SKP2 promotes breast cancer tumorigenesis and radiation tolerance through PDCD4 ubiquitination

WT and SKP2^−/− MEF mice were purchased from Model Animal Research Center Of Nanjing University. 293 T, MDA-MB-231, MCF-7, MDA-MB-468, SKBR-3 cells were obtained from American Type Culture Collection and cultured in DMEM medium containing 10% foetal bovine serum (FBS).

lentiCRISPR v2, pCMV-VSV-G, psPAX, pcDNA3-myc-Skp2, CMV10-3xFlag Skp2 delta-F, pSuper-retro-puro, HA-Ubiquitin, pRK5-HA-Ubiquitin-K48R and pET3a-Ubiquitin-K63R plasmids were purchased from Addgene, Flag–His-SKP2, Flag-His-ΔN-SKP2, Flag-His-PDCD4 and Flag-His-PDCD4(Ser67)plasmids were purchased from Biosune Biotechnology. The sgRNA and shRNA sequences for SKP2 were as follows: sgSKP2:AGAATCCAGAACACCCAGAA; shSKP2:GATCCCCGCCTAAGCTAAATCGAGAGAATTCAAGAGATTCTCTCGATTTAGCTTAGGCTTTTTGGAAA. shRNA sequences for PDCD4 were as follows: CCGGGCGGTTTGTAGAAGAATGTTTCTCGAGAAACATTCTTCTACAAACCGCTTTTTG.

Cells were transferred to 6-cm² flasks and incubated in DMEM with 10% FBS at 37 °C with 5% CO₂ for 24 h. The flasks were placed on a linear accelerator PRIMUS H (SIEMENS, GER) with a fixed source skin distance and X-ray irradiation at 0.6GY/min for 10 min. Nude mice were exposed to whole body-irradiationa at 0.1GY/min for 10 min twice a week at 4–6 weeks after tumor cells injection.

The following antibodies were used for IP or immunoblotting (IB): SKP2 antibody (IP:1:200, IB: 1:1000, Cell Signaling Technology, #2652), PDCD4 antibody (IP: 1:200, IB: 1:1000, Cell Signaling Technology, #9535), phosphorylated PDCD4(Ser67) antibody (IP: 1:200, IB: 1:1000, Abcam, ab73343), Flag antibody (IP: 1:200; IB:1:1000, Cell Signaling Technology, F1804), Caspase3 antibody (IB: 1:1000, Cell Signaling Technology, #9662), Cleaved Caspase3 antibody (IB: 1:1000, Cell Signaling Technology, #9664), γ-H2AX antibody (IB: 1:1000, Abcam, ab26350), HA-Tag antibody (IB,1:1000; Cell Signaling Technology, #3724), Myc-tag antibody (IP,1:200, IB,1:1000; Cell Signaling Technology, #2276), AKT(AKT3 + AKT2 + AKT1) antibody (IB:1:5000, Abcam, ab32505), pAKT(AKT3 (phospho S472) + AKT2 (phospho S474) + AKT1 (phospho S473)) antibody (IB:1:5000, Abcam, ab192623), PCNA antibody (IB,1:2000; Cell Signaling Technology, #2276), P53 antibody (IB: 1:1000, Abcam, ab32389), phosphorylated P53(Ser15) antibody (IB: 1:1000, Abcam, ab1431), Bax antibody (IB,1:1000; Cell Signaling Technology, #2772), Bcl-2 antibody (IB,1:1000; Cell Signaling Technology, #2872), β-Actin antibody (IB: 1:1000, Cell Signaling Technology, #3700), GAPDH antibody (IB: 1:1000, Abcam, ab32389), CHX, MG132 and RIPA Lysis Buffer were from Beyotime Biotechnology. SKP2 inhibitor SMIP004 and AKT inhibitor MK-2206 were from MCE. Protease inhibitor cocktai was from Roche. lipo-2000 were from Invitrogen.

RNA was isolated using RNeasy reagents (Thermo, USA) and then transcribed into cDNA using SuperscriptIII reagents (Invitrogen) with an oligo(dT)₂₀ primer. Quantitative real-timePCR was performed using Power SYBR Green Mastermix (Thermo, USA) on an Eppendorf realplex² Real-Time PCR System. All oligonucleotide primers were obtained from GENEWIZ Technologies (Suzhou, China). The housekeeping gene GAPDH was used as loading controls. The sequences of primer sets were 5′- TTGCCCTGCAGACTTTGCTA -3′ and 5’-CAGCTGGGTGATGGTCTCTG-3′ for SKP2; 5′- TGGATTAACTGTGCCAACCA-3′ and 5′- TCTCAAATGCCCTTTCATCC-3′ for PDCD4; 5’-GTCTCCTCTGACTTCAACAGCG-3′ and 5’-ACCACCCTGTT GCTGTAGCCAA-3′ for GAPDH.

The number of MCF-7 cells was 1 × 10⁶ /well in 6-well plates before transfection, 14 μg of pcDNA3-myc-SKP2 plasmid and 10 μL of Lipofectamine 2000 were transfected into MCF-7 cells according to the instructions of Lipofectamine 2000 Transfection Reagent. The cells were screened by using G418, and resistant clones were visualized after about 2 weeks of screening, followed by further monoclonalization of the cells. The result was verified by western blot.

The pSuper-retro-puro plasmid was linearized with BglII and HindIII enzyme (NEB, USA) and linearized with the verified shSKP2 sequence(from Sigma website) to construct the pSuper-retro-puro-shSKP2 recombinant plasmid and diluted to about 1 μg/μl; then transfected into 293 T cells with calcium phosphate for 48 h and the retrovirus was producted in supernatant. MDA-MB-231 cells was continuously by retrovirus infected for 3 days, and the positive cells were screened for 2 weeks with the medium containing puromycin (0.5 μg/ml). The result was verified by western blot.

The SKP2 Cas-9 gene knockout plasmid was constructed using the Lenti CRISPR V2 plasmid, then transfected with psPAX2 and pCMV-VSV-G plasmid at ratio of 4:3:2 into 293 T cells. MDA-MB-231 cells in 60 mm dish were infected with 1 to 5 mL of virus supernatant when the cell density is 60–80%. 50 to 100 cells were evenly divided into 96-well plates and cultured, and the cells were directly subjected to PCR, then sequenced, and the successfully silenced cells were expanded and cultured. The result was verified by western blot.

The method is the same as above. 14 μg pcDNA3-Flag-PDCD4 plasmid and 10 μL of Lipofectamine 2000 were transfected into MCF-7-SKP2 cells, then screened by G418 for 14 days. pSuper-retro-puro-shPDCD4 recombinant plasmid was diluted to about 1 μg/μl and then transfected into 293 T cells with calcium phosphate for 48 h and the retrovirus was producted in supernatant. MDA-MB-231-sgSKP2 cells were continuously infected by retrovirus for 3 days, and the positive cells were screened with puromycin for 2 weeks. The result was verified by western blot.

For western bloting, Whole-cell lysates were prepared using RIPA lysis buffer supplemented with protease inhibitors. For immunoprecipitation, Whole-cell lysates were prepared using weak RIPA lysis buffer supplemented with protease inhibitors. 1000 μg protein and 5 μL antibody were incubated in 200 μL immunoprecipitation buffer for 4 h before 20 μL immunomagnetic beads (Millipore) were added overnight, followed by western bloting which was performed as described previously [23].

Two hundred ninety-three T cells stably transfected with vector or Myc-SKP2 were immunoprecipitated with Myc antibody, and subjected to SDS–PAGE. Protein bands were excised from Commassie blue staining. Proteins were identified and searched against the NCBI protein database.

In vivo ubiquitination assays were performed as described [24]. In brief, 293 T cells were transfected with the indicated plasmids for 48 h and subjected to IB analysis. For in vitro ubiquitination assays, Flag–SKP2 and PDCD4 proteins purified from the 293 T cells were eluted in SDS-sample buffer and immunoblotted with anti-PDCD4 antibody.

For in vitro GST–SKP2 and PDCD4/PDCD4 (Ser67) interaction, GST–SKP2 proteins were purified from the bacterial lysates of BL21 competent cells using the glutathione-agarose beads according to the manufacturer’s standard procedures.Then the GST–SKP2 proteins bound to glutathione beads were incubated with the in vitro translated PDCD4 or PDCD4 (Ser67) peptide fragments at 4 °C overnight in the interaction buffer four times, and subjected to 8% SDS–PAGE, followed by IB.

MTT assay was performed to assess cell proliferation. When the cell density was about 70%, digested and adjusted the cell density at 1.5 × 10⁴ cells/mL, inoculated 100 μL/well into 96-well plates, set up 3 replicate wells for each cell line; After 12, 24, 48, 72 and 96 h, added 5 μL of 5 mg/mL 3-[4, 5-dimethylthiazol-2-yl]-2, 5 diphenyltetrazolium bromide (MTT) per well, continued to culture for 4 h; carefully aspirated the supernatant, added 200 μL DMSO per well, shaked for 10 min in a horizontal shaker, and measured OD value at 490 nm.

Colony formation assays were performed to assess cell proliferation. Cells in logarithmic growth phasewas digested and inoculated 800 cells in each 60 mm culture dish, set up 3 replicate dishes for each cell line cultured for 2 weeks in cell incubator; aspirated the supernatant, washed 3 times with PBS; Add 10 mL of methanol to the dish and fixed for 30 min; removed the methanol, added 1:10 dilution of Giemsa dye solution and kept for 30 min, rinsed off the dye solution with water, and dried naturally; counted, the number of cells above 30 was recorded as a clone, the number of clones was counted under the microscope and statistical analysis was performed.

Annexin V-APC/7-AAD apoptosis kit Flow was purchased from BD Bioscience (USA, Catalogue No. 550474). Washed cells twice with cold PBS and then resuspended cells in 1X Binding Buffer at a concentration of 1 × 10⁶ cells/ml. Transfered 100 μl of the solution (1 × 10⁵ cells) to a 5 ml culture tube. Added 5 μl of APC Annexin V (for one and two color analysis) and 5 μl of 7-AAD (for two color analysis only). Gently vortexed the cells and incubated for 15 min at RT (25 °C) in the dark. Added 400 μl of 1X Binding Buffer to each tube. Analyzed by flow cytometry within 1 h.

Hoechst 33342/PI (propidine iodide) apoptosis and Necrosis Assay Kit was purchased from Beyotime (China, Catalogue No. C1056). Washed cells twice with cold PBS and added 5 μl of Hoechst 33342 staining solution. Mixed gently, incubated at 4 °C for 20–30 min in an ice bath. Then observed with a microscope ant took photos.

For in vivo tumorigenesis assays, MCF-7, MCF-7-Con, MCF-7-SKP2, MCF7-SKP2-PDCD4 and MDA-MB-231, MDA-MB-231-Con, MDA-MB-231-sgSKP2, MDA-MB-231-sgSKP2-shPDCD4 stable expressed cells were cultured and ogarithmic growth phase cells were digested and resuspended in PBS, adjusted cell density to 5 × 10⁶/ml, subcutaneous injection 0.1 ml into the left lank of 6-week-old nude mice. Tumor size was measured weekly using acaliper, and the tumor volume was determined with the standard formula: L× W² × 0.5², where L is the longest diameter and W is the shortest diameter. After about 6 weeks, tumors were taken, the tumor weight and volume were determined. The Institutional Animal Care and Use Committee (IACUC) is from Ethics Committee of Qilu Hospital of Shandong University.

The institutional review board of QiLu hospital had approved the study by using formalin-fixed tissue. IHC analysis was performed on cancer and corresponding non-cancerous tissues from 60 breast carcinoma patients and 40 liver cancer patients between 2012 and 2015.

The procedures of IHC studies were performed as previously described [23]. In brief, The samples were fixed with 10% formalin, embedded in paraffin and sliced into 5-μm sections. The slides were incubated with primary antibodies against SKP2 (Cell Signaling Technology, 1:100), PDCD4 (Cell Signaling Technology, 1:50), Caspase-3 (Cell Signaling Technology, 1:100), γ-H2AX (Abcam, 1:100) and Ki-67 antibody (Epitomics, 1:160). Staining was observed in 5 randomly selected high-power fields. The staining intensity was based on the average percentage of positive cells. The scoring results were analyzed by 2 investigators.

Results were expressed as mean ± SD from at least three independent experiments. SPSS19.0 statistical software package (SPSS Inc.) was used for statistical analysis. Statistical differences between groups were assessed using the Student t test. Association between SKP2 and PDCD4 expression in breast cancer cell lines was evaluated by the Spearman rank correlation test. Association between SKP2 and PDCD4 expression in colorectal cancer tissue was evaluated by the Chi-square test. P < 0.05 was considered statistically significant.

Previous studies have shown that PDCD4 can be ubiquitylated and degraded by β-TRCP, a member of the F-box protein family. SKP2, also a F-box family member, showed correlation with PDCD4 [22]. We assumed that SKP2 may bind PDCD4 and mediate PDCD4 ubiquitination and degradation. To verify our inference, we generated 293 T cells stably overexpressed with Myc-SKP2, and the total cell lysates from these cells were immunoprecipitated with Myc antibody to pull down SKP2 interacting proteins. Mass spectrometric analysis was used to indicate that several peptides existed in the SKP2 immunocomplex, one of which corresponded to PDCD4 (Fig. 1a).

To validate the interaction between SKP2 and PDCD4, reciprocal co-immunoprecipitation (Co-IP) experiments were performed. We found that endogenous SKP2 interacted with endogenous PDCD4 (Fig. 1b, c). Previous research has shown that SCF^SKP2 specifically binds to the phosphorylated form of protein and targets it for degradation through a ubiquitin-dependent process [25]. Exogenous wild-type (WT) PDCD4 immunoprecipitated efficiently with SKP2, but PDCD4(S76A) mutant did not [22]. We then studied whether there was a similar phenomenon between SKP2 and PDCD4. Surprisingly, a peptide (amino acids 65–79) from PDCD4 containing phosphorylated Ser67 efficiently bounded to SKP2, but a corresponding non-phosphorylated peptide did not (Fig. 1d). PDCD4 (S67A) mutant also failed to bind to SKP2 in vivo (Fig. 1e). We further demonstrated that SKP2 interacted with PDCD4 in the form of SCF^SKP2 complex by using Co-IP assays. F-box domain and C-terminal LRR domain (amino acids 201–424) were also required for the interaction (Additional file 1: Figure S1a).

Having detected a physical interaction between the two proteins, we next determined whether PDCD4 protein levels were regulated by SKP2. We found that PDCD4 protein levels were upregulated in primary SKP2^−/− MEF cells compared with WT MEF cells by using immunofluorescence and western blot (Fig. 1f, g). The results were also verified in SKP2^−/− and WT mouse tissues by IHC (Additional file 2: Figure S2a). SKP2 and PDCD4 showed opposite expression levels in human breast cell lines (Fig. 1h). SKP2 was highly expressed in MDA-MB-231 and MDA-MB-468 cell lines, whereas lowly expressed in MCF-7 and SKBR-3 cell lines. PDCD4 showed opposite expression in these cell lines. The levels of PDCD4 were reduced upon SKP2 transfection and overexpressed upon SKP2 knockdown (Fig. 1i, j). However, overexpression of SKP2ΔF had no effect (Additional file 1: Figure S1b). Furthermore, SKP2 had no effect on the levels of PDCD4 mRNA (Fig. 1k, l), suggesting SKP2 promoted PDCD4 protein degradation. Collectively, these data strongly suggest that PDCD4 could be a novel substrate of SKP2.

Previous research has shown that AKT causes PDCD4 phosphorylation at Ser67, which affects the protein stability of PDCD4 [26]. SKP2 overexpression correlates with AKT activation, and AKT mediates downstream substrates phosphorylation [26, 27]. SCF^SKP2 directly triggers ubiquitination and degradation of its phosphorylated protein substrates [28, 29]. Since SKP2 regulated PDCD4 protein levels, it is highly possible that SKP2 plays a role in the phosphorylation, ubiquitylation and degradation of PDCD4. To test this hypothesis, we explored whether SKP2 could upregulate PDCD4 phosphorylation levels. Western blot results showed that phosphorylated PDCD4 (Ser67) and pAKT levels were remarkably increased upon SKP2 transfection (Fig. 2a). On the other hand, transfection of sgRNA targeting SKP2 led to a decrease in phosphorylated PDCD4 (Ser67) and pAKT levels (Fig. 2b). AKT inhibitor MK-2206 reversed the impact on phosphorylated PDCD4 levels in SKP2 transfected cells (Fig. 2c), indicating that SKP2 upregulates PDCD4 phosphorylation levels through the AKT signal pathway.

To verify the conjecture that SCF^SKP2 is a direct E3 ligase for PDCD4, we performed in vitro ubiquitination assays and found that SCF^SKP2 could induce PDCD4 ubiquitination in vitro (Fig. 2d). Then we conducted in vivo ubiquitination assays to determine whether SKP2 promotes PDCD4 ubiquitination. Notably, overexpression of SKP2 promoted ubiquitination of PDCD4 in the presence of the proteasome inhibitor MG132. PDCD4 (Ser67A) was unable to be ubiquitinated by SKP2, suggesting phosphorylation of PDCD4 on Ser67 is a requirement for PDCD4 ubiquitination (Fig. 2e). We further demonstrated that SKP2 triggered K48-linked ubiquitination of PDCD4 (Fig. 2f). Accordingly, these results suggest that PDCD4 is a novel substrate for SKP2. K48-linked ubiquitination is linked to proteasome-dependent degradation [30]. We then determined whether SKP2 could affect PDCD4 protein half-life. Indeed, SKP2^−/− extended PDCD4 protein half-life, leading to its stabilisation (Fig. 2g). These means SKP2 promotes K48-linked ubiquitination of PDCD4 in a proteasome-dependent manner. Therefore, our results suggest that SCF^SKP2 is the E3 ligase for PDCD4 that promotes PDCD4 ubiquitination and degradation.

Above research showed SKP2 negatively regulated PDCD4 expression promoted PDCD4 ubiquitination and degradation, we probed whether SKP2 promotes tumorigenesis via PDCD4 suppression in vitro and in vivo. To achieve this goal, we overexpressed PDCD4 in MCF-7-SKP2 cells and knocked down PDCD4 in MDA-MB-231-sgSKP2 cells. Western blot showed PDCD4 negatively regulated SKP2 protein levels (Fig. 3a, b). The same results were also observed in WT and SKP2^−/− MEF cells (Additional file 2: Figure S2b).

We then explored whether SKP2 promotes breast cancer cells proliferation via PDCD4 suppression. Western blot results showed SKP2 overexpression promoted PCNA protein expression in MCF-7 cells, while PDCD4 overexpression reversed the effect of SKP2 overexpression. On the other hand, SKP2 knockdown inhibited PCNA protein expression in MDA-MB-231 cells, while PDCD4 knockdown reversed the effect of SKP2 knockdown. These results imply SKP2 promotes cell proliferation via degrading PDCD4 in breast cancer. The cell survival efficiency was determined by colony-forming assay and MTT assay in MCF-7-vector, MCF-7-SKP2 and MCF-7-SKP2-PDCD4 cells as well as MDA-MB-231-vector, MDA-MB-231-sgSKP2 and MDA-MB-231-sgSKP2-sgPDCD4 cells. SKP2 overexpressed MCF-7 cells exhibited higher cell proliferation and colony formation compared with control cells, and PDCD4 overexpression reversed the effect of SKP2-MCF7 cells strikingly (Fig. 3c, e). On the other hand, SKP2 knockdown MDA-MB-231 cells exhibited lower cell proliferation and colony formation compared with control cells, and PDCD4 knockdown reversed the effect of MDA-MB-231-sgSKP2 cells (Fig. 3d, f). In vivo nude mice models also had similar results (Fig. 3g-i, k-m). IHC staining in breast tumors revealed that SKP2 overexpression promoted breast cancer cell proliferation in vivo, as determined by Ki-67 staining, and such promotion effect could be rescued by PDCD4 overexpression (Fig. 3j). On the other hand, Ki-67 staining showed SKP2 knockdown reduced breast cancer cell proliferation in vivo and such suppression effect could be rescued by PDCD4 knockdown (Fig. 3n). SKP2 and PDCD4 expression in nude mice was detected by immunohistochemical staining (Additional file 3: Figure S3). Altogether, these results suggest that SKP2 regulates breast cancer cells proliferation and breast cancer development via inhibiting PDCD4 expression.

Since PDCD4 induces apoptosis [31] and participates in DNA-damage response in a P53-dependent manner [20], we probed whether SKP2 could suppress cell apoptosis, promote DNA damage response and increase survival after radiation via PDCD4 suppression. Western bolt showed PDCD4 was upregulated in SKP2^−/− MEF cells compared with WT MEF cells after radiation (Fig. 4a). The same result was also verified in PDCD4 knockdown MDA-MB-231 cells (Additional file 4: Figure S4a, b). Cell apoptosis marker Bax and DNA damage response marker pP53 (Ser15) were downregulated while Bcl-2 was upregulated in SKP2^−/− MEF cells compared with WT MEF cells after radiation. These results imply SKP2 could suppress cell apoptosis and promote DNA damage response via degrading PDCD4 in breast cancer. The cell survival efficiency was determined by colony-forming assay and MTT assay in MCF-7-vector, MCF-7-SKP2 and MCF-7-SKP2-PDCD4 cells after radiation treatment. The results showed SKP2-overexpressed MCF-7 cells exhibited higher cell proliferation and colony formation compared with control cells, and PDCD4 overexpression reversed the effect of SKP2-MCF7 cells (Fig. 4b, d). MDA-MB-231-vector, MDA-MB-231-sgSKP2 and MDA-MB-231-sgSKP2-sgPDCD4 cells verified the effects from the opposite side (Fig. 4c, e). Annexin V analysis measured by FACS showed increased expression of SKP2 reduced MCF-7 cell apoptosis, and PDCD4 transfection could significantly reverse SKP2 effects after radiation (Fig. 4f). On the contray, reducing the expression of SKP2 increased cell apoptosis as compared with MDA-MB-231-Con cells after radiation. PDCD4 knockdown could significantly reverse increased cell apoptosis (Fig. 4g). The results were verified also in MDA-MB-231 cell after radiation by Hoechst 33342 staining (Additional file 5: Figure S5). The immunofluorescence analysis revealed less γ-H2AX foci was noted in the nuclei of MCF-7-SKP2 cells than MCF-7 control cells after radiation, and PDCD4 transfection reversed the effect (P < 0.01) (Fig. 4h). More γ-H2AX foci was localised in the nuclei of MDA-MB-231-sgSKP2 cells than in control cells after radiation, and PDCD4 knockdown reversed the effect (P < 0.01) (Fig. 4i). The same effect was also verified on the levels of Cleaved-Caspase3 and γ-H2AX in MDA-MB-231 cells by using the western blot (Fig. 4j). These results suggest that SKP2 significantly inhibits cell apoptosis and promotes DNA-damage response via PDCD4 suppression after radiation in breast cancer cells.

To understand the correlation of SKP2 and PDCD4, we performed Western blot and IHC to determine the expression of these proteins in human breast cancer samples and para-carcinoma samples (Fig. 5a, b). SKP2 was upregulated and PDCD4 was downregulated in breast cancer samples. SKP2 expression levels showed negative correlation with PDCD4 expression levels. Next, we studied the relationship between mRNA expression of SKP2 or PDCD4 and clinical outcome using a Kaplan–Meier plotter (http://​www.​kmplot.​com) [31]. SKP2 mRNA high expression was found to be correlated to significantly poor prognosis for breast cancer patients (Affymetrix ID: 203625_x_at, HR = 1.75 (1.57–1.96), p < 1e-16; Affymetrix ID: 203567_x_at, HR = 1.33 (1.19–1.49), p = 2.2e - 07) (Fig. 5c). On the contrary, PDCD4 mRNA high expression was significantly associated with favourable prognosis (Affymetrix ID: 202730_x_at, HR = 0.71 (0.64–0.8), p = 1.3e - 09; Affymetrix ID: 202731_x_at, HR = 0.68 (0.61–0.75), p = 2.2e - 12) (Fig. 5d). Mutation detection of breast cancer patients in cBioPortal for Cancer Genomics showed SKP2 mutated at the F-box domain and PDCD4 mutated at the MA-3 domain [32], which is the eIF4A binding domain [33] (Fig. 5e, f). These results together with our findings suggest that the SKP2-PDCD4 axis plays an important role in breast cancer development and represents an important biomarker for survival outcome of breast cancer patients (Fig. 5g).

The above research results indicate that SKP2 participates in DNA-damage response and cell survival after radiation, we further investigated whether SKP2 inhibitors could be used as potential radiosensitizers for treating breast cancer. We used SMIP004, which was found to downregulate SKP2 and stabilise p27 [34], to prove our concept. Western blot analysis showed SMIP004 significantly downregulated SKP2 expression levels and upregulated PDCD4 expression levels (Fig. 6a). SMIP004 inhibited PCNA protein expression while PDCD4 knockdown reversed the effect of SMIP004 (Fig. 6a). MCF-7 or MDA-MB-231 cells treated with SMIP004 exhibited lower cell proliferation and colony formation compared with control cells after radiation treatment (Fig. 6b-e). Immunofluorescence showed moreγ-H2AX foci localised in the nuclei of MCF-7 or MDA-MB-231 cells treated with SMIP004 than cells after radiation treatment (Additional file 6: Figure S6a, b). The inhibitory effects of SMIP004 combine with radiation treatment were also observed in vivo nude mice models (Fig. 6f-h, j-l). Caspase-3 and γ-H2AX staining showed SMIP004 promoted breast cancer cells apoptosis and increased DNA damage in vivo after radiation (Fig. 6i, m, Additional file 7: Figure S7a, b). These results showed radiotherapy combined with SMIP004 may have satisfactory clinical effects on breast cancer patients. In conclusion, SKP2 inhibitor can be used as a novel radiosensitizer in breast cancer clinical trials.