Background
Colorectal cancer (CRC) is a commen cancer that threatens people’s health and is highly linked to cancer-associated mortality [
1,
2]. The treatment options for CRC include surgery, chemotherapy, radiotherapy and adjuvant therapy [
3]. However, tumor metastasis is the main reason for the death in CRC patients and the prognosis of patients with metastasis CRC is dismal [
4]. Molecular markers can be used as therapeutic targets for CRC [
5]. Consequently, it is imperative to explore the mechanism of CRC progress and identify novel targets.
The non-coding circular RNAs (circRNAs) are commonly expressed in various tumor cell types and modulate tumor progression [
6,
7]. More importantly, circRNAs have been recognized as microRNA (miRNA) sponges to alter gene expression to modulate the carcinogenesis of human cancers [
8]. For example, circRAE1 exacerbated the motility of CRC via elevating TYRO3 through sponging miR-338-3p [
9]. Circ_0038646 facilitated the growth and migration of CRC cells through modulating miR-331-3p/GRIK3 axis [
10]. These reports indicated the oncogenic role of circRNAs in CRC. Circ_0084615 derived from aspartate beta-hydroxylase (ASPH) and was found to be upregulated in CRC via GEO databases. However, the precise functions of circ_0084615 in CRC are barely known.
MiRNAs are a flock of non-coding RNAs harboring 18–22 nucleotides and are implicated in tumor progression [
11]. Among these, miR-599 was demonstrated to serve as a suppressor in diverse human cancers, such as bladder urothelial carcinoma [
12], anaplastic thyroid carcinoma [
13], gastric cancer [
14] and glioma [
15]. Furthermore, miR-599 participated in CRC cell progression via lncRNA MCM3AP-AS1/miR-599/ARPP19 axis [
16]. However, the mechanisms mediated by miR-599 in PC remain largely unknown.
One cut homeobox 2 (ONECUT2, also named OC2) is related to the proliferation, motility and differentiation of tumor cells [
17]. In CRC, ONECUT2 influenced the growth, invasion and epithelial-mesenchymal transition (EMT) via acting as the target of miR-429 [
18]. Based on bioinformatics analysis, miR-599 was found to contain the binding sites of circ_0084615 and ONECUT2. However, the relationships among circ_0084615, miR-599 and ONECUT2 are not clear.
In the present research, the expression profiles of circ_0084615, miR-599 and ONECUT2 in CRC were determined and their relationships in CRC development were revealed.
Materials and methods
Tissue specimens acquisition
CRC and nearby non-tumor tissues were acquired from CRC patients (
n = 54) at The Sixth Affiliated Hospital of Sun Yat-sen University after the work was authorized by the Ethics Committee of The Sixth Affiliated Hospital of Sun Yat-sen University and written informed consents were provided by the patients. The tissues were preserved at -80 °C until use. The correlation of circ_0083615 expression with the clinicopathologic features in CRC patients were exhibited in Table
1.
Table 1
Correlation of the expression of circ_0083615 with clinicopathologic features in CRC patients
Age,years |
<60 | 25 | 11 | 14 | 0.413 |
≥60 | 29 | 16 | 13 | |
Gender |
Male | 32 | 18 | 14 | 0.268 |
Female | 22 | 9 | 13 | |
Tumor size |
<3 | 35 | 16 | 19 | 0.393 |
≥3 | 19 | 11 | 8 | |
Lymph node metastasis |
No | 33 | 11 | 22 | 0.002*** |
Yes | 21 | 16 | 5 | |
Differentiation |
Well/Moderate | 34 | 11 | 23 | <0.001*** |
Poor | 22 | 18 | 4 | |
TNM stage |
I + II | 29 | 10 | 19 | 0.014* |
III | 25 | 17 | 8 | |
Chemotherapy |
sensitive | 25 | 11 | 14 | 0.413 |
resistant | 29 | 16 | 13 | |
Cell culture
The American Type Culture Collection (ATCC, Manassas, VA, USA) offered FHC, SW620, DLD1, SW480 and HT-29 cells. RPMI1640 (Invitrogen, Carlsbad, CA, USA) mixed with 10 % fetal bovine serum (FBS; Invitrogen) and 1 % penicillin-streptomycin (Invitrogen) was utilized to culture the cells at a cultivation environment of 5 % CO2 and 37 °C.
Quantitative real-time polymerase chain reaction (qRT-PCR)
The RNA was extracted utilizing TRIzol (Invitrogen) and then reversely transcribed into cDNA via the usage of High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA, USA) or TaqMan miRNA assays (Applied Biosystems) and either random hexamer primers or oligo (dT)18 primers. qRT-PCR was then conducted using SYBR Green qPCR Mix (Invitrogen) and related primers (GenePharma, Shanghai, China). The primer sequences were exhibited in Table
2. The relative expression was normalized to GAPDH or U6 and computed via 2
−ΔΔCt method.
Table 2
Primers sequences used for qRT-PCR
hsa_circ_0084615 | Forward | ACTTATCAGAGGTGCTTCAAGG |
Reverse | TGTGTCCTCCATGCTTTGTCT |
hsa_circ_0040809 | Forward | TGCAACAAAGTGCGATGGTG |
Reverse | CAGGTCGTGTTCCGACATCA |
hsa_circ_0000467 | Forward | GAGGAATAATAAAAGTACACGAGCA |
Reverse | GCAACAGGAGGATCAGACAGA |
hsa_circ_0000512 | Forward | AGCTTGGAACAGACTCACGG |
Reverse | ATCTCCTGCCCAGTCTGACC |
ASPH | Forward | GGAACAAGCAGTATATGAACCTCT |
Reverse | ATGGTTAGGCTGGTCCTCCT |
miR-599 | Forward | GCCGAGGTTGTGTCAGTTT |
Reverse | CTCAACTGGTGTCGTGGAGT |
ONECUT2 | Forward | CCGAACACTCTTCGCCATCT |
Reverse | GCTCAGATCGTCTTGCCACT |
GAPDH | Forward | GACAGTCAGCCGCATCTTCT |
Reverse | GCGCCCAATACGACCAAATC |
U6 | Forward | CTCGCTTCGGCAGCACA |
Reverse | AACGCTTCACGAATTTGCGT |
Actinomycin D (Act D), RNase R and subcellular fraction analysis
For Act D assay, SW620 and DLD-1 cells were exposed to Act D (Sigma-Aldrich, St. Louis, MO, USA) for indicated time points.
RNase R treatment was executed on total RNA using RNase R (Epicenter, Madison, WI, USA) for 20 min.
The cytoplasm and nucleus in SW620 and DLD-1 cells were separated with the PARIS Kit (Life Technologies, Austin,Texas, USA) following the manufacturers’ guidelines.
After the above treatments, the abundance of circ_0084615 or ASPH was determined via qRT-PCR.
Cell transfection
Short hairpin RNA (shRNA) against circ_0084615 (sh-circ_0084615), shRNA against EIF4A3 (sh-EIF4A3) and their scramble control (sh-NC), miR-599 mimics (miR-599) and negative control (miR-NC), miR-599 inhibitors (anti-miR-599) and its control (anti-NC), ONECUT2 overexpression vector (ONECUT2) and control vector (vector), EIF4A3 overexpression vector (oe-EIF4A3) and empty control (pcDNA) were all bought from GenePharma and transfected into SW620 and DLD-1 cells via Lipofectamine 2000 (Invitrogen) referring to the protocols.
5-ethynyl-2’- deoxyuridine (EdU) experiment
The EdU kit (RIBOBIO, Guangzhou, China) was employed to test cell proliferation. In short, SW620 and DLD-1 cells were plated into 24-well plates and then mixed with EdU reagent. Next, cells were fixed with paraformaldehyde (Sigma-Aldrich) and mixed with 0.5 % Triton-X-100 (Sigma-Aldrich). Nuclei were dyed with EdU and DAPI (Sigma-Aldrich). The images were captured with a fluorescence microscope (Olympus, Tokyo, Japan). EdU-positive cells were counted.
The transfected SW620 and DLD-1 cells were kept in 6-well plates for approximately 14 days. Thereafter, the clones were stained with crystal violet (Sigma-Aldrich) and then imaged and counted.
Wound healing assay
The transfected SW620 and DLD-1 cells were plated in 12-well plates and then a pipette tip was used to make a wound. The wound closure was measured at 0 and 24 h for the assessment of cell migration.
Transwell assay
The chambers (Corning, Corning, NY, USA) covered with Matrigel (Corning) were utilized for cell invasion assay. Briefly, the transfected SW620 and DLD-1 cells suspended in non-serum medium were added into the upper chamber and the complete culture medium mixed with 10 % FBS (Invitrogen) was placed into the lower chamber. After incubation for 24 h, the invaded cells were stained with crystal violet (Sigma-Aldrich) for photographing and counting.
To examine the angiogenesis ability, HUVECs (ATCC) were maintained in the 96-well plates which were covered with Matrigel (Corning). Then, the suspended SW620 and DLD-1 cells were supplemented into the wells and cultured for 8 h. After that, the tube numbers were counted under a fluorescence microscope (Olympus).
Western blot analysis
The tissues and cells were subjected to RIPA (Beyotime, Shanghai, China) for total protein extraction. The proteins were then separated using SDS-PAGE (Beyotime) and blotted onto PVDF membranes (Beyotime). The membranes were then blocked with 5 % slim milk, incubated with primary antibodies, followed by interaction with a secondary antibody (bs-0295 M-HRP; Bioss, Beijing, China). The proteins were detected with an ECL kit (Beyotime). The primary antibody included anti-ONECUT2 (bs-19643R; Bioss), anti-Zinc Finger E-Box Binding Homeobox 2 (anti-ZEB2; bs-20484R; Bioss), anti-E-cadherin (bs-1519R; Bioss), anti-Vimentin (bs-0756R; Bioss), anti-vascular endothelial growth factor A (VEGFA) (bs-20393R; Bioss) and β-actin (bs-0061R; Bioss).
RNA immunoprecipitation (RIP) assay
RIP experiment was conducted with EZ-Magna RIP kit (Millipore, Billerica, MA, USA). To analyze the relationships of circ_0084615, miR-599 and ONECUT2, SW620 and DLD-1 cells were lysed in RIP buffer and incubated with magnetic beads conjugated with anti-Ago2 (bs-12450R; Bioss) or anti-IgG (bs-0297P; Bioss). Then, the RNAs were extracted from immunoprecipitated complexes and the enrichment of circ_0084615, miR-599 and ONECUT2 were detected.
To analyze to the interaction between EIF4A3 and ASPH, the lysed cells were kept with magnetic beads conjugated with anti-EIF4A3 (bs-14548R; Bioss) or anti-IgG (bs-0297P; Bioss). Next, the coprecipitated RNAs were extracted and subjected to qRT-PCR.
RNA pull-down assay
The wild-type or mutant biotin-labeled probe miR-599 (bio-miR-599-wt or bio-miR-599-mut) or related control (bio-NC) was cultivated with streptavidin-coated magnetic beads (Invitrogen) for the generation of probe-coated beads. Then SW620 and DLD-1 cells were sonicated and kept overnight with the beads. After that, the beads-bound RNA complexes were eluted and RNAs were extracted. The enrichment of circ_0084615 and ONECUT2 was examined.
Dual-luciferase reporter assay
To construct luciferase reporter vectors circ_0084615-wt or ONECUT2 3’UTR-wt, the sequences of circ_0084615 or ONECUT2 3’UTR including miR-599 binding sites (GACACAA) were introduced into pmiR-REPORT™ vectors (Promega, Madison, WI, USA). Circ_0084615-wt or ONECUT2 3’UTR-wt was constructed by mutating the binding sites. Then the vectors were transfected into SW620 and DLD-1 cells in combination with miR-599 or miR-NC, followed by measurement of the luciferase intensity.
Immunohistochemistry (IHC) assay
IHC assay was performed as previously reported [
24]. The antibodies against ONECUT2 (bs-19643R), ZEB2 (bs-20484R), E-cadherin (bs-1519R), Vimentin (bs-0756R) and VEGFA (bs-20393R) were bought from Bioss.
Murine xenograft model
Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China) offered the male BALB/c nude mice. The mice were divided into 2 groups (n = 6/group) and then sh-NC or sh-circ_0084615 transfected SW620 cells were introduced into the mice. The tumor volume (1/2 (length × width2)) was monitored every 5 days. The mice were euthanized after 30 days and xenograft tumors were harvested for weight and IHC assay. The animal experiments were approved by the Ethics Committee of Animal Research of The Sixth Affiliated Hospital of Sun Yat-sen University.
Statistical analysis
All experiments were executed 3 times and the data were analyzed through GraphPad Prism 7 (GraphPad, La Jolla, CA, USA). The results were exhibited as mean ± SD. The overall survival curve was analyzed through Kaplan-Meier plot and log-rank test. Difference analysis was done via Student’s t-test or one-way analysis of variance. P value less than 0.05 indicated significant.
Discussion
Accumulating evidence has revealed that the dysregulation of circRNAs are linked to CRC progression and may be used as the potential diagnostic biomarkers [
21]. The current study unveiled the functions of circ_0084615 in CRC for the first time. Moreover, the novel regulatory pathway circ_0084615/miR-599/ONECUT2 in CRC development was discovered.
In CRC, diverse circRNAs, such as circIFT80 [
22], circ_0053277 [
23], circ-ITGA7 [
24], circ_001917 [
25], have been reported to mediate CRC development via altering tumor cell growth, migration, EMT and angiogenesis. Even though, the effects of circ_0084615 on CRC are unclear. The CRC-related GEO databases showed the abnormal upregulation of circ_0084615 in CRC, thus, we further explored the exact roles of circ_0084615 in CRC progression. As a result, circ_0084615 was found to be overexpressed in CRC and was linked to TNM stages, lymph node metastasis, poor differentiation and dismal overall survival in CRC patients. These results suggested that the potential of circ_0084615 in acting as diagnostic and prognostic markers for CRC. Functionally, circ_0084615 interference restrained the proliferation, migration, invasion and angiogenesis in CRC cells
in vitro and blocked tumor formation
in vivo. Our results also showed that EMT-related markers ZEB2 and Vimentin were reduced and E-cadherin was elevated in CRC cells with circ_0084615 silencing. VEGFA is defined as a key mediator in angiogenesis and invasion of tumors [
26]. Thus, we determined the influence of circ_0084615 on VEGFA expression and found that circ_0084615 knockdown reduced VEGFA level in CRC cells.
Thereafter, we elucidated the potential mechanism of circ_0084615 in CRC. We demonstrated that circ_0084615 served as the sponge for miR-599, which directly bound to ONECUT2. Yu et al. unveiled that miR-599 overexpression repressed CRC cell viability and migration via targeting ARPP19 [
16]. Herein, miR-599 was reduced in CRC and repressed CRC cell growth, metastasis and angiogenesis, which was consistent with the former report. MiR-599 inhibition abrogated circ_0084615 knockdown-mediated effects on CRC cell malignant behaviors, suggesting that circ_0084615 regulated CRC cell development via targeting miR-599. Sun et al. claimed that ONECUT2 could be targeted by miR-429 to alter CRC cell proliferation and invasion [
18]. However, ONECUT2 was demonstrated to be the target gene of miR-599 for the first time. ONECUT2 overexpression abated the effects of miR-599 on CRC cell malignant behaviors.
It has been reported that EIF4A3 is a modulator in RNA splicing [
27]. Moreover, EIF4A3 can bind to MMP9 [
20], BNIP3 [
28]or ASAP1 [
29] to induce circMMP9, circ-BNIP3 or circASAP1 expression. Herein, it was found that EIF4A3 induced circ_0084615 expression by binding to ASPH transcript.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.