Skip to main content
Erschienen in: Cancer Cell International 1/2012

Open Access 01.12.2012 | Primary research

Mutations increased overexpression of Notch 1 in T-cell acute lymphoblastic leukemia

verfasst von: Chunlan Lin, Haitao Zheng, Chunyan Wang, Lijian Yang, Shaohua Chen, Bo Li, Yubing Zhou, Huo Tan, Yangqiu Li

Erschienen in: Cancer Cell International | Ausgabe 1/2012

Abstract

Background

The Notch signaling pathway is crucial in T-cell development, Notch 1 mutations are frequently present in T-cell acute lymphoblastic leukemia (T-ALL). To investigate the feature of Notch 1 mutation and its corresponding expression level in Chinese patients with T-ALL, detection of mutation and the expression level of Notch 1 gene was preformed using RT-PCR, sequencing and real-time PCR respectively.

Results

Two Notch 1 point mutations (V1578E and L1593P) located on HD-N domain were identified in three cases out of 13 T-ALL patients. The mutation on 4733 position (V1578E) found in two cases was a novel mutation. The overexpression of Notch 1 was detected in all samples with T-ALL, moreover, significantly higher expression of Notch 1 was detected in the T-ALL with Notch 1 mutation group compared with T-ALL with WT Notch 1 group (p = 0.0192).

Conclusions

Higher expression of Notch 1 was associated with Notch 1 mutation, more novel mutation of this gene might be identified in different populations and its contribution to the molecular pathogenesis of T-ALL is needed further research.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1475-2867-12-13) contains supplementary material, which is available to authorized users.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

YQL contributed to concept development and study design. CLL and SHC performed PCR and sequencing, HTZ, LJY and YBZ performed the real-time PCR. CYW, LJY, BL and HT were responsible for collection of clinical data. YQL and CLL and HTZ coordinated the study and helped drafting the manuscript. All authors read and approved the final manuscript.

Background

T-cell acute lymphoblastic leukemia (T-ALL) which occurs mainly via the proliferation of malignant T cell clones, accounts for 15% of newly diagnosed ALL cases in children and 20-25% of ALL cases in adults [1]. Overall, these are aggressive malignancies that do not respond well to chemotherapy and have a poorer prognosis than their B-cell counterparts [2]. Complex acquired genetic aberrations include chromosomal translocations (frequently involving TCR), as well as gene rearrangements and mutations resulting in abnormal expression of oncogenes like Notch 1 may be associated with the advance and resistance to treatment of this disease [3].
Notch 1 was discovered in 1991 through analysis of rare T-cell lymphoblastic leukemia/lymphoma with balanced (7;9) translocation [4]. Acquired Notch 1 mutations are present in about 50% of T-ALL [5, 6]. More than hundred different mutations frequently involved in heterodimerization domain (HD), transactivation domain (TAD) and praline, glutamic acid, serine, threonine-rich (PEST) domains of Notch 1 were reported in patients with T-ALL from a lot of researcher groups in different countries [510]. Little is known the incidence and feature of Notch 1 mutations in Chinese T-ALL patients [10], in this study, we detected the Notch 1 mutations in 13 Chinese patients with T-ALL and analyzed the corresponding expression level of Notch 1 gene.

Materials and methods

Samples

Thirteen newly diagnosed and untreated cases of T-ALL, 11 males and 2 females (6-55 years old; median age: 23.5 years) were included in this study, along with 20 healthy individuals as controls. The samples were collected with informed consent. All procedures were conducted in accordance with the guidelines of the medical ethics committees of the Health Bureau of Guangdong Province, China. The peripheral blood mononuclear cells (PBMCs), RNA extraction using Trizol reagent (Trizol®, Invitrogen, Carlsbad, CA, USA) and cDNA synthesis using random hexamer primers and reverse transcriptase (SuperScript® III, Invitrogen, Carlsbad, CA, USA) were performed according to the manufacturer's instructions.

RT-PCR and sequencing

To amplify different domain and exon of Notch 1 according the structure of the Notch 1 gene, 4-pair primers were purchased, which covered different exons, where the mutations happen frequently (Table 1) [5, 6]. RT-PCR was performed as our previous study, positive control (Jurkat cell line) and negative control (non-template) were included in each reaction [11, 12]. The PCR products were directly sequenced using a BigDye Terminator v3.1 Cycle Sequencing kit (Perkin Elmer, ABI) and the ABI PRISM 3100-Avant genetic analyzer. The sequences from different samples of T-ALL were analyzed with the BLAST software (http://​blast.​ncbi.​nlm.​nih.​gov/​Blast.​cgi) to identify the mutations of Notch 1 gene.
Table 1
List of the primers used in RT-PCR and real-time PCR for Notch 1 gene amplification
Primer 5,6
Sequence
Domain
PCR
Function
notch26 + 27-F
5'-ACGACCAGTACTGCAAGGACC - 3'
HD/exon 26 + 27
RT-PCR
Sense
notch26 + 27-R
5'- AAGAACAGAAGCACAAAGGCG - 3'
  
Antisense
notch28-F
5'- TCGCTGGGCAGCCTCAACATCC - 3'
HD/exon28
RT-PCR
Sense
notch28-R
5'- ACTCATTCTGGTTGTCGTCC - 3'
  
Antisense
Notch TAD-F
5'- GCCCTCCCCGTTCCAGCAGTCT - 3'
TAD
RT-PCR
Sense
Notch TAD-R
5'- GCCTGGCTCGGCTCTCCACTCA - 3'
  
Antisense
Notch PEST-F
5'- CAGATGCAGCAGCAGAACCTG - 3'
PEST/exon34
RT-PCR
Sense
Notch PEST-R
5'- AAAGGAAGCCGGGGTCTCGT - 3'
  
Antisense
Notch1-f
5'-GCGACAACGCCTACCTCT-3'
 
real-time PCR
Sense
Notch1-r
5'-CTGCTGGCACAGTCATCC-3'
  
Antisense
β2M-f
5'-TACACTGAATTCACCCCCAC-3'
 
real-time PCR
Sense
β2M-r
5'-CATCCAATCCAAATGCGGCA-3'
  
Antisense
Note: HD heterodimerization domain; TAD transactivation domain; PEST PEST domain.

Real-time quantitative RT-PCR (qRT-PCR)

Expression levels of Notch1 and the reference gene β2M were determined by SYBR Green I real-time PCR. PCR was performed as our previous description [12, 13]. The 2(-ΔΔT) method was used to present the data of the genes of interest relative to an internal control gene [1214]. The sequences of primers used in qRT-PCR were listed in Table 1.

Statistical analysis

Univariate analyses were done using the Mann-Whitney test to compare manes of Notch1 expression level between T-ALL with Notch 1 mutations or with wild-type (WT) Notch 1 status. P < 0.05 was considered as statistically significant.

Results

Notch 1 mutation and polymorphirsm in T-ALL

Notch 1 expression was detected in all of 13 cases with T-ALL by RT-PCR (Figure 1). The search for Notch 1 mutation was performed in exon 26, 27 and 28 (HD), TAD and PEST domain. The PCR products were direct sequenced and revealed two mutations at nucleotide position 4733 and 4778 respectively. The mutation on 4733 position was identified in two different cases, the nucleotide sequence was changed from GTG to GAG (codon 1578), thereby leading to an amino acid exchange (Valine to Glutamic), this was a novel mutation. While the mutation on 4778 position was identified in one case, the nucleotide sequence was changed from CTG to CCG (codon 1593), leading to an amino acid exchange from Leucine to Proline. All of mutations presented were heterozygous genetic alteration. And the mutations were located on HD N-terminus (Figure 2). Sequence analysis of Notch 1 segments revealed further a nucleotide exchange in all samples analyzed at position 5094, where we found a cytosine instead of a thymine, the alteration affected the third position of the codon 1698 and did not alter the amino acid sequence (data not shown).

Expression level of Notch 1 in T-ALL

In order to compare the expression level of Notch 1 gene in different T-ALL samples with Notch 1 mutations or with wild-type (WT) Notch 1 status, the expression level of Notch 1 gene was analyzed by real-time PCR, in comparison with healthy controls (0.37 ± 0.33), significantly higher expression of Notch1 was found in both T-ALL with WT Notch 1 (6.34 ± 7.03) (p = 0.0006) or with Notch 1 mutations (Mut Notch 1) (20.47 ± 10.81) (p < 0.0001) (Figure 3). Moreover, significantly higher expression of Notch 1 was detected in the T-ALL with Mut Notch 1 group compared with WT Notch 1 group (p = 0.0192) (Figure 3). Interesting, the expression level of Notch1 in two cases with WT Notch 1 T-ALL (24.28 and 9.06 respectively), which were not identified any mutation in the present study, was as high as the samples with Notch 1 mutation.

Discussion

Notch 1 signaling is crucial for T-cell differentiation and proliferation, mutational activation of Notch 1 is an important factor in T-ALL pathogenesis [5, 7]. Translocation and mutations of Notch 1 may alter its function resulting in overexpression and independent activation [15]. In this study, Notch 1 mutations were identified in 3 Chinese patients with T-ALL, the incidence of Notch 1 mutation was only 23.08% (3/13), it seemed relatively low in comparison with previous studies from different European and American countries [5, 6, 16]. There are rare studies described the incidence of Notch 1 mutation in Chinese cases, one report by Zhu et al showed that Notch 1 mutation was found in 29 patient out of 77 cases (37.7%) with Chinese T-ALL [10]. Similar incidence (22%) of Notch 1 mutations was reported by a research group from Turkey [8]. However, further research is needed to collect and investigate more samples and find out the representational results.
The higher frequency of Notch 1 mutation is found in HD, TAD and PEST domains [510]. In the present study, we used the 4 pair primers covered all the HD, TAD and PEST domains to amplify and sequence. Two mutations were identified in three cases, one was the mutation on 4778 position (L1593P) which was reported in previous studies [10, 17], while the another mutation was identified on 4733 position (V1578E) in two different cases with T-ALL, to our best knowledge, this is a novel identified mutation. The effect of the novel mutation is needed to evaluate by further functional analysis. Both mutations were located at HD N-terminus (HD-N) domain. The Notch 1 HD-N mutation may destabilize the subunit interaction and do not require the ligand-binding domain to activate signaling, resulting in constitutive Notch 1 activation and subsequent cell transformation [9, 17]. Based on the results, we compared the expression level of Notch 1 in T-ALL with WT Notch 1 or with Mut Notch 1 group, definitive result indicated that the expression level of Notch 1 was significant associated with Notch 1 mutation in HD-N domain, significantly higher expression of Notch 1 was detected in the T-ALL with Mut Notch 1 group compared with WT Notch 1 T-ALL group. However, overexpression of Notch 1 was a common feature in all T-ALL patients, whether the mechanism of Notch 1 overexpression in mutation or WT samples is different, it remains an open question. Although no mutation was detected in HD, TAD or PEST domains, high expression level of Notch1 in two cases with T-ALL in the present study was thought that might has potential mutation in the other domains, whole notch 1 gene sequence analysis for these cases is needed to follow up.
In the present study, we were unable to identify mutation of Notch 1 in PEST domain which regulates protein turnover by targeting proteins to the ubiquitin-proteosome complex for subsequent degradation [9, 15]. However, a high incidence (4/15 cases) of Notch 1 mutation in PEST domain was reported in Indian T-ALL patients [9], while lower incidence was described from a study in Chinese T-ALL patients (5/77, 6.5%) [15], as well as in Turkish patients (7%) and German patients (8.2%) [7, 18], the difference may due to the racial diversify.
In summary, Notch 1 mutations including a novel mutation were identified in a small cohort of Chinese T-ALL cases, and concomitant significantly higher expression level of Notch 1 was found. More ongoing study was performed to follow up its predictive value and to elucidate its contribution to the molecular pathogenesis of T-ALL.

Acknowledgements

This work was supported by Grants from National Natural Science Foundation of China (no. 30871091), the Fundamental Research Funds for the Central Universities (No. 21610603) and Science and Technology Innovation Key Project of Guangdong Higher Education Institutes (kjcxzd1013).
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

YQL contributed to concept development and study design. CLL and SHC performed PCR and sequencing, HTZ, LJY and YBZ performed the real-time PCR. CYW, LJY, BL and HT were responsible for collection of clinical data. YQL and CLL and HTZ coordinated the study and helped drafting the manuscript. All authors read and approved the final manuscript.
Anhänge

Authors’ original submitted files for images

Literatur
1.
Zurück zum Zitat Pui CH, Relling MV, Downing JR: Acute lymphoblastic leukemia. N Engl J Med. 2004, 350: 1535-48. 10.1056/NEJMra023001.CrossRefPubMed Pui CH, Relling MV, Downing JR: Acute lymphoblastic leukemia. N Engl J Med. 2004, 350: 1535-48. 10.1056/NEJMra023001.CrossRefPubMed
2.
Zurück zum Zitat Morris JC, Waldmann TA, Janik JE: Receptor-directed therapy of T-cell leukemias and Lymphomas. J Immunotoxicol. 2008, 5: 235-48. 10.1080/15476910802129661.CrossRefPubMed Morris JC, Waldmann TA, Janik JE: Receptor-directed therapy of T-cell leukemias and Lymphomas. J Immunotoxicol. 2008, 5: 235-48. 10.1080/15476910802129661.CrossRefPubMed
3.
Zurück zum Zitat Vanura K, Vrsalovic MM, Le T, Marculescu R, Kusec R, Jäger U, Nadel B: V(D)J targeting mistakes occur at low frequency in acute lymphoblastic leukemia. Genes Chromosomes Cancer. 2009, 48: 725-36. 10.1002/gcc.20677.CrossRefPubMed Vanura K, Vrsalovic MM, Le T, Marculescu R, Kusec R, Jäger U, Nadel B: V(D)J targeting mistakes occur at low frequency in acute lymphoblastic leukemia. Genes Chromosomes Cancer. 2009, 48: 725-36. 10.1002/gcc.20677.CrossRefPubMed
4.
Zurück zum Zitat Aster JC, Blacklow SC, Pear WS: Notch signalling in T-cell lymphoblastic leukaemia/lymphoma and other haematological malignancies. J Pathol. 2011, 223: 262-73.PubMedCentralCrossRefPubMed Aster JC, Blacklow SC, Pear WS: Notch signalling in T-cell lymphoblastic leukaemia/lymphoma and other haematological malignancies. J Pathol. 2011, 223: 262-73.PubMedCentralCrossRefPubMed
5.
Zurück zum Zitat Asnafi V, Buzyn A, Le Noir S, Baleydier F, Simon A, Beldjord K, Reman O, Witz F, Fagot T, Tavernier E, Turlure P, Leguay T, Huguet F, Vernant JP, Daniel F, Béné MC, Ifrah N, Thomas X, Dombret H, Macintyre E: NOTCH1/FBXW7 mutation identifies a large subgroup with favorable outcome in adult T-cell acute lymphoblastic leukemia (T-ALL): a group for research on adult acute lymphoblastic leukemia (GRAALL) study. Blood. 2009, 17: 3918-24.CrossRef Asnafi V, Buzyn A, Le Noir S, Baleydier F, Simon A, Beldjord K, Reman O, Witz F, Fagot T, Tavernier E, Turlure P, Leguay T, Huguet F, Vernant JP, Daniel F, Béné MC, Ifrah N, Thomas X, Dombret H, Macintyre E: NOTCH1/FBXW7 mutation identifies a large subgroup with favorable outcome in adult T-cell acute lymphoblastic leukemia (T-ALL): a group for research on adult acute lymphoblastic leukemia (GRAALL) study. Blood. 2009, 17: 3918-24.CrossRef
6.
Zurück zum Zitat Mansour MR, Duke V, Foroni L, Patel B, Allen CG, Ancliff PJ, Gale RE, Linch DC: Notch1 mutations are secondary events in some patients with T-Cell acute lymphoblastic leukemia. Clin Cancer Res. 2007, 13: 6964-9. 10.1158/1078-0432.CCR-07-1474.CrossRefPubMed Mansour MR, Duke V, Foroni L, Patel B, Allen CG, Ancliff PJ, Gale RE, Linch DC: Notch1 mutations are secondary events in some patients with T-Cell acute lymphoblastic leukemia. Clin Cancer Res. 2007, 13: 6964-9. 10.1158/1078-0432.CCR-07-1474.CrossRefPubMed
7.
Zurück zum Zitat Erbilgin Y, Sayitoglu M, Hatirnaz O, Dogru O, Akcay A, Tuysuz G, Celkan T, Aydogan G, Salcioglu Z, Timur C, Yuksel-Soycan L, Ure U, Anak S, Agaoglu L, Devecioglu O, Yildiz I, Ozbek U: Prognostic significance of NOTCH1 and FBXW7 mutations in pediatric T-ALL. Dis Markers. 2010, 28: 353-60.PubMedCentralCrossRefPubMed Erbilgin Y, Sayitoglu M, Hatirnaz O, Dogru O, Akcay A, Tuysuz G, Celkan T, Aydogan G, Salcioglu Z, Timur C, Yuksel-Soycan L, Ure U, Anak S, Agaoglu L, Devecioglu O, Yildiz I, Ozbek U: Prognostic significance of NOTCH1 and FBXW7 mutations in pediatric T-ALL. Dis Markers. 2010, 28: 353-60.PubMedCentralCrossRefPubMed
8.
Zurück zum Zitat Mansur MB, Ford AM, van Delft FW, Gonzalez D, Emerenciano M, Maia RC, Greaves M, Pombo-de-Oliveira MS: Occurrence of identical NOTCH1 mutation in non-twinned sisters with T-cell acute lymphoblastic leukemia. Leukemia. 2011, 25: 1368-70. 10.1038/leu.2011.96.CrossRefPubMed Mansur MB, Ford AM, van Delft FW, Gonzalez D, Emerenciano M, Maia RC, Greaves M, Pombo-de-Oliveira MS: Occurrence of identical NOTCH1 mutation in non-twinned sisters with T-cell acute lymphoblastic leukemia. Leukemia. 2011, 25: 1368-70. 10.1038/leu.2011.96.CrossRefPubMed
9.
Zurück zum Zitat Bhanushali AA, Babu S, Thangapandi VR, Pillai R, Chheda P, Das BR: Mutations in the HD and PEST domain of Notch-1 receptor in T-cell acute lymphoblastic leukemia: report of novel mutations from Indian population. Oncol Res. 2010, 19: 99-104. 10.3727/096504010X12864748215007.CrossRefPubMed Bhanushali AA, Babu S, Thangapandi VR, Pillai R, Chheda P, Das BR: Mutations in the HD and PEST domain of Notch-1 receptor in T-cell acute lymphoblastic leukemia: report of novel mutations from Indian population. Oncol Res. 2010, 19: 99-104. 10.3727/096504010X12864748215007.CrossRefPubMed
10.
Zurück zum Zitat Zhu YM, Zhao WL, Fu JF, Shi JY, Pan Q, Hu J, Gao XD, Chen B, Li JM, Xiong SM, Gu LJ, Tang JY, Liang H, Jiang H, Xue YQ, Shen ZX, Chen Z, Chen SJ: Notch1 mutations in T-cell acute lymphoblastic leukemia: prognostic significance and implication in multifactorial leukemogenesis. Clin Cancer Res. 2006, 12: 3043-9. 10.1158/1078-0432.CCR-05-2832.CrossRefPubMed Zhu YM, Zhao WL, Fu JF, Shi JY, Pan Q, Hu J, Gao XD, Chen B, Li JM, Xiong SM, Gu LJ, Tang JY, Liang H, Jiang H, Xue YQ, Shen ZX, Chen Z, Chen SJ: Notch1 mutations in T-cell acute lymphoblastic leukemia: prognostic significance and implication in multifactorial leukemogenesis. Clin Cancer Res. 2006, 12: 3043-9. 10.1158/1078-0432.CCR-05-2832.CrossRefPubMed
11.
Zurück zum Zitat Li Y, Chen SH, Yang L, Chen S, Lin C, Wang L, Lu Y, Geng S, Du X, Schmidt CA: Change in expression pattern of TCR-CD3 complex in patients with multiple myeloma. Hematology. 2011, 16: 143-50. 10.1179/102453311X12953015767491.CrossRefPubMed Li Y, Chen SH, Yang L, Chen S, Lin C, Wang L, Lu Y, Geng S, Du X, Schmidt CA: Change in expression pattern of TCR-CD3 complex in patients with multiple myeloma. Hematology. 2011, 16: 143-50. 10.1179/102453311X12953015767491.CrossRefPubMed
12.
Zurück zum Zitat Zheng H, Chen Y, Chen S, Niu Y, Yang L, Li B, Lu Y, Geng S, Du X, Li Y: Expression and distribution of PPP2R5 gene in leukemia. J Hematol Oncol. 2011, 4: 21-10.1186/1756-8722-4-21.PubMedCentralCrossRefPubMed Zheng H, Chen Y, Chen S, Niu Y, Yang L, Li B, Lu Y, Geng S, Du X, Li Y: Expression and distribution of PPP2R5 gene in leukemia. J Hematol Oncol. 2011, 4: 21-10.1186/1756-8722-4-21.PubMedCentralCrossRefPubMed
13.
Zurück zum Zitat Chen S, Zha X, Yang L, Li B, Zhong L, Li Y: Deficiency of CD3gamma, delta, epsilon and zeta expression in T-cells from AML patients. Hematology. 2011, 16: 31-6. 10.1179/102453311X12902908411832.CrossRefPubMed Chen S, Zha X, Yang L, Li B, Zhong L, Li Y: Deficiency of CD3gamma, delta, epsilon and zeta expression in T-cells from AML patients. Hematology. 2011, 16: 31-6. 10.1179/102453311X12902908411832.CrossRefPubMed
14.
Zurück zum Zitat Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001, 25: 402-8. 10.1006/meth.2001.1262.CrossRefPubMed Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001, 25: 402-8. 10.1006/meth.2001.1262.CrossRefPubMed
15.
Zurück zum Zitat Ferrando AA: The role of Notch1 signaling in T-ALL. Hematology Am Soc Hematol Educ Program. 2009, 353-61. Ferrando AA: The role of Notch1 signaling in T-ALL. Hematology Am Soc Hematol Educ Program. 2009, 353-61.
16.
Zurück zum Zitat Kox C, Zimmermann M, Stanulla M, Leible S, Schrappe M, Ludwig WD, Koehler R, Tolle G, Bandapalli OR, Breit S, Muckenthaler MU, Kulozik AE: The favorable effect of activating NOTCH1 receptor mutations on long-term outcome in T-ALL patients treated on the ALL-BFM 2000 protocol can be separated from FBXW7 loss of function. Leukemia. 2010, 24: 2005-13. 10.1038/leu.2010.203.PubMedCentralCrossRefPubMed Kox C, Zimmermann M, Stanulla M, Leible S, Schrappe M, Ludwig WD, Koehler R, Tolle G, Bandapalli OR, Breit S, Muckenthaler MU, Kulozik AE: The favorable effect of activating NOTCH1 receptor mutations on long-term outcome in T-ALL patients treated on the ALL-BFM 2000 protocol can be separated from FBXW7 loss of function. Leukemia. 2010, 24: 2005-13. 10.1038/leu.2010.203.PubMedCentralCrossRefPubMed
17.
Zurück zum Zitat Malecki MJ, Sanchez-Irizarry C, Mitchell JL, Histen G, Xu ML, Aster JC, Blacklow SC: Leukemia-associated mutations within the Notch1 heterodimerization domain fall into at least two distinct mechanistic classes. Mol Cell Biol. 2006, 12: 4642-51.CrossRef Malecki MJ, Sanchez-Irizarry C, Mitchell JL, Histen G, Xu ML, Aster JC, Blacklow SC: Leukemia-associated mutations within the Notch1 heterodimerization domain fall into at least two distinct mechanistic classes. Mol Cell Biol. 2006, 12: 4642-51.CrossRef
18.
Zurück zum Zitat Breit S, Stanulla M, Flohr T, Schrappe M, Ludwig WD, Tolle G, Happich M, Muckenthaler MU, Kulozik AE: Activating Notch1 mutations predict favorable early treatment response and long-term outcome in childhood precursor T-cell lymphoblastic leukemia. Blood. 2006, 108: 1151-17. 10.1182/blood-2005-12-4956.CrossRefPubMed Breit S, Stanulla M, Flohr T, Schrappe M, Ludwig WD, Tolle G, Happich M, Muckenthaler MU, Kulozik AE: Activating Notch1 mutations predict favorable early treatment response and long-term outcome in childhood precursor T-cell lymphoblastic leukemia. Blood. 2006, 108: 1151-17. 10.1182/blood-2005-12-4956.CrossRefPubMed
Metadaten
Titel
Mutations increased overexpression of Notch 1 in T-cell acute lymphoblastic leukemia
verfasst von
Chunlan Lin
Haitao Zheng
Chunyan Wang
Lijian Yang
Shaohua Chen
Bo Li
Yubing Zhou
Huo Tan
Yangqiu Li
Publikationsdatum
01.12.2012
Verlag
BioMed Central
Erschienen in
Cancer Cell International / Ausgabe 1/2012
Elektronische ISSN: 1475-2867
DOI
https://doi.org/10.1186/1475-2867-12-13

Weitere Artikel der Ausgabe 1/2012

Cancer Cell International 1/2012 Zur Ausgabe

Erhöhtes Risiko fürs Herz unter Checkpointhemmer-Therapie

28.05.2024 Nebenwirkungen der Krebstherapie Nachrichten

Kardiotoxische Nebenwirkungen einer Therapie mit Immuncheckpointhemmern mögen selten sein – wenn sie aber auftreten, wird es für Patienten oft lebensgefährlich. Voruntersuchung und Monitoring sind daher obligat.

Costims – das nächste heiße Ding in der Krebstherapie?

28.05.2024 Onkologische Immuntherapie Nachrichten

„Kalte“ Tumoren werden heiß – CD28-kostimulatorische Antikörper sollen dies ermöglichen. Am besten könnten diese in Kombination mit BiTEs und Checkpointhemmern wirken. Erste klinische Studien laufen bereits.

Perioperative Checkpointhemmer-Therapie verbessert NSCLC-Prognose

28.05.2024 NSCLC Nachrichten

Eine perioperative Therapie mit Nivolumab reduziert das Risiko für Rezidive und Todesfälle bei operablem NSCLC im Vergleich zu einer alleinigen neoadjuvanten Chemotherapie um über 40%. Darauf deuten die Resultate der Phase-3-Studie CheckMate 77T.

Positiver FIT: Die Ursache liegt nicht immer im Dickdarm

27.05.2024 Blut im Stuhl Nachrichten

Immunchemischer Stuhltest positiv, Koloskopie negativ – in solchen Fällen kann die Blutungsquelle auch weiter proximal sitzen. Ein Forschungsteam hat nachgesehen, wie häufig und in welchen Lokalisationen das der Fall ist.

Update Onkologie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.