Background
Worldwide, breast cancer is the commonest cancer to affect women, and in Taiwanese women, it is the leading cause of deaths from cancer [
1]. It possesses highly metastatic and invasive properties, which explain its high mortality rate [
2]
. Among breast cancers, triple-negative breast cancers (TNBCs) lacking the genes for estrogen receptor, HER2, and progesterone receptor have been correlated with tumor aggressiveness. TNBCs are more likely than other breast cancer types to migrate beyond the breast and to recur after chemotherapy or lumpectomy [
3]
. TNBC cases comprise 15–20% of all breast cancer cases. Furthermore, patients with TNBC exhibit unfavorable outcomes compared with those with other breast cancer subtypes [
4]. TNBC tumor cells lack the requisite receptors, which renders some targeted or hormone therapies ineffectual. Consequently, combinations of chemotherapy medicines are typically prescribed for patients with TNBC. This approach, however, does not help patients with cancer to counter the chemotherapy-induced adverse side effects and drug resistance [
5]. Thus, novel compounds with lower toxicity are urgently required for effective treatment of TNBC.
In cancer cells, polarized epithelial cells complete multifaceted changes that cause them to begin expressing a mesenchymal phenotype and undergo migration, invasion, and metastasis. This process is referred to as the epithelial–mesenchymal transition (EMT) [
6]. Several factors induce EMT in vitro and in vivo, for example, TGF-β1, ROS, TNF-α, and hypoxia [
7‐
9]. EMT involves AKT/GSK or NFκB-mediated expression of Snail and promotes cell invasion and migration in various cancers, such as breast, renal, and colon cancers [
10,
11]
. The loss of E-cadherin, an adherens junction cell surface protein expressed in epithelial cells is the principal characteristic of EMT [
12]. The Snail and Slug signaling cascades are among those that may be involved in EMT in cancer cells. Snail and Slug are key transcription factors that can down regulate the expression of E-cadherin. They do this by binding to E-boxes in the E-cadherin promoter, subsequently increasing MMP-9 expression to promote cell invasion [
13]. However, few studies have investigated the suppression of molecular events and EMT responsible for EMT inhibition in anticancer treatment.
The Wnt/β-catenin signaling pathway contributes to cell fate decisions as well as the normal cellular response during cancer cell development [
14]. Researchers have suggested that dysregulated or uncontrolled triggering of this signaling pathway promotes tumor progression and metastasis in patients with breast cancer [
15]. Other attributes of the Wnt extracellular signaling pathways manage tissue architecture, proliferation, embryonic axis formation, and cell migration [
16] and can be broadly classified into noncanonical and canonical pathways. Canonical pathways are activated when the relevant Wnt ligands bind to the LRP-5/6 coreceptors and Frizzled transmembrane domain receptor [
17], whereas non-canonical pathways are β-catenin-independent and need Ror2/Ryk coreceptors rather than LRP-5/6 coreceptors. β-Catenin is usually aberrantly activated in breast cancer tissues. Therefore, Wnt/β-catenin pathway inhibition has the potential to reduce breast cell invasion as well as that of their EMT.
Coenzyme Q
0 (CoQ
0) also known as ubiquinone 0 and 2,3 dimethoxy-5-methyl-1,4 benzoquinone) and a member of the mitochondrial respiratory chain is a redox-active ubiquinone compound commonly present in the mitochondrion. It possesses strong antioxidant activity and prevents the mitochondrial permeability transition pore [
18] from being opened calcium-dependently. CoQ
0 has demonstrated activity against the proliferation of numerous cancer cell lines (e.g., HepG2, A549, and SW480) [
19,
20]. Although it exhibits cytotoxic anticancer activities, it was also demonstrated to stimulate insulin secretion in pancreatic islets [
21]. We described its anti-inflammatory and anti-angiogenic properties in vivo and in vitro in our previous study [
22]. Remarkably, administering CoQ
0 mixtures prevents oxidative damage in rodent spleen, blood, kidney, heart, and liver [
23]. Our previous study on CoQ
0 found that it significantly inhibits melanoma cell growth and tumor formation by inducing apoptosis and cell-cycle arrest [
24]. Additionally, it effectively promoted apoptosis by increasing ROS in MCF-7 cells that were irradiated using ultraviolet B [
22]. Despite CoQ
0’s anticancer attributes, its inhibitory effect on breast cancer metastasis and EMT and the molecular mechanism that gives it its therapeutic efficacy are unclear.
To ascertain CoQ0’s capabilities at inhibiting metastasis, EMT, and their associated changes, we designed a validated EMT and metastasis model for human TNBC (MDA-MB-231). Metastasis and EMT control levels and the principal molecular biomarkers involved were analyzed to ascertain the anti-EMT and antimetastatic attributes mediated by CoQ0. In addition, we sought to clarify the fundamental mechanism of TNBC cells.
Methods and materials
Reagent and antibodies
CoQ0 was from Sigma-Aldrich (St. Louis, MO, United States), as was the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide reagent for the MTT assay. GIBCO BRL/Invitrogen (Carlsbad, CA, United States) supplied L-glutamine, penicillin/streptomycin/neomycin, and Dulbecco’s modified Eagle’s medium (DMEM). Antibodies against anti-NFκB (p65), phos-IKK, Cyclin D1, CDK4, PARP, β-catenin, p-AKT, p-PI3K, PI3K, H3 antibodies, and IKK were from Cell Signaling Technology Inc. (Danvers, MA, United States), and those against MMP-9, vascular endothelial growth factor (VEGF), β-actin, c-Myc, Bax, Bcl-2, p21, p27, p53, caspase-3, cytochrome C, and I-κB were from Santa Cruz Biotechnology, Inc. (Heidelberg, Germany). The remaining chemicals were of HPLC grade and were from either Sigma-Aldrich or Merck (Darmstadt, Germany).
Generation of breast cancer cell lines
The tumorigenic triple-negative (MDA-MB-231, MDA-MB-231-Brain, MDA-MB-231-Brain-erb2, MDA-MB-231-Bone, MDA-MB-231-Bone-erb2, BT549, Hs578T), non-tumorigenic MCF-10A, and estrogen receptor-positive (BT474 and MCF-7) cell lines were from ATCC (Manassas, VA, United States). Cell lines underwent culturing at 37 °C in DMEM supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, and 1% streptomycin. Furthermore, MCF-10A cells were grown at 37 °C in DMEM/F12 supplemented with 2 mM glutamine, 5% horse serum, 0.5 μg/mL hydrocortisone, 20 ng/mL human epidermal growth factor, 10 μg/mL insulin, and 1% streptomycin.
MTT assay
MTT colorimetric assays were employed to ascertain cell viability [
25]. Cells were grown in 12-well plates to a confluence. Subsequently, they underwent 24-h CoQ
0 incubation (2.5–20 μM). Following the MTT assay, an ELISA microplate reader (Bio-Tek Instruments Inc., Winooski, VT, United States) was utilized to ascertain the absorbance at 570 nm. The proportion of viable cells relative to vehicle-treated control cells (designated as 100%) was the basis for evaluating CoQ
0’s effect on cell viability.
In vitro wound-healing assay
The effects of CoQ
0 on cell migration were evaluated using in vitro wound-healing assay as follows: the cells were cultured (density: 1 × 10
4), and the standard protocol of the in vitro healing assay was followed [
26]. Subsequently, the cells underwent 24-h incubation with varying CoQ
0 concentrations (0.5–2 μM) in 1% FBS medium followed by phosphate-buffer saline (PBS) wash (3 times). They were subsequently fixed using 100% methanol. Finally, they were stained using Giemsa staining solution (Merck, Darmstadt). Migrated cells were monitored, and phase-contrast microscopy at 200× was used to photograph them. Image-Pro Plus (Media Cybernetics, Inc., Rockville, MD, United States) was used to compute the wounded area’s closure.
Cell invasion assay
Cell invasion assay was conducted using BD Matrigel invasion chambers (Bedford, United States), as described by Debbie and Brooks [
27]. We used 10 μL of Matrigel (25 mg/50 mL) to coat 8-μm polycarbonate membrane filters. Then, we seeded the cells (density: 1 × 10
5) onto the Matrigel-treated filter in 200 μL of CoQ
0 (0.5–2 μM) devoid of serum. Cell migration underwent 24-h observation at 37 °C. After being incubated for 24 h, the cells that did not migrate were removed from atop the membrane by using a cotton swab. On the other side of the membrane, the migrated cells were fixed for 15 min in ice-cold methanol (75%) and were washed in PBS three times. Subsequently, Giemsa stain was used to fix the cells; they were subsequently destained using PBS. Images were viewed and captured through 200× light microscopy; we quantified invading cells by using manual counting. All experiments were repeated three times.
Protein isolation and Western blotting
We seeded the cells (density: 4 × 106 cells/dish) into a 6-cm dish that had undergone 24-h CoQ0 (2.5–10 μM) pre-treatment. Next, they underwent trypsinization and 3 times rinsing with ice-cold PBS. Total cytoplasmic and nuclear extracts were isolated in accordance with the suggested protocol (Pierce Biotechnology, Waltham, MA, United States). The protein concentration was ascertained using Bradford reagent, with bovine serum albumin (BSA) as standard. The lysate was separated through 12% SDS-PAGE. PVDF membranes were immunoblotted using specific primary antibodies and their corresponding horseradish peroxidase–conjugated secondary antibodies. An enhanced chemiluminescence substrate (Pierce Biotechnology, Waltham) was utilized to develop the blot, and a densitometric graph displaying band intensities was generated using AlphaEaseFC (Miami, FL, United States).
RNA extraction and RT-PCR
After cells had undergone 24-h pre-treatment with various CoQ
0 concentrations (0.5–2 μM), they were harvested. Subsequently, TRIzol reagent (Invitrogen, Carlsbad) was employed to extract total RNA. Then, Bio-Rad iCycler PCR instrument (Bio-Rad, Hercules, CA, United States) and SuperScript-III One Step RT-PCR platinum
taq kit (Invitrogen, Carlsbad) were used for RT-PCR of 1 μg of total RNA in accordance with the procedure [
28]. The PCR product was analyzed in agarose gel (1%). The primers used were as follows: MMP-2 F: 5′ATGACAGCTGCACCACTGAG-3′, R-5′-ATTTGTTGCCCAGGAAAGTG -3′; MMP-9 F-5′- TTGACAGCGACAAGAAGTGG-3′, R-5′-GCCATTCACGTCGTCCTTAT-3′; uPA F-5′-TGCGTCCTGGTCGTGAGCGA-3′, R-5′-CAAGCGTGTCAGCGCTGTAG-3′; uPAR F-5′CATGCAGTGTAAGACCCAACGGGGA-3′, R-5′-AATAGGTGACAGCCCGGCCAGAGT3′; E-cadherin: F-5′-TGGGTTATTCCTCCCATCAG-3′, R-5′TTTGTCAGGGAGCTCAGGAT-3′; Vimentin: F- 5′CTCTTCCAAACTTTTCCTCC 3′, R-5′AGTTTCGTTGATAACCTGTC 3′; Snail: F-5′CGAAAGGCCTTCAACTGCAAAT 3′, R-5′ACTGGTACTTCTTGACATCTG 3′; Slug: F- 5′CGCCTCCAAAAAGCCAAAC 3′, R-5′CGGTAGTCCACACAGTGATG 3′; β-catenin: F-5′-AAGGAAGCTTCCAGACATGC 3′, R-5′AGCTTGCTCTCTTGATTGCC 3′; 18S F-5′GTCTGTGATGCCCTTAGATG 3′, R-5′AGCTTATGACCCGCACTTAC 3′.
We performed a mammosphere formation assay as described elsewhere with several minor modifications [
29]. For mammosphere culture from MDA-MB-231 cells, we suspended cells at 1 × 10
3 cells/mL and seeded them onto ultralow attachment plates (Corning Inc., Corning, NY, United States) in MammoCult basal medium (STEMCELL Technologies, United States) supplemented with 0.2% heparin (STEMCELL Technologies, United States), 500 μg/mL cortisone (STEMCELL Technologies, United States), and 10 μL/mL mammo supplant serum (STEMCELL Technologies, United States) in an incubator supplemented with 5% CO
2. The cells underwent dimethyl sulfoxide (DMSO) (0.1%) or CoQ
0 (0.5–2 μM) treatment and were then incubated for 1 week during which time the plate was kept stationary and the media were replenished. On day 7, the mammospheres were collected through gentle centrifugation and dissociated into single-cell suspensions; the cells then underwent repeated vehicle control (0.1% DMSO) or CoQ
0 (0.5–2 μM) treatment. The cell suspensions underwent three passages through a syringe with 26-G needles. This procedure resulted in single-cell suspensions being formed. We then adjusted cell concentration to 500 cells/mL and plated the 2-mL single-cell suspensions on a 35-mm ultralow attachment plate (Corning Inc., Corning) in triplicate. For serial passage (secondary sphere formation) and differentiation experiments, this study employed early progenitor cells as well as sphere forming, breast stem–enhanced single cells. On day 14, a graticule-enabled microscope was employed to determine the number of mammospheres of diameter > 50 μm as well as the number of colony-forming units. Then, the cells were trypsinized, and the cell numbers were counted. Two independent observers not exposed to the treatment were asked to count the sphere numbers manually. All experiments were conducted three times.
MDA-MB-231 cells (density: 5 × 105 cells/60-mm dish) underwent 24-h CoQ0 treatment (concentrations: 0–7.5 μM). We then trypsinized the cells and replated them (density: 3 × 104 cells/35-mm dish) in triplicate. They were subsequently subjected to 7-d RPMI 1640 incubation. Afterward, they were fixed at room temperature for 10 min using 10% neutral buffered formalin and stained using 20% Giemsa stain (Merck, Darmstadt). We subsequently assayed the cells for ability to form colonies and proliferation rate. The number of colonies of size > 1 mm was determined with light microscopy (40×). Colony number was ascertained based on a colony formation percentage of 100% in the absence of CoQ0.
Gelatin zymography assay
The zymography protease assay was used to quantify the activity of MMP-2 and 9 in the medium used to grow the MCF-10A cells. The MCF-10A cells (1 × 10
6 cells/well) were seeded into 6-well culture dishes and grown in medium with 10% FBS to a nearly confluent monolayer. The cells were re-suspended in 1% FBS medium, and then incubated with TGF-β/TNF-α (10 ng/mL) and CoQ
0 (2 μM) for 24 h. After treatment the remains procedures were followed according to the previously mentioned work [
30]. The changes in expression of MMP-2 and -9 were quantified by Matrix Inspector 2.1 software (AlphaEase, Genetic Technology, Inc., Miami, FL, USA).
Immunofluorescence staining
Cells (density: 1 × 104 cells/well) underwent culturing; this culturing was performed in an eight-well glass Tek chamber. Subsequently, CoQ0 (0.5–2 μM) was used to pre-treat them for the recommended duration. Next, they underwent 15-min fixing in paraformaldehyde (2%), 10-min Triton (0.1%) permeabilization, washing, and FBS (10%) blocking in PBS. Accordingly, the cells underwent 2-h primary antibody (anti-p65, anti-Vimentin, anti-F-actin, anti-β-catenin, and anti-E-cadherin) incubation in 1.5% FBS. Subsequently, they were incubated for 1 h using FITC-conjugated secondary antibody in BSA (6%). We then stained them for 5 min using 1 μg/mL DAPI. The cells were subsequently subjected to secondary antibody incubation and DAPI staining, washed thoroughly using PBS, and then visualized through fluorescent confocal microscopy.
Luciferase reporter assay
The transcriptional activity of NFκB, E-cadherin, and β-catenin was ascertained through dual-luciferase reporter assays (Promega, Fitchberg, WI, United States). We grew the cells to 70–80% confluence for 5 min in a 24-well plate by using serum-free DMEM devoid of antibiotics. They were subsequently transfected with NFκB, E-cadherin, or β-catenin plasmids with β-galactosidase or a pcDNA vector by using Lipofectamine 2000 (Invitrogen, Carlsbad). Afterward, they underwent 4-h CoQ0 (0.5–2 μM) treatment. Subsequently, they were lysed, following which their luciferase activity was ascertained through luminometry (Bio-Tek, Winooski) and then standardized to their β-galactosidase activity in the cell lysates. In addition, we quantified the intensity of relative fluorescence by using a luminance ELISA reader.
Immunoprecipitation
Protein A-sepharose beads were used to preclear 1 mg of the protein sample for 1 h, which subsequently underwent 24-h incubation using 2 mg of anti-E-cadherin antibody. Radioimmunoprecipitation assay (RIPA) buffer was employed to wash the immunoprecipitated complexes. Subsequently, the complexes were denatured using SDS sample buffer. Centrifugation (14,000 rpm) was employed to clarify the cell lysate for 15 min. It was then separated through SDS-PAGE and conveyed to PVDF membranes. Skim milk (5%) was used to block the membrane for 30 min. Then, it was immunoblotted using specific primary antibodies and the corresponding HRP-conjugated secondary antibodies for 1 h and subsequently visualized with the aid of an electroluminescence reagent (Millipore, Burlington, MA, United States).
Transient transfection of siRNA targeting β-catenin
Lipofectamine RNAiMAX (Invitrogen, Carlsbad) was used to transfect the cells with β-catenin siRNA. To facilitate transfection, the cells were incubated in 10% FBS containing DMEM; subsequently, they were plated to 60% confluence on a 6-well plate during transfection. The following day, we replaced the culture medium with 500 μL of Opti-MEM, which we then subjected to transfection using 5 μL of RNAiMAX.
We mixed 250 μL of Opti-MEM and 5 μL of RNAiMAX and subjected the mixture to incubation for 5 min at room temperature. In another tube, 100 pM siRNA in 1 mL of Opti-MEM and 250 μL of Opti-MEM were combined. Subsequently, we added siRNA solution to the diluted RNAiMAX reagent, and the prepared 500-μL siRNA/RNAiMAX mixtures underwent incubation at room temperature for 25 min to facilitate the formation of the complex.
Afterward, the cells and solution were combined. They together represented a final transfection volume of 1 mL. After 6-h incubation, 2 mL of standard growth medium was used to replace the transfection medium, which subsequently underwent culturing at 37 °C. Afterward, the cells underwent 24-h CoQ0 (1 μM) incubation. To ascertain cellular protein level, Western blotting was employed.
Analysis of F-actin distribution and cell morphology
The cells (1 × 104 cells/8-chamber slide) were cultured in DMEM or high glucose that contained FBS (10%). Twenty-four hours later, the cells underwent 1-h CoQ0 (2 μM) pre-treatment. Subsequently, they were activated using TGF-β/TNF-α (10 ng/mL) for 24 h. We then fixed them in paraformaldehyde (3.7%), blocked them in BSA (3%), and stained the F-actin using TRITC-conjugated phalloidin in order to monitor the actin cytoskeleton; to image the nuclei, DAPI (1 μg/mL) was added. Fluorescence microscopy (magnification: 100×; Nikon, Tokyo, Japan) was employed to capture images.
Cell-cycle analysis
Cellular DNA content was assessed through flow cytometry using propidium iodide (PI)–labeled cells. DMEM medium with thymidine (3 mM) was used to block AGS cells for 16 h. PBS was subsequently employed to wash cell-cycle synchronized cells, and these cells were reprogrammed so as to enter the G1 phase for 24 h with fresh DMEM medium added that included CoQ0 (5–15 μM). Afterward, cellular trypsinization was executed, and the cells were subsequently fixed at − 20 °C overnight in 3 mL of ice-cold ethanol (70%). Their pellets were gathered through centrifugation and resuspended in 0.5 mL of PI staining buffer (1% Triton x-100, 0.5 mg/mL RNase A, 4 μg/mL PI in PBS). They were then incubated at room temperature for 30 min. FACScan cytometry (BD Biosciences, San Jose, CA, United States) adapted with a 488-nm single Ar ion laser was adopted to ascertain cell-cycle progression. ModFit (Verity Software House, Topsham, ME, United States) was utilized to analyze the cell cycles.
TUNEL assay
Apoptotic cell death was examined by applying the TUNEL method by using TdT-dUTP-fluorescein in situ cell detection tools (Roche, Mannheim, Germany) as expounded elsewhere [
31]. Optical microscopy was used to view the slides.
Assay for cell apoptosis rate
We conducted double staining for PI and Annexin V-FITC to evaluate MDA-MB-231 cells’ apoptotic rate. In short, cells underwent 24-h CoQ0 (5–15 μM) incubation, trypsinization, 2× PBS washing, and 5-min 800-rpm centrifugation. Next, we suspended the cells (1 × 106 cells/10-cm dish) in 100-μL binding buffer and double stained them using a PI Apoptosis Detection kit (BioVison, Mountain View, CA, United States) and Annexin-V-FITC. Subsequently, the resultant red (PI) and green (FITC) fluorescence for the samples was quantitatively analyzed through FACSCaliber flow cytometry (Becton Dickinson, Franklin Lakes, NJ, United States). Finally, data were processed on CellQuest (BD Biosciences, San Jose).
Measurement of ROS level in cells
The cells (density: 4 × 10
5 cells/well) were grown in a 12-well plate. They underwent 5 min–1 h of CoQ
0 (5–15 μM) pre-treatment. Following, DCFH
2− (10 μM) and the culture were combined; they were subjected to incubation for 30 min at 37 °C. Warm PBS was used to wash the cells, and generation of ROS was ascertained from intracellular DCF production that was the result of DCFH
2 oxidation [
32]. A fluorescence microscope (Olympus, Shinjuku, Tokyo) was employed (magnification: 200×) to determine the level of DCF fluorescence.
Xenograft animal model
China Medical University’s Institutional Animal Care and Treatment Committee approved all protocols involving animals and their welfare. Briefly, 5- to 7-week-old athymic nude mice (female; BALB/c-nu), acquired from the National Laboratory Animal Center (Taipei, Taiwan), were confined in a sterile environment with a 12–12 h light–dark cycle. They were fed rodent chow (Oriental Yeast Co., Tokyo) and provided unlimited access to water.
The mice were subcutaneously engrafted in the right-hind flank with 1 × 106 MDA-MB-231 cells. The mice were separated into two groups of five. For this experiment, cells passaged less than 20 times were used. The treatment-group mice were administered C0Q0 (0.75 mg/kg b.w.) Intraperitoneal (IP) injection (three times/week) was performed for 12 weeks; the control group received only the vehicle (PBS). The tumors were measured on a weekly basis, and tumor volume was ascertained as width2 × length × 0.5 (mm). The mice were sacrificed on the 12th week; this was followed by tumor removal and weighing. A veterinary pathologist examined the excised organs, including the liver, lungs, and kidneys.
The animals that underwent CoQ0 (1.5 or 2 mg/kg) and MDA-MB-231-luciferase cell (1 × 106 cells/well) treatment were injected intravenously. Afterward, they were sedated and then IP injected with luciferin. An IVIS 200 system was employed to image them, with the images representing the luminescence (photons/s) emitted from the animal.
Immunohistochemistry analyses
Paraformaldehyde (4%) was used to fix the biopsied tumor tissues. This, in addition to segmentation and staining, were performed to facilitate observation under light microscopy. For Western blotting, the tissue samples were mixed in RIPA buffer that contained phosphatase inhibitor cocktail (1%; Sigma-Aldrich, St. Louis) and protease inhibitor cocktail (1%). SDS-PAGE gel was the site of sample separation. Subsequently, the samples were relocated onto PVDF membranes. Corresponding primary and biotinylated secondary antibodies (Zymed Laboratories, South San Francisco, CA, United States) were added to the PVDF membranes and incubated. Afterward, the membranes underwent avidin-biotin complex reagent incubation. Finally, they were stained using 3,3′-diaminobenzidine in accordance with the manufacturer’s procedures (Histostain-Plus Kit; Zymed, South San Francisco).
Statistical analysis
The experiment was conducted in triplicate; the values were represented as mean ± standard error. Significance was ascertained using Dunnett’s test for pair-wise comparison.
Discussion
EMT is a physiological process that is usually activated during wound healing and embryonic development. It is a crucial step in cancerous metastatic progression [
36]. During EMT, the epithelial-derived tumor cells stimulate intercellular and intracellular changes that contribute to mesenchymal cell phenotypes, including cytoskeleton reorganization, polarity alteration, extracellular matrix remodeling, and migratory ability acquisition [
12]. Numerous researchers have investigated EMT’s role in breast cancer. Mesenchymal EMT molecular marker overexpression in biopsies of breast cancer is correlated with increased recurrence, adverse clinicopathological characteristics, reduced survival, and tumor aggressiveness [
37]. Therefore, efficacious therapeutic strategies must be established to reduce breast cancer cell tumor aggressiveness and prevent malignant growth. In our previous study, we reported that CoQ
0 exerts antimetastatic effects in melanoma carcinomas. This action may be because of the modulation of the Wnt/β-catenin signaling pathway in B16F10 melanoma cells [
24]. In the current study, CoQ
0’s antimetastatic and anti-EMT abilities were characterized, and mechanisms responsible for its effects in MDA-MB-231 were studied. Additionally, E-cadherin downregulation and alterations of the EMT-linked signaling regulator indicate that MDA-MB-231 cells can commence and propagate the EMT process in cancer cells. The salubrious impact of pre-treatment with CoQ
0 was proven by the renewal of E-cadherin protein and transcriptional activity. The renewal of E-cadherin was linked to β-catenin, NFκB, and MMP-9 inhibition, a key molecular event in EMT inhibition. Increased cancer cell migration and invasion, mammosphere formation, colony formation ability, and tumor growth were effectively suppressed through CoQ
0 treatment. These findings indicate that CoQ
0 is an antimetastatic and anti-EMT substance, and the potential molecular signaling pathways that are involved in this process can be inferred.
E-cadherin is an adherens junction protein expressed in normal breast tissue; it is a useful phenotypic marker in cases of breast cancer [
38]. In this study, the transcriptional activity and protein levels of E-cadherin were investigated to ascertain the manifestation of EMT with TNF-α/TGF-β-stimulation in TNBC cells. The results of immunofluorescence and luciferase activity and Western blotting revealed that TNF-α/TGF-β could undermine E-cadherin junctions by governing the organization of actin in MDA-MB-231 cells. These results were supported by evidence from previous studies [
33]. E-cadherin loss stimulates EMT, which plays a major role in the development of carcinomas to a metastatic state. Although the mechanism that is involved in E-cadherin inactivation in cancer cells remains vague, alterations of transcriptional levels may explain its downregulation [
39]. Therefore, an effective strategy for controlling metastasis and EMT progression may be restoring or preventing E-cadherin downregulation by using TNF-α/TGF-β. In this work, the restoration of E-cadherin protein levels and transcriptional activity through CoQ
0 treatment inhibited EMT and the associated carcinoma metastasis. Restoration of E-cadherin expression at the transcription and protein level by Withaferin A was linked to metastasis and cell proliferation inhibition in breast cancer cells [
33]. Furthermore, our in vivo study proved that CoQ
0 significantly increased the expression of E-cadherin in MDA-MB-231 tumors and prevented MDA-MB-231 cell lung metastasis, implying that CoQ
0 arrests EMT programming because of its antimetastatic properties in breast cancer cells.
EMT is a crucial mechanism in cancer development and in the first phase of metastasis. Retardation of E-cadherin/β-catenin may facilitate tumor invasion and metastasis [
40]. Increasingly, evidence indicates that E-cadherin has a vital function in β-catenin function and stabilization. When E-cadherin expression decreased, β-catenin was able to be separated from the E-cadherin/β-catenin complexes and could translocate to the nucleus freely. Moreover, β-catenin bound with the TCF/LEF-1 element after which it activated certain promigratory genes required for EMT combined with related transcription factors [
41]. Some transcription factors, including Slug and Snail, which are both among the transcriptional targets of β-catenin, may be associated with E-cadherin and EMT repression [
42]. In this work, CoQ
0 induced E-cadherin and significantly decreased nuclear β-catenin, Snail, and Slug protein association, as shown by Western blot analysis. Furthermore, immunoprecipitation assays revealed that CoQ
0 increased E-cadherin and β-catenin expression relative to that of the untreated group. This result indicates that CoQ
0 may restore the formation of E-cadherin/β-catenin complexes in MDA-MB-231 cells, impeding nuclear transport of β-catenin to a greater extent, which subsequently enhances the expression of E-cadherin by inhibiting Slug. Our results are a strong indication notion that the anti-EMT impact of CoQ
0 is correlated with the governance of the formation of E-cadherin/β-catenin complexes.
Matrix metalloproteases (MMPs) have a key function in extracellular matrix (ECM) remodeling and degradation [
43]. MMPs play roles in all stages of breast carcinogenesis, from tumor initiation to metastasis. Among the several MMP family members, MMP-2 and MMP-9 were highly expressed in invasive breast cancer cells [
44]. The present study determined that CoQ
0 pre-treatment abrogated the TNF-α/TGF-β-induced MMP-9 and MMP-2 expression levels in MDA-MB-231 cells. Therefore, MMP-9 and MMP-2 could be CoQ
0-responsive mediators whose ECM degradation could result in ensuing cancer invasion and migration.
The MMP-9 promoter region possesses cis-regulatory elements, such as two AP-1 and one NFκB binding sites. These sites are not present in MMP-2’s promoter region [
45]. Therefore; we investigated the effects of CoQ
0 on NFκB, which plays a major role in the transcription of MMP-9. NFκB activation results in cell invasion, metastasis, and survival advantages and drug resistance to several cancer types [
46]. Nuclear translocation and transcriptional activation of NFκB subunits are strictly governed by NFκB’s inhibitory protein, I-κBα, whose phosphorylation releases NFκB subunits [
47]. The data from our experiments clearly demonstrate that treatment with CoQ
0 suppressed the transcriptional activation and nuclear translocation of NFκB. This effect may have been caused by the inhibition of I-κB kinase phosphorylation and I-κBα degradation. Furthermore, pre-treatment with celastrol remarkably reduced the expression of MMP-9 and NFκB proteins. This result indicates that the NFκB pathway is the principal regulatory pathway in the suppression of MMP-9 expression by treatment with CoQ
0.
PI3K/AKT is the major pathway for tumor invasion [
48]. Therefore, we sought to determine whether CoQ
0 suppresses the phosphorylation of PI3K/AKT because its signaling cascade is the main component upstream of NFκB and plays a key role in cellular adhesion, differentiation, and growth. The PI3K/AKT axis plays a principal role in metastasis and tumor invasion through activation of NFκB-mediated MMP-9 [
49]. Our findings clearly demonstrate that CoQ
0 treatment suppressed PI3K/AKT phosphorylation substantially. Furthermore, NFκB activation and MMP-9 were significantly reduced by blockage of the PI3K/AKT pathway with LY249002 treatment. These findings reveal that CoQ
0 lowers the expression of MMP-9 by blocking NFκB activation through PI3K/AKT and thus suppresses MMP-9-mediated cell intrusion in MDA-MB-231 human breast cancer cells. Our findings are consistent with those of a report that suggested that LFG-500 extracted from flavonoid inhibits cancer cell intrusion by suppressing the PI3K/AKT/NFκB/MMP-9 signaling pathways [
49].
The present paper documents the anti-EMT and antimetastatic capabilities of CoQ
0 and lists the mechanisms that may cause its effects in non-tumorigenic MCF-10A cells under stimulation induced by TNF-α/TGF-β. TGF-β enhances tumor development by activating EMT. TGF-β-induced EMT exhibited the following attributes: the loss of junctional E-cadherin localization, acquisition of fibroblastic morphology, and increased cellular motility [
50]. TNF-α is a proinflammatory cytokine and plays a vital role in tumor malignancy, including motility, tumor cell invasion, and metastasis [
51]. TNF-α induced EMT in renal cell carcinoma by suppressing E-cadherin expression and promoting Vimentin and MMP-9 protein expression [
52]. Stimulation of TGF-β, TNF-α, or both may cause an EMT-like phenomenon, E-cadherin expression reduction, and morphological changes in Madin–Darby canine kidney cells [
53]. In the present study, downregulation of E-cadherin, upregulation of β-catenin, and changes in EMT-linked signaling regulators initiated and propagated EMT in MCF-10A cells stimulated using TNF-α/TGF-β. The advantageous impact of pre-treatment with CoQ
0 was based on the renewal of transcriptional and E-cadherin promoter activity against losses induced by TNF-α/TGF-β. Additionally, the renewed E-cadherin promoter activity was linked to β-catenin, NFκB, and MMP-2/− 9 inhibition, which is a vital molecular event in the inhibition of EMT induced by TNF-α/TGF-β.
Human mammary epithelial cells forms numerous non-adherent spherical colonies know as, “non-adherent mammospheres”. [
54]. They comprise of several stem cells that regenerate to form mammospheres within serial passages and progenitor cells that perform multi origin differentiation. Accumulating evidence suggests that many cancers, including breast cancer, are guided by a cellular subpopulation, designated as cancer stem cells (CSCs), that mediates tumor metastasis and resistance to conventional therapies. Thus, preventing CSC growth in breast cancer is the optimal strategy for inhibiting tumor development and metastasis [
55]. Therefore, research on CoQ
0-induced molecular mechanisms that mediate CSC proliferation is vital to clarify CoQ
0’s antimetastatic and anticancer activities. Our study revealed that CoQ
0 treatment considerably lowered mammosphere formation and sphere size. These results suggest that CoQ
0 inhibits mammosphere formation.
Apoptosis induction, restriction of cell proliferation by chemical or biological agents, and cell-cycle arrest are intended to be effective strategies in cancer management, particularly of TNBCs. Apoptosis-inducing agents are under investigation as alternative tools for cancer treatment management. A study reported that CoQ
0 treatment caused the proportion of late apoptotic MDA-MB-231 cells to rise when Annexin V/PI staining and then flow cytometry were employed [
56]. In the present study, the treatment of MDA-MB-231 cells with CoQ
0, successfully inhibited anchorage-independent growth and cell proliferation. Examples of the characteristic features of apoptosis are chromatin condensation, internucleosomal DNA cleavage, caspase activation, and cellular morphological changes [
57]. In the current study, we demonstrated that, by treating MDA-MB-231 cells with CoQ
0, apoptotic cell death linked to DNA fragmentation increased considerably. In a study, treating human lung cancer cells with CoQ
0 increased the number of early and late apoptotic cells and reduced apoptotic cell death through antioxidant treatment [
19]. Other studies have demonstrated that methoxy-containing analogs of CoQ
0 and quinones that have similar structures to CoQ
0 have a cytotoxic influence on human cancer cells because they induce apoptosis [
58]. Researchers employed various CoQ analogs and recorded enhanced DNA fragmentation, caspase-3 activation, and apoptosis for CoQ
4 and CoQ
2 in HL 60 human leukemia cells. However, these effects were not observed for CoQ
10 or CoQ
6. These results suggest that CoQ
0 analogs pro-apoptotic and anticancer attributes vary depending on the location of the methoxy-substitutions on the quinone nucleus and the length of the isoprenyl side chain. No matter the cell line, CoQ
0, which possesses no isoprenoid units, suppresses cancer cell growth and triggers early and late apoptosis.
The excessive generation of ROS can induce cell-cycle arrest, oxidative stress, damaged DNA in cancer cells, cell function loss, and cellular apoptosis [
59]. CoQ
0’s favorable impact on breast cancer cell lines is linked to mitochondrial dysfunction and the overproduction of intracellular ROS. ROS causes the mitochondrial permeability transition pore to open, mitochondrial proapoptotic factors to be released, and the mitochondrial membrane to depolarize during mitochondria-mediated apoptosis [
60]. The present study determined that CoQ
0 treatment leads to a notable increased in intracellular ROS production in MDA-MB-231 cells. By contrast, the antioxidant, NAC, inhibited ROS production, which reduced apoptosis significantly, indicated that MDA-MB-231-cell apoptosis induced by CoQ
0 had a close link with ROS production. CoQ
0 potentially play roles as upstream signaling molecules to induce cell apoptosis mediated by mitochondria. Our findings are agreement with those of prior investigations indicating that natural compounds (e.g., celastrol and deltonin) induce MDA-MB-231 cell ROS-mediated mitochondrial apoptosis [
61].
Disruption of the cancer cell cycle is a therapeutic objective of research on novel cancer drugs. This is linked to lower Cyclin A, Cyclin B, Cdc2, and Cdc25C expression and higher CDK inhibitor p21 expression. In eukaryotes, cell-cycle progression included the resultant triggering of CDKs; their activation is cyclin associated. Among CDKs, Cdc2 and CDK2 kinases are mainly triggered with Cyclin B and Cyclin A during G2/M phase progression [
62]. Cdc2/Cyclin A and Bi kinase complex activity was suppressed by phosphorylating Tyr15 of Cdc2. Cdc25C phosphatase catalyzed the dephosphorylation of Tyr15 of Cdc2. This reaction was considered the rate-limiting step in their progression into mitosis [
63]. P21 might facilitate G2/M cell-cycle arrest maintenance through CyclinB1/Cdc2 complex inactivation, thereby disrupting the cell nuclear antigen–Cdc25C interaction [
64]. The findings suggest that Cdc25C, Cdc2, Cyclin A, and Cyclin B expression is downregulated, and the CDK inhibitor p21 increased in MDA-MB-231 cells treated with CoQ
0, which arrests G2/M phase. The present study’s data suggest that the monitored suppression of MDA-MB-231 cell proliferation linked to CoQ
0 treatment was because of G2/M-phase cell-cycle arrest and not G1 arrest. Intriguingly, our results differ from those of the previous report that indicated that treatment of MDA-MB-231 cells with CoQ
0 led to G0/G1-phase cell-cycle arrest.
To enhance CoQ
0’s antimetastatic and anticancer attributes, an in vivo investigation of CoQ
0-treated MDA-MB-231-xenografted nude mice was executed. CoQ
0-treated xenografted nude mice resulted in a significant fall in tumor volume and significantly prevented lung metastasis. The observed anticancer action is seemingly related to mitotic cell inhibition and substantial proliferation of apoptotic cells in tumors treated with CoQ
0. Fewer mitotic-positive cells in the HL60 xenografted nude mouse tumors treated with CoQ0 indicated reduction in cell proliferation. This reduced cell proliferation may cause a lower tumor volume in nude mice [
65]. Furthermore, antimetastatic activity may be linked to the upregulation of E-cadherin and the downregulation of MMP-2, MMP-9, p-AKT, p65, and β-catenin proteins. These in vivo results verify CoQ
0’s effective antimetastatic and antitumor attributes against TNBC that are in agreement with its in vitro anticancer attributes.