC) is one of the most common malignant tumors, with 458,918 new cases and 432,242 deaths worldwide in 2018 [
1]. Although the diagnosis and treatment of PC have been improved in recent years, the efficacy of surgery and chemotherapy is still unsatisfactory, with a 5-year survival rate of only 5% [
2,
3]. Therefore, it is urgent to explore novel molecular mechanisms of PC, identify new prognostic biomarkers, and develop more effective treatment strategies.
Long non-coding RNAs (lncRNAs) are transcripts greater than 200 nucleotides in length; they play an important role in many biological processes, including cell-cycle regulation, lineage differentiation, stem cell pluripotency, and cancer progression [
4]. Recent studies have shown that lncRNAs are aberrantly expressed in plenty of cancers, acting as oncogenes, tumor suppressors, or both, which participates in various biological processes, such as proliferation, migration, and metastasis [
5‐
7]. Several lncRNAs have been reported to be related to the growth, invasion, and metastasis of PC [
5,
8,
9], however, their specific roles and mechanisms in the occurrence of PC have not yet been elucidated.
LINC01128, located on chromosome 1 (827,591–859,446), is a novel lncRNA identified in cancer. Previous studies have shown that LINC01128 can enhance cell proliferation, migration, and invasion by upregulating stratifin (SFN) expression after binding with microRNA (miRNA) miR-383-5p [
10]. In contrast, another study demonstrated that LINC01128 acted as a tumor suppressor in acute myeloid leukemia [
11]. In our current study, we found LINC01128 was upregulated in PC tissues and cell lines, and loss-of-function and gain-of-function experiments showed that LINC01128 promoted cell proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) in vitro and tumor growth in vivo. Mechanistically, LINC01128 acted as a competing endogenous RNA (ceRNA) that upregulated the protein expression of lactate dehydrogenase A (LDHA) by sponging miR-561-5p. In summary, our study reveals a novel LINC01128/miR-561-5p/LDHA pathway in PC, indicating that LINC01128 may serve as a potential prognostic marker for the occurrence and development of PC, thereby providing a new target for PC treatment.
Methods
Clinical samples
48-primary PC specimens and their adjacent tissues were obtained from the First Affiliated Hospital of Nanchang University with the written consent of the patient. None of the patients received chemotherapy or radiotherapy prior to surgery. The study was approved by the Human Research Ethics Committee of the First Affiliated Hospital of Nanchang University.
Cell lines and cell culture
Human PC cell lines (SW1990, AsPC-1, PANC-1, BxPC-3, Capan-2, and MIAPaCa-2) and a normal pancreatic epithelial cell line (HPDE) were purchased from the American Type Culture Collection (ATCC). All cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, USA) with 10% fetal bovine serum (Invitrogen, USA) in an incubator under 5% CO2 at 37 °C. All cell lines were tested for mycoplasma contamination and authenticated using short tandem repeat (STR) profiling.
Real-time quantitative PCR (qRT-PCR)
First, TRIzol (Invitrogen) was used to extract total RNA from fresh pancreatic tissue samples and PC cells. Easy Script cDNA Synthesis Kit (TransGen Biotech) was used to reverse transcribed the extracted RNA into complementary DNA (cDNA). Subsequently, the Step One Plus real-time PCR system (Applied Biosystems) and Fast Start Universal SYBR Green Master Mix (Takara) were used for qRT-PCR detection. Table
1 presented the primer sequences used in our manuscript. The relative expression level was analyzed via using 2
−ΔΔCT method.
LINC01128 | AAGGTGAGGTGAGAGGACAGGAAG | CAAGGCAGGCACTCAACGGTAG |
miR-561 | CAAAGUUUAAGAUCCUUGAAGU | TCAACTGGTGTCGTGGAGTCGGC |
LDHA | GAGTGGAATGAATGTTGCTGGTGTC | CCAGGATGTGTAGCCTTTGAGTTTG |
GAPDH | CCAGCCGAGCCACATCGCTC | ATGAGCCCCAGCCTTCTCCAT |
U6 | CTCGCTTCGGCAGCACATATACT | ACGCTTCACGAATTTGCGTGTC |
Cell transfection
LINC01128 overexpression plasmid, short hairpin RNA (shRNA) against LINC01128, LDHA overexpression plasmid, LDHA inhibitors, miRNA mimics, and miRNA inhibitors were purchased from Gene Pharma (Shanghai, China). The cells under a density of 50–70% were transfected with the corresponding plasmid via Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturers’ guidance.
Cell proliferation and colony formation assays
A density of 2000 cells per well and 500 cells each well were needed for Cell Counting Kit 8 (CCK-8) assay and colony formation assays after 48 h-transfection, respectively. The details for each experiment could be seen as previously described [
12].
Migration and invasion assays
Cells at a density of 3 × 104 were seeded into the upper transwell chamber (BD Biosciences, USA) under FBS-free medium condition with or without Matrigel (Corning, USA), while the lower chamber was filled with complete medium. The chamber was collected and stained with crystal violet containing 1% methanol after 24-h incubation.
Luciferase reporter assay
An online software site named StarBase3.0 (
http://starbase.sysu.edu.cn/) was used in our study to predict the binding sites among LINC01128, miRNA-561 and LDHA [
13]. Lipofectamine 3000 transfection reagent was further used to transfect luciferase vector (Promega, USA) with wild-type LINC01128 or mutant-type LINC01128 into PC cells with the mimic. The luciferase activity of the reporter plasmid was finally detected via the double luciferase reporter gene assay system (Promega, USA).
Subcellular fractionation assay
APARIS kit purchased from Life Technology Company, USA was used to isolate nuclear and cytoplasmic RNA, which can be referred to the manufacturer's instructions for details. The levels of β-actin, U6, and LINC01128 of each fraction were subsequently analyzed and evaluated via qRT-PCR.
MS2-RIP assay
We co-transfected SW1990 and BxPC-3 cells with pcDNA-MS2, pcDNA-MS2-LINC01128, or pcDNA-MS2-LINC01128-MUT (miR-561-5p), along with pMS2-GFP (Addgene), using Viafect reagent. After 48 h, GFP antibody (Roche) and the Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (Millipore, Bedford, MA, USA) were used to collect and lyse the cells and perform RIP analysis according to the manufacturer's instructions. Finally, purified RNA was measured using qRT-PCR to confirm the presence of the bound target.
Western blot
Western blotting was performed as described previously [
12]. Antibodies against β-actin, E-cadherin, Slug, Snail, N-cadherin, vimentin, and LDHA were purchased from Cell Signaling Technology. Quantitative analysis of protein expression was realized by ImageJ software (National Institutes of Health, Bethesda, MD).
In vivo analysis
A total of 18 five-week-old female nude mice purchased from the National Laboratory Animal Center (Beijing, China) were randomly assigned into three groups for the following experiments. The cells about 1 × 106 from the negative control (NC) group, the LINC01128 overexpression group and the LINC01228 knockdown group were separately subcutaneously injected into the right axilla of the corresponding group of nude mice. Tumor volume was measured every four days using the formula: length × width2 × 0.5. After 28-day feed, the nude mice were killed by cervical dislocation under ether anesthesia and the tumors were collected and recorded. All animal experiments were ethically supported by the Animal Research Ethics Committee of Nanchang University.
Statistical analysis
SPSS software (version 25.0) was used for statistical analysis. Student's t-test and one-way ANOVA were used to evaluate the statistical significance of comparisons between two groups and more than two groups, respectively. Spearman’s correlation analysis was performed using MATLAB. Survival plots were drawn according to the Kaplan–Meier analysis. All experiments were repeated at least three times. p < 0.05 was considered statistically significant.
Discussion
It has been confirmed that lncRNAs are involved in the occurrence and development of various cancers [
17], including prostate cancer, bladder cancer, gallbladder cancer, PC, osteosarcoma, and breast cancer [
12,
18‐
21]. Several lncRNAs have been identified, such as THAP9-AS1 [
22], PLAT1 [
23], PVT1 [
24], and XLOC_006390 [
25], and their underlying mechanisms have been explored in PC. LINC01128 has previously been implicated in cervical cancer [
10] and acute myeloid leukemia [
11], however, there have been no reports on its effects in PC. In our study, we found that LINC01128 was upregulated in PC tissues and cell lines, and LINC01128 overexpression was related to the poor prognosis of patients with PC. In addition, LINC01128 knockdown inhibited cell proliferation, migration, invasion, and EMT processes of PC cells and led to G2/M phase arrest, while LINC01128 overexpression yielded opposite results.
Previous studies have shown that lncRNAs can regulate gene expression at the pre-transcriptional level, transcriptional level, and post-transcriptional level according to their locations in the cell [
26,
27]. The lncRNAs locating in the nucleus functioned pre-transcriptionally or transcriptionally, whereas lncRNAs located in the cytoplasm usually competing with endogenous RNAs and sponging miRNAs to regulate the expression of target mRNAs post-transcriptionally [
28,
29]. LINC01128, a novel lncRNA, has been shown to promote cell proliferation, migration, and invasion, inhibit cell apoptosis, sponge miR-383-5p, thus upregulating the expression of SFN in cervical cancer [
10]. However, another study demonstrated that LINC01128 inhibited the malignant behavior of acute myeloid leukemia [
11]. These findings may be explained by the fact lncRNAs possess a more pronounced tissue-specific expression pattern compared to protein-encoding genes. Through subcellular grading experiments, we found that LINC01128 was mainly located in the cytoplasm, indicating that LINC01128 may play a role as a ceRNA during initiation and progression by sponging miRNAs. The deregulation of miR-561-5p expression in various cancers indicates that miR-561-5p may play an important role in tumorigenesis and progression [
30,
31]. Kun et al. showed that miR-561-5p was frequently down-regulated in gastric cancer cell lines and tissues, and overexpression of miR-561-5p inhibited cell proliferation and invasion by downregulating c-Myc expression [
32]. A recent next-generation sequencing study showed that miR-561-5p was also often down-regulated in PC [
33]. In our study, StarBase3.0 predicted that miR-561-5p might be a downstream target of LINC01128. Subsequent luciferase reporter and MS2-RIP assays confirmed the interaction between LINC01128 and miR-561-5p. Further experiments have shown that miR-561-5p can promote cell proliferation, migration, and invasion during the initiation and progression of PC, suggesting that the cancer-promoting effect of LINC01128 mainly relies on miR-561-5p.
According to the ceRNA hypothesis, mRNA expression of target genes is upregulated due to the competitive binding of lncRNAs to miRNAs. StarBase3.0 was used to predict LDHA as a potential target gene for LINC01128 and miRNA-561. Previous studies have demonstrated that LDHA is a step-control enzyme in the glycolysis pathway [
34,
35]. Increasing evidences have shown that LDHA is upregulated in various cancers, which is related to the clinicopathological characteristics and prognosis of patients and involved in cancer growth [
36‐
38]. In various cancers, including breast cancer, nasopharyngeal cancer, gallbladder cancer, and PC, LDHA can promote malignant progression by increasing the production of lactic acid, accelerating the uptake of glucose, and regulating many cancer-related molecules [
39‐
43]. In a previous study, LDHA silencing induced a decrease in lactic acid concentration, and cancer cell migration was reduced by approximately 40% compared to the control siRNA [
44]. In our study, luciferase reporter and MS2-RIP experiments verified the direct binding of LDHA to miR-561-5p. LDHA silencing partially eliminated the tumorigenic effects of LINC01128 in the rescue experiment. Furthermore, LINC01128 promoted tumor growth and regulated LDHA protein expression in vivo. Recently, the application of tumor-related lncRNA HOX Transcript Antisense Intergenic RNA (HOTAIR) deletion mutant variant was defined an innovative RNA-based strategy for tumor therapy reported to reduce cellular motility, invasiveness, growth, and EMT [
45]. In addition, Wang et al. [
46] also shed great light on the importance of the researches regarding to targeting RNA therapeutics in cancer which aroused widespread attention and interests. Therefore, the development of the novel inhibitor or variant of LINC01128 for PC therapy emerges to be a significant strategy which needs further work in the future.
Taken together, LINC01128 can act as a ceRNA and regulate the expression of LDHA protein by competitively sponging miR-561-5p, thus promoting proliferation, migration, invasion, and EMT of PC cells. This highlights the LINC01128/miR-561-5p/LDHA axis as a potential significantly diagnostic and therapeutic target for patients with PC.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.