Skip to main content
Erschienen in: Antimicrobial Resistance & Infection Control 1/2019

Open Access 01.12.2019 | Research

Molecular characterization of class 1, 2 and 3 integrons in clinical multi-drug resistant Klebsiella pneumoniae isolates

verfasst von: Farzaneh Firoozeh, Zeinab Mahluji, Ahmad Khorshidi, Mohammad Zibaei

Erschienen in: Antimicrobial Resistance & Infection Control | Ausgabe 1/2019

Abstract

Background

The aim of this study was to characterize class 1,2 and 3 integrons in clinical MDR Klebsiella pneumoniae isolates in Kashan, Iran.

Methods

One hundred-eighty one Klebsiella pneumoniae were recovered from clinical specimens during November 2013 to October 2014. Antimicrobial susceptibility patterns were determined by disk diffusion method according to the Clinical and Laboratory Standards Institute (CLSI) guidelines for detection of MDR strains. Of the 181 Klebsiella pneumoniae, 146 (80.7%) of isolates were isolated from nosocomial infected patients and 150 (82.9%) identified as MDR isolates. The PCR amplification was used to show presence of class 1, 2 and 3 integrons among MDR strains. The PCR method and sequencing were used for evaluation of cassette content of integrons.

Results

Of the MDR K. pneumoniae isolates, 150 (100%) and 55 (36.7%) carried intI1 and intI2 genes, respectively. None of the MDR Klebsiella pneumoniae isolates carried class 3 integrons. Amplification of conserved segment (CS) of class 1 and class 2 integrons revealed 10 different arrays including: No. cassette; dfrA5, dfrA30; aadA2; aadA2, dfrA12; dfrA17, aadA5, aadA4; dfrA5, dfrA30, aadA2; dfrA5, dfrA30, aadA2, dfrA12, dfrA5, dfrA30, dfrA17, aadA5, aadA4; aadA2, aadA2, dfrA12; dfrA5, dfrA30, aadA2, aadA2, dfrA12 and 4 arrays including: No. cassette; aadA1; dfrA1-sat1; aadA1, dfrA1-sat1, respectively.

Conclusions

The finding of present study revealed a high prevalence of integrons especially class 1 among MDR K. pneumoniae isolates from nosocomial infections in Kashan, which led to rapid extension of MDR strains.

Background

Klebsiella pneumoniae (K. pneumoniae) is one of the most important causes of infection especially among hospitalized patients [1]. Multi-drug resistant (MDR) K. pneumoniae isolates are becoming increasingly prevalent in the clinical and nosocomial environments and is raised as a major threat in treatment of nosocomial infections [2]. Different mechanisms and factors involved in the development and spread of antibiotic resistance in bacterial strains. Among them acquisition of resistance genes especially via mobile genetic elements is considered as the main factor in the wide distribution of antimicrobial resistance [3]. Integrons which are one of the kind mobile genetic elements presumed to be involved in the dissemination of these MDR strains [4]. Integrons are considered powerful mobile genetic elements that are located on plasmids, transposons and pathogenicity islands which facilitate their transferring among different bacteria. According to reports available, integrons have a wide distribution among clinically isolated bacteria; also, their mobility has become a major problem in antibiotic resistance in clinical specimens [5]. Till now, five classes of integrons have been described based on the nucleotide sequence of the integrase gene [6].
Class 1 integrons are the most prevalent and have been frequently reported in clinical isolates of gram negative bacteria including K. pneumoniae [7]. The structure of class 1 integrons is consisted of two conserved regions, including 3′ conserved segment (3′ CS) and 5′ conserved segment (5′ CS), as well as internal gene cassettes that encode antimicrobial resistance genes [7]. Class 2 integrons found sometimes and class 3 integrons are rarely documented in K. pneumoniae [3]. Up to now, more than 130 different cassettes which confer resistance against a wide range of antibiotics including all ß- lactams, all aminoglycosides, quinolones, fluoroquinolones, macrolides, and many other antibiotics classes have been detected [5]. Integrons carrying diverse cassette arrays have been identified in different studies in Europe and Asia [5]. Class 1 integrons carries variety of resistance gene cassettes, and most of them contain aadA gene which confer resistance to streptomycin- spectinomycin. The wide spread distribution of class 1 integrons harbouring different alleles of the aadA gene has been documented [5]. Also, the dfrA cassette arrays, encoding resistance to trimethoprim, are frequently detected in both class 1, and 2 integrons [8]. Although several studies have documented the prevalence of integrons in MDR K. pneumoniae isolated from clinical specimens in Iran [9, 10], there is little information regarding the association between class 2 and 3 integrons and MDR, also cassettes contents of integrons in K. pneumoniae isolates from nosocomial infected patients in our region. Thus, the present study proposed to characterize class 1, 2 and 3 integrons in clinical MDR K. pneumoniae isolates in Kashan, Iran.

Methods

Bacterial isolates

A total of 181 non-duplicate K. pneumoniae isolates from clinical specimens at Shahid Beheshti Hospital in Kashan, Iran, during November 2013 to October 2014 were enrolled in the study. All patients admitted to Shahid Beheshti Hospital in Kashan and diagnosed with infections caused by K. pneumoniae during the study were included. While, patients diagnosed with infections due to other bacteria than K. pneumoniae during the same time, were excluded. Of the 181 K. pneumoniae isolates, 146 (80.7%) were nosocomial and had been occurred after 48 h of hospital admission. The isolates were from both sexes including 78 male and 103 female and were recovered from urine, respiratory tract samples (sputum, bronchoalveolar lavage, tracheal aspirate and nasal discharge), blood, wound, cerebrospinal fluid (CSF) and catheter. Collection of specimens from the lower respiratory tract was done by pulmonologists prior to initiation of antimicrobial therapy. Tracheal aspirate obtained from patients by instillation of 1.5 mL saline (pH 7.0) in to each nostril. After insertion of plastic catheter or tubing contained 2 mL of saline into the nostril, nasopharyngeal secretions were aspirated and collected in sterile containers. Bronchoalveolar lavage (BAL) was obtained using bronchoscope. Also deep cough sputum of other patients with respiratory infections were collected in sterile containers. The collection of CSF was performed by clinicians under aseptic conditions. In addition, in order to obtain urine specimen from patients with urinary tract infection (UTI) and indwelling catheter, sterile syringe was inserted in to catheter at a 45 degree angle, then 20–30 mL of urine was withdrawn and collected in sterile containers.
The isolates were identified as K. pneumoniae, after culturing on MacConkey agar (Merck, Germany) media and incubation at 37 °C for 24 h. Characteristic colonies of K. pneumoniae were confirmed by standard biochemical tests including TSI (Triple Sugar Iron Agar), Indole, Methyl Red (MR), Voges–Proskauer (VP), and Citrate (IMVIC), also urease and motility tests (Merck, Germany). All K. pneumoniae isolates were confirmed as, Indole negative, MR negative, VP positive, Citrate positive, urease positive, and motility negative gram negative coccobacilli [11].

Antibiotic susceptibility testing

K. pneumoniae isolates were tested for susceptibility to antimicrobial agents and identification of MDR strains were done by using disk diffusion method described by the Clinical and Laboratory Standards Institute (CLSI) guidelines [12]. The antibiotics were selected according to CLSI standard and previous studies in this field as follows: ampicillin (30 μg), amoxicillin/clavulanic acid (20/10 μg), aztreonam (30 μg), cephalothin (30 μg), cefotaxime (30 μg), ceftazidime (30 μg), cefoxitin (30 μg), cefteriaxon (30 μg), imipenem (10 μg), gentamicin (10 μg), nalidixic acid (30 μg) and ciprofloxacin (5 μg) (Mast Companies, UK). The E. coli strain ATCC 25922 was used as a control. Results were interpreted according CLSI and the manufacturer protocols (Mast, UK) and each K. pneumoniae isolate which showed resistance to more than three antibiotic classes was identified as MDR [13].

Genomic DNA extraction

DNA of each MDR K. pneumoniae isolates was extracted by boiling method. The overnight cultures of K. pneumoniae strains in LB broth were suspended in 250 μL of sterile deionized water and incubated at 100 °C for 10 min. After centrifugation at 10,000 g for 5 min, the supernatant were used as a template DNA and stored at − 20 °C until use [14].

Detection and characterization of class 1, 2 and 3 integrons

The presence of class 1, 2 and 3 integrons in MDR K. pneumoniae were investigated by amplification of integrase genes including intI1, intI2, and intI3 specific primers (Table 1). The PCR reactions were prepared in a total volume of 25 μL and amplification was performed in a thermaocycler (Eppendorf master cycler®, MA) as follows: 5 min at 94 °C; 35 cycles of 1 min at 94 °C, 1 min at 55 °C,30 s at 72 °C; 10 min at 72 °C for detection of intI1 gene and 5 min at 94 °C; 32 cycles of 1 min at 94 °C, 1 min at 60 °C,2 min at 72 °C; 10 min at 72 °C for detection of intI2, and intI3 genes [1517]. Reaction mixtures without a DNA template used as negative control. The amplified products were electrophoresed on 1.2% agarose gel and after staining with ethidium bromide (0.5 mg/ml) visualized in gel document system (Biorad, UK).
Table 1
Primers used for PCR amplification for detection of class 1, 2 and 3 integrons
Gene
Primer
Sequence (5′-3′)
Amplification Product (bp)
Reference
intI1
IntI1-F
TCTCGGGTAACATCAAGG
254
[11]
IntI-R
AGGAGATCCGAAGACCTC
  
intI2
IntI2-F
CACGGATATGCGACAAAAAGG
788
[12]
IntI2-R
TGTAGCAAACGAGTGACGAAATG
  
intI3
IntI3-F
AGTGGGTGGCGAATGAGTG
600
[13]
IntI3-R
TGTTCTTGTATCGGCAGGTG
  
5′CS
5′CS-F
GGCATCCAAGCAGCAAG
Variable
[14]
3′CS
3′CS-R
AAGCAGACTTGACCTGA
  
attI2
attI2-F
GACGGCATGCACGATTTGTA
Variable
[14]
orfX
orfX-R
GATGCCATCGCAAGTACGAG
  

Detection and characterization of integrons internal variable region genes

All integron–positive MDR K. pneumoniae isolates were tested for the presence of internal cassettes genes by CS-PCR using 3′CS and 5′CS primers (Table 1). The following conditions was used for CS-PCR reaction: initial denaturation at 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 1 min, annealing at 58 °C for 1 min, and extension at 72 °C for 2 min, with final extension at 72 °C for 10 min [18]. After electrophoresis on 1.2% agarose gel and staining, the PCR products were visualized.

DNA sequencing and integrons gene cassettes analysis

The purified PCR products were sequenced by the ABI Capillary System and Sanger’s method (Macrogen Research, Seoul, Korea) using 10 pmol of specific primers. The sequences were analyzed by Chromas Pro version1.7.5 Technelysium as well as online BLAST software (http://​www.​ncbi.​nlm. nih.​gov/​BLAST/). Sequences of CS-PCR products revealed the integrons cassettes contents.

Results

This study was conducted on 181 patients with age ranged between 1 and 97 (mean 50.36 ± 3.80 years). The K. pneumoniae were isolated from clinical specimens including: urine 124 (68.5%), wound 6 (3.3%), blood 5 (2.8%), respiratory tract samples 43 (23.8%) including (6 sputum, 2 bronchoalveolar lavage, 34 tracheal aspirates and 1 nasal discharge), CSF 1 (0.6%) and catheter 2 (1.1%).
The antibiotic susceptibility patterns by disk diffusion are shown in (Fig. 1). The highest resistance was obtained to ampicillin, cephalothin, cefotaxime and cefteriaxon. One hundred- fifty (82.9%) identified as MDR isolates, and showed resistance to more than three antimicrobial families. Class 1 and 2 integrons were detected in 150 (100%) and 55(36.7%) of MDR K. pneumoniae isolates, which showed to carry intI1 and intI2 genes respectively. The intI3 gene was not identified among 150 MDR K. pneumoniae isolates and class 3 integrons were not founded in any MDR K. pneumoniae isolates.
Sequencing analysis for intI-positive strains revealed that the cassette arrays of class 1 integron were including 10 different arrays groups from A-J (Table 2), consist of (708 bp, 1002 bp, 1500 bp and 1610 bp integrons) and identified gene cassettes were as follows: (no cassette; dfrA5, dfrA30; aadA2; aadA2, dfrA12; dfrA17, aadA5, aadA4; dfrA5, dfrA30, aadA2; dfrA5, dfrA30, aadA2, dfrA12; dfrA5, dfrA30, dfrA17, aadA5, aadA4; aadA2, aadA2, dfrA12; dfrA5, dfrA30, aadA2, aadA2, dfrA12) Whereas, 4 different cassette arrays groups from a-d (Table 3) consist of (1000 bp and 1500 bp integrons) were detected among 55 MDR K. pneumoniae isolates which carried class 2 integrons, and identified gene cassettes were as follows: (no cassette; aadA1; dfrA1-sat1; aadA1, dfrA1-sat1).
Table 2
Sources, numbers, sizes, inserted cassettes and groups of cassettes arrays of integrons, among integron class 1-positive K. pneumoniae isolates
Source
Isolate (N) (%)
intI1 (No = 150)
Cs1 (No = 132)
NO. of Integrons Class1
Integron Sizes(s) (bp)
Inserted Cassette(s)
Groups of Cassettes Arrays of Integrons Class 1
Urine
14 (9.3)
+
NO cassette
A
25 (16.6)
+
+
2
708
dfrA5, dfrA30
B
3 (2.0)
+
+
1
1002
aadA2
C
13 (8.7)
+
+
2
1500
aadA2, dfrA12
D
10 (6.7)
+
+
3
1610
dfrA17, aadA5, aadA4
E
7 (4.6)
+
+
3
708,1002
dfrA5, dfrA30, aadA2
F
13 (8.7)
+
+
4
708,1500
dfrA5, dfrA30, aadA2, dfrA12
G
2 (1.3)
+
+
5
708, 1610
dfrA5, dfrA30, dfrA17, aadA5, aadA4
H
4 (2.6)
+
+
3
1002,1500
aadA2, aadA2, dfrA12
I
8 (5.3)
+
+
5
708,1002, 1500
dfrA5, dfrA30, aadA2, aadA2, dfrA12
J
Respiratory
3 (2.0)
+
+
 
NO cassette
A
15 (10)
+
+
2
708
dfrA5, dfrA30
B
1 (0.7)
+
+
1
1002
aadA2
C
10 (6.7)
+
+
2
1500
aadA2, dfrA12
D
6 (4.0)
+
+
3
1610
dfrA17, aadA5, aadA4
E
2 (1.3)
+
+
3
708,1002
dfrA5, dfrA30, aadA2
F
1 (0.7)
+
+
4
708,1500
dfrA5, dfrA30, aadA2, dfrA12
G
1 (0.7)
+
+
3
1002,1500
aadA2, aadA2, dfrA12
I
1 (0.7)
+
+
5
708,1002, 1500
dfrA5, dfrA30, aadA2, aadA2, dfrA12
J
Blood
1 (0.7)
+
+
3
1610
dfrA17, aadA5, aadA4
E
1 (0.7)
+
+
3
708,1002
dfrA5, dfrA30, aadA2
F
Wound
3 (2.0)
+
+
2
708
dfrA5, dfrA30
B
3 (2.0)
+
+
3
1610
dfrA17, aadA5, aadA4
E
CSF
1 (0.7)
+
+
 
NO cassette
A
Catheter
2 (1.3)
+
+
2
1500
aadA2, dfrA12
D
Table 3
Sources, numbers, sizes, inserted cassettes and groups of cassettes arrays of integrons, among integron class 2-positive K. pneumoniae isolates
Source
Isolate N (%)
intI2 (No = 55)
Cs2 (No = 37)
NO. of Integrons Class 2
Integron Sizes(s) (bp)
Inserted Cassette(s)
Groups of Cassettes Arrays of Integrons Class 2
Urine
12 (21.9)
+
NO cassette
a
7 (12.7)
+
+
1
1000
aadA1
b
6 (10.9)
+
+
2
1500
dfrA1-sat1
c
7 (12.7)
+
+
3
1000,1500
aadA1, dfrA1-sat1
d
Respiratory
3 (5.5)
+
NO cassette
a
3 (5.5)
+
+
1
1000
aadA1
b
6 (10.9)
+
+
2
1500
dfrA1-sat1
c
4 (7.3)
+
+
3
1000,1500
aadA1, dfrA1-sat1
d
Blood
1 (1.8)
+
NO cassette
a
1 (1.8)
+
+
3
1000,1500
aadA1, dfrA1-sat1
d
Wound
2 (3.6)
+
NO cassette
a
1 (1.8)
+
+
1
1000
aadA1
b
2 (3.6)
+
+
3
1000,1500
aadA1, dfrA1-sat1
d
The most common cassettes were 708 bp, which were detected in 43 (28.6%) isolates with class 1 integrons (Table 2), whereas among class 2 integrons, the most frequent cassettes were 1000–1500 bp, which were identified among 14 (25.5%) of them (Table 3). Twenty- three (15.3%) of class 1 integron positive K. pneumoniae strains carried more than three gene cassettes simultaneously consisting of array of 708,1500 bp; 708, 1610 bp; 708, 1002, 1500 bp.

Discussion

MDR K. pneumoniae has become an important challenge in treatment of nosocomial infections worldwide [19]. It has been documented that mobile genetic elements, such as integrons, play an important role in the dissemination of MDR- K. pneumoniae isolates [20]. In this study we have characterized the class 1, 2 and 3 integrons in clinical MDR K. pneumoniae isolates in Iran. All MDR K. pneumoniae that we investigated were positive for class 1 integrons. The intense association between the presence of class 1 integrons and occurrence of MDR among gram negative bacteria has been documented [21, 22]. In Li et al. [21] study, the class 1 integron positive isolates in comparison with class 1 integron negative isolates showed resistance to a much higher number of drugs [21]. High frequency of integron positive MDR- K. pneumoniae has been reported from other studies [22, 23]. High Prevalence of integrons among MDR strains, could be due to that integrons confer a selection advantage to strains that live in environments such a hospitals where selective pressures created by overuse of antibiotics. We found that among the integron class 1 positive strains, 10 amplicon were identified. The most prevalent arrays observed among class 1 integrons were 708 bp and gene cassettes identified were dfrA5 and dfrA30 which encode dihydrofolate reductases enzymes. Also other variants of dfrA genes including dfrA12 and dfrA17 were identified in relatively high frequency among our integron class 1 positive K. pneumonia strains. The studies show that the most prevalent integron cassette- associated genes are those encode dihydrofolate reductases and aminoglycoside modifying enzymes [21, 2426]. Salimizand et al. [9] reported dfrA17 variant in Klebsiella species. The cassette arrays of class 1 integron in intI1-positive K. pneumoniae strains in China were included dfrA17, dfrA12, dfrA1, dfrA25, dfrA27, genes [19, 21]. The dfrA17 and dfrA12 have been identified among gram negative bacteria that carried class 1 integrons in USA [27], which shows these variants are common among cassettes of class 1 integrons in the world. In other studies in Iran other variants of dfrA genes including dfrA7, dfrA1 dfrA25, dfrA5 and dfrA12 have been documented among Salmonella serotypes and Enteropathogenic Escherichia coli (EPEC) isolates respectively [24, 2830]. To our knowledge this is the first report of detecting dfrA5, dfrA12 and dfrA30 variants among K. pneumoniae in Iran. Also detection of dfrA5, dfrA12 variants in other species could be due to interspecies gene transfer. The second most prevalent cassette in our study was aadA2 which were identified in 67 intI1-positive K. pneumoniae strains. The frequency of presence of other variants of aadA genes including aadA4 and aadA5 were also relatively high in studied intI1-positive K. pneumoniae strains. Till now, 18 different variants of the aadA genes which encode resistance to streptomycin- spectinomycin have been identified on gene cassettes of class 1 integrons among gram-negative bacteria [26]. The presence of aadA2 is shown in Salmonella serotypes and EPEC with low prevalence in Iran [24, 30]. In studies conducted in Taiwan, aadA genes variants including aadA1, aadA2 and aadA4 have been reported in majority of MDR Acinetobacter baumannii isolates and integrons class 1 carrying aadA2 variant was the most frequently found cassette array in clinical isolates of K. pneumoniae [31, 32]. In a study in Iran aadA5 gene have been identified among integron cassettes of MDR Klebsiella spp. [9]. According to data in the literature this is the first report of aadA2 variant in K. pneumoniae in Iran and presence of this gene in different studies among cassettes arrays of class 1 integrons shows that this gene may be the first cassette to be captured by an integron. Another interesting founding was that relatively high frequency of class 1 integron positive K. pneumoniae strains carried more than three gene cassettes simultaneously. This result in correlation with other studies in different geographical areas shows the high diversity of integrons among K. pneumoniae isolates in our regions [7, 32, 33]. The frequency of class 2 integrons in our MDR K. pneumoniae isolates was 36.7% which is higher than that reported by Ahangarzadeh Rezaee et al. [10] in northwest of Iran. The frequencies of 14, 4.8, and 10.4% have been reported in Acinetobacter baumannii, EPEC and Escherichia coli isolates from humans and animals in Iran and different parts of the world respectively [3437]. In study of cassettes contents of class 2 integrons in MDR K. pneumoniae isolates for the first time in Iran, we found that the most prevalent cassettes arrays observed among class 2 integrons were aadA1 and dfrA1-sat1 which confer resistance to streptomycin and spectinomycin, trimethoprim and streptothricin respectively. In other studied these cassettes arrays are frequently detected among class 2 integrons [18, 38]. In a study conducted by Eftekhari et al. [39], these cassettes were identified in class 2 integrons in Shigella spp. isolated from patients in Iran.
The high frequency of aadA1 and dfrA1-sat1 genes which has been documented in different reports, shows the stability of these gene cassettes among class 2 integrons especially in gram negative bacteria, also the identification of these gene cassettes among other genus of Enterobacteriaceae family is evidence of interspecies transition of class 2 integrons. We found an apparent association between the presence of aad and drf gene cassette arrays and phenotypic resistance to the corresponding antibiotics in our int-positive strains. On the other hand, despite the observation of high phenotypic resistance to many other antibiotics such as ampicillin, no cassette carrying the gene for resistance to these antibiotics was obtained. This could be due to the fact that the resistance genes to these antibiotics are located outside the integrons. Of the all integron class 1 and 2 positive K. pneumoniae strains, 12.0 and 37.2% isolates harboured empty integrons and did not carried any gene cassettes. Empty integrons have been documented by other reports [18, 39] indicate the potential of these isolates to capture resistance gene cassettes and change to strains with multiple resistance determinants especially in hospitals environments due to antibiotic selective pressures.

Conclusion

Over all, the results of in this study revealed a high prevalence of integrons especially class 1 among MDR K. pneumoniae isolates from nosocomial infections in Kashan, which led to rapid extension of MDR strains.

Acknowledgements

The technical assistance of the staff of Microbiology Laboratory, of the Department of Microbiology and Immunology, School of Medicine, Kashan University of Medical Sciences are gratefully acknowledged. The results described in this paper formed part of an MSc student thesis.

Funding

Nil.

Availability of data and materials

The data analyzed during the study will be available from the corresponding authors upon request.
The purpose and procedures of the study were explained to all participants, and a written informed consent was obtained from all of them. The study was approved by the ethical clearance committees of the Kashan University of Medical Sciences.
Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Tsai YK, Fung CP, Lin JC, Chen JH, Chang FY, Chen TL, et al. Klebsiella pneumonia outer membrane porins OmpK35 and OmpK36 play roles in both antimicrobial resistance and virulence. Antimicrob Agents Chemother. 2011;55:1485–93.CrossRef Tsai YK, Fung CP, Lin JC, Chen JH, Chang FY, Chen TL, et al. Klebsiella pneumonia outer membrane porins OmpK35 and OmpK36 play roles in both antimicrobial resistance and virulence. Antimicrob Agents Chemother. 2011;55:1485–93.CrossRef
2.
Zurück zum Zitat Lombardi F, Gaia P, Valaperta R, Cornetta M, Tejada MR, Girolamo LD, et al. Emergence of carbapenem-resistant Klebsiella pneumoniae: progressive spread and four-year period of observation in a cardiac surgery division. Biomed Res Int. 2015;2015:871947.PubMedPubMedCentral Lombardi F, Gaia P, Valaperta R, Cornetta M, Tejada MR, Girolamo LD, et al. Emergence of carbapenem-resistant Klebsiella pneumoniae: progressive spread and four-year period of observation in a cardiac surgery division. Biomed Res Int. 2015;2015:871947.PubMedPubMedCentral
3.
Zurück zum Zitat Odumosu BT, Adeniyi BA, Chandra R. Analysis of integrons and associated gene cassettes in clinical isolates of multidrug resistant Pseudomonas aeruginosa from Southwest Nigeria. Ann Clin Microbiol Antimicrob. 2013;12:29.CrossRef Odumosu BT, Adeniyi BA, Chandra R. Analysis of integrons and associated gene cassettes in clinical isolates of multidrug resistant Pseudomonas aeruginosa from Southwest Nigeria. Ann Clin Microbiol Antimicrob. 2013;12:29.CrossRef
4.
Zurück zum Zitat Essen-Zandbergen A, Smith H, Veldman K, Mevius D. Occurrence and characteristics of class 1, 2 and 3 integrons in Escherichia coli, Salmonella and Campylobacter spp. in the Netherlands. J Antimicrob Chemother. 2007;59:746–50.CrossRef Essen-Zandbergen A, Smith H, Veldman K, Mevius D. Occurrence and characteristics of class 1, 2 and 3 integrons in Escherichia coli, Salmonella and Campylobacter spp. in the Netherlands. J Antimicrob Chemother. 2007;59:746–50.CrossRef
5.
Zurück zum Zitat Deng Y, Bao X, Ji L, Chen L, Liu J, Miao J, et al. Resistance integrons: class 1, 2 and 3 integrons. Ann Clin Microbiol Antimicrob. 2015;14:45.CrossRef Deng Y, Bao X, Ji L, Chen L, Liu J, Miao J, et al. Resistance integrons: class 1, 2 and 3 integrons. Ann Clin Microbiol Antimicrob. 2015;14:45.CrossRef
6.
Zurück zum Zitat Guerin E, Jove T, Tabesse A, Mazel D, Ploy MC. High-level gene cassette transcription prevents integrase expression in class 1 integrons. J Bacteriol. 2011;193:5675–82.CrossRef Guerin E, Jove T, Tabesse A, Mazel D, Ploy MC. High-level gene cassette transcription prevents integrase expression in class 1 integrons. J Bacteriol. 2011;193:5675–82.CrossRef
7.
Zurück zum Zitat Lima AM, de Melo ME, Alves LC, Brayner FA, Lopes AC. Investigation of class 1 integrons in Klebsiella pneumoniae clinical and microbiota isolates belonging to different phylogenetic groups in Recife, State of Pernambuco. Rev Soc Bras Med Trop. 2014;47:165–9.CrossRef Lima AM, de Melo ME, Alves LC, Brayner FA, Lopes AC. Investigation of class 1 integrons in Klebsiella pneumoniae clinical and microbiota isolates belonging to different phylogenetic groups in Recife, State of Pernambuco. Rev Soc Bras Med Trop. 2014;47:165–9.CrossRef
8.
Zurück zum Zitat Kiiru J, Butaye P, Goddeeris BM, Kariuki S. Analysis for prevalence and physical linkages amongst integrons, ISEcp1, ISCR1, Tn21 and Tn7 encountered in Escherichia coli strains from hospitalized and non-hospitalized patients in Kenya during a 19-year period (1992-2011). BMC Microbiol. 2013;13:109.CrossRef Kiiru J, Butaye P, Goddeeris BM, Kariuki S. Analysis for prevalence and physical linkages amongst integrons, ISEcp1, ISCR1, Tn21 and Tn7 encountered in Escherichia coli strains from hospitalized and non-hospitalized patients in Kenya during a 19-year period (1992-2011). BMC Microbiol. 2013;13:109.CrossRef
9.
Zurück zum Zitat Salimizand H, Shahcheraghi F, Kalantar E, Badmasti F, Mousavi SF. Molecular characterization of class 1 integrons and gene cassettes in multidrug resistant (MDR) Klebsiella spp. isolated from hospitalized and outpatients in Iran, 2009. Iran J Microbiol. 2013;5:48–55.PubMedPubMedCentral Salimizand H, Shahcheraghi F, Kalantar E, Badmasti F, Mousavi SF. Molecular characterization of class 1 integrons and gene cassettes in multidrug resistant (MDR) Klebsiella spp. isolated from hospitalized and outpatients in Iran, 2009. Iran J Microbiol. 2013;5:48–55.PubMedPubMedCentral
10.
Zurück zum Zitat Ahangarzadeh-Rezaee M, Langarizadeh N, Aghazadeh M. First report of class 1 and class 2 integrons in multidrug-resistant Klebsiella pneumoniae isolates from Northwest Iran. Jpn J Infect Dis. 2012;65:256–9.CrossRef Ahangarzadeh-Rezaee M, Langarizadeh N, Aghazadeh M. First report of class 1 and class 2 integrons in multidrug-resistant Klebsiella pneumoniae isolates from Northwest Iran. Jpn J Infect Dis. 2012;65:256–9.CrossRef
11.
Zurück zum Zitat Mahon CR, Lehman DC, Manuselis G. Textbook of diagnostic microbiology. USA: Saunders Company; 2011. p. 427–61. Mahon CR, Lehman DC, Manuselis G. Textbook of diagnostic microbiology. USA: Saunders Company; 2011. p. 427–61.
12.
Zurück zum Zitat Clinical and Laboratory Standards Institute: Performance Standards for Antimicrobial Susceptibility Testing. Wayne PA, USA 2013. 23th information supplement, M100-S23. Clinical and Laboratory Standards Institute: Performance Standards for Antimicrobial Susceptibility Testing. Wayne PA, USA 2013. 23th information supplement, M100-S23.
13.
Zurück zum Zitat Amiri A, Firoozeh F, Moniri R, Zibaei M. Prevalence of CTX-M-type and PER extended-spectrum β-lactamases among Klebsiella spp. isolated from clinical specimens in the teaching hospital of Kashan, Iran. Iran Red Crescent Med J. 2016;18:e22260.CrossRef Amiri A, Firoozeh F, Moniri R, Zibaei M. Prevalence of CTX-M-type and PER extended-spectrum β-lactamases among Klebsiella spp. isolated from clinical specimens in the teaching hospital of Kashan, Iran. Iran Red Crescent Med J. 2016;18:e22260.CrossRef
14.
Zurück zum Zitat Afzali H, Firoozeh F, Amiri A, Moniri R, Zibaei M. Characterization of CTX-M-type extend-spectrum β-lactamase producing Klebsiella spp. in Kashan, Iran. Jundishapur J Microbiol. 2015;8:e27967.CrossRef Afzali H, Firoozeh F, Amiri A, Moniri R, Zibaei M. Characterization of CTX-M-type extend-spectrum β-lactamase producing Klebsiella spp. in Kashan, Iran. Jundishapur J Microbiol. 2015;8:e27967.CrossRef
15.
Zurück zum Zitat Leverstein-van Hall MA, Blok HEM, Donders ART, Paauw A, Fluit AC, Verhoef J. Multidrug resistance among Enterobacteriaceae is strongly associated with the presence of integrons and is independent of species or isolate origin. J Infect Dis. 2003;187:251–9.CrossRef Leverstein-van Hall MA, Blok HEM, Donders ART, Paauw A, Fluit AC, Verhoef J. Multidrug resistance among Enterobacteriaceae is strongly associated with the presence of integrons and is independent of species or isolate origin. J Infect Dis. 2003;187:251–9.CrossRef
16.
Zurück zum Zitat Machado E, Ferreira J, Novais A, Peixe L, Canton R, Baquero F, et al. Preservation of integron types among Enterobacteriaceae producing extended-spectrum β-lactamases in a Spanish hospital over a 15-year period (1988 to2003). Antimicrob Agents Chemother. 2007;51:2201–4.CrossRef Machado E, Ferreira J, Novais A, Peixe L, Canton R, Baquero F, et al. Preservation of integron types among Enterobacteriaceae producing extended-spectrum β-lactamases in a Spanish hospital over a 15-year period (1988 to2003). Antimicrob Agents Chemother. 2007;51:2201–4.CrossRef
17.
Zurück zum Zitat Goldstein C, Lee MD, Sanchez S, Hudson C, Phillips B, Register B, et al. Incidence of class 1 and 2 integrases in clinical and commensal bacteria from livestock, companion animals, and exotics. Antimicrob Agents Chemother. 2001;45:723–6.CrossRef Goldstein C, Lee MD, Sanchez S, Hudson C, Phillips B, Register B, et al. Incidence of class 1 and 2 integrases in clinical and commensal bacteria from livestock, companion animals, and exotics. Antimicrob Agents Chemother. 2001;45:723–6.CrossRef
18.
Zurück zum Zitat Lapierre L, Cornejo J, Borie C, Toro C, San Martín B. Genetic characterization of antibiotic resistance genes linked to class 1 and class 2 integrons in commensal strains of Escherichia coli isolated from poultry and swine. Microb Drug Resist. 2008;14:265–72.CrossRef Lapierre L, Cornejo J, Borie C, Toro C, San Martín B. Genetic characterization of antibiotic resistance genes linked to class 1 and class 2 integrons in commensal strains of Escherichia coli isolated from poultry and swine. Microb Drug Resist. 2008;14:265–72.CrossRef
19.
Zurück zum Zitat Cao X, Xu X, Zhang Z, Shen H, Chen J, Zhang K. Molecular characterization of clinical multidrug-resistant Klebsiella pneumoniae isolates. Ann Clin Microbiol Antimicrob. 2014;13:16.CrossRef Cao X, Xu X, Zhang Z, Shen H, Chen J, Zhang K. Molecular characterization of clinical multidrug-resistant Klebsiella pneumoniae isolates. Ann Clin Microbiol Antimicrob. 2014;13:16.CrossRef
20.
Zurück zum Zitat Khan AA, Ponce E, Nawaz MS, Cheng CM, Khan JA, West CS. Identification and characterization of class 1 integron resistance gene cassettes among Salmonella strains isolated from imported seafood. Appl Environ Microbiol. 2009;75:1192–6.CrossRef Khan AA, Ponce E, Nawaz MS, Cheng CM, Khan JA, West CS. Identification and characterization of class 1 integron resistance gene cassettes among Salmonella strains isolated from imported seafood. Appl Environ Microbiol. 2009;75:1192–6.CrossRef
21.
Zurück zum Zitat Li B, Hu Y, Wang Q, Yi Y, Woo PC, Jing H, et al. Structural diversity of class 1 integrons and their associated gene cassettes in Klebsiella pneumoniae isolates from a hospital in China. PLoS One. 2013;8:e75805.CrossRef Li B, Hu Y, Wang Q, Yi Y, Woo PC, Jing H, et al. Structural diversity of class 1 integrons and their associated gene cassettes in Klebsiella pneumoniae isolates from a hospital in China. PLoS One. 2013;8:e75805.CrossRef
22.
Zurück zum Zitat Wu K, Wang F, Sun J, Wang Q, Chen Q, Yu S, et al. Class 1 integron gene cassettes in multidrug-resistant gram-negative bacteria in southern China. Int J Antimicrob Agents. 2012;40:264–7.CrossRef Wu K, Wang F, Sun J, Wang Q, Chen Q, Yu S, et al. Class 1 integron gene cassettes in multidrug-resistant gram-negative bacteria in southern China. Int J Antimicrob Agents. 2012;40:264–7.CrossRef
23.
Zurück zum Zitat Gruteke P, Goessens W, Gils J, Peerbooms P, Lemmens-Den Toom N, Van Santen-Verheuvel M, et al. Patterns of resistance associated with integrons, the extended-spectrum β-lactamase SHV-5 gene, and a multidrug efflux pump of Klebsiella pneumoniae causing a nosocomial outbreak. J Clin Microbiol. 2003;41:1161–6.CrossRef Gruteke P, Goessens W, Gils J, Peerbooms P, Lemmens-Den Toom N, Van Santen-Verheuvel M, et al. Patterns of resistance associated with integrons, the extended-spectrum β-lactamase SHV-5 gene, and a multidrug efflux pump of Klebsiella pneumoniae causing a nosocomial outbreak. J Clin Microbiol. 2003;41:1161–6.CrossRef
24.
Zurück zum Zitat Firoozeh F, Zahraei-Salehi T, Shahcheraghi F, Karimi V, Aslani MM. Characterization of class I integrons among Salmonella enterica serovar Enteritidis isolated from human and poultry. FEMS Immunol Med Microbiol. 2011;64:237–43.CrossRef Firoozeh F, Zahraei-Salehi T, Shahcheraghi F, Karimi V, Aslani MM. Characterization of class I integrons among Salmonella enterica serovar Enteritidis isolated from human and poultry. FEMS Immunol Med Microbiol. 2011;64:237–43.CrossRef
25.
Zurück zum Zitat Firoozeh F, Shahcheraghi F, Zahraei-Salehi T, Karimi V, Aslani MM. Characterization of antimicrobial resistance profile and class I integrongs among Salmonella enterica serovars isolated from human clinical specimens in Tehran, Iran. Iran J Microbiol. 2011;3:112–7.PubMedPubMedCentral Firoozeh F, Shahcheraghi F, Zahraei-Salehi T, Karimi V, Aslani MM. Characterization of antimicrobial resistance profile and class I integrongs among Salmonella enterica serovars isolated from human clinical specimens in Tehran, Iran. Iran J Microbiol. 2011;3:112–7.PubMedPubMedCentral
26.
Zurück zum Zitat Sun J, Zhou M, Wu Q, Ni Y. Characterization of two novel gene cassettes, dfrA27 and aadA16, in a non-O1, non-O139 Vibrio cholerae isolate from China. Clin Microbiol Infect. 2010;16:1125–9.CrossRef Sun J, Zhou M, Wu Q, Ni Y. Characterization of two novel gene cassettes, dfrA27 and aadA16, in a non-O1, non-O139 Vibrio cholerae isolate from China. Clin Microbiol Infect. 2010;16:1125–9.CrossRef
27.
Zurück zum Zitat Adams-Sapper S, Sergeevna-Selezneva J, Tartof S, Raphael E, Diep BA, Perdreau-Remington F, et al. Globally dispersed mobile drug-resistance genes in gram-negative bacterial isolates from patients with bloodstream infections in a US urban general hospital. J Med Microbiol. 2012;61:968–74.CrossRef Adams-Sapper S, Sergeevna-Selezneva J, Tartof S, Raphael E, Diep BA, Perdreau-Remington F, et al. Globally dispersed mobile drug-resistance genes in gram-negative bacterial isolates from patients with bloodstream infections in a US urban general hospital. J Med Microbiol. 2012;61:968–74.CrossRef
28.
Zurück zum Zitat Rajaei B, Sepehri-Rad N, Badmasti F, Razavi MR, Aghasadeghi MR, Saboohi R, Rajaei T, Moshiri A, Siadat SD. Multiple-antibiotic resistance in Salmonella enterica serovars isolated in Iran harboring class 1 integrons. Br Microbiol Res J. 2015;5:186–93.CrossRef Rajaei B, Sepehri-Rad N, Badmasti F, Razavi MR, Aghasadeghi MR, Saboohi R, Rajaei T, Moshiri A, Siadat SD. Multiple-antibiotic resistance in Salmonella enterica serovars isolated in Iran harboring class 1 integrons. Br Microbiol Res J. 2015;5:186–93.CrossRef
29.
Zurück zum Zitat Firoozeh F, Zahraei-Salehi T, Shahcheraghi F. Molecular clonality and detection of class 1 integron in multidrug-resistant Salmonella enterica isolates from animal and human in Iran. Microb Drug Resist. 2014;20:517–24.CrossRef Firoozeh F, Zahraei-Salehi T, Shahcheraghi F. Molecular clonality and detection of class 1 integron in multidrug-resistant Salmonella enterica isolates from animal and human in Iran. Microb Drug Resist. 2014;20:517–24.CrossRef
30.
Zurück zum Zitat Shahcheraghi F, Rahmati Ghezelgeh F, Nobari S, Torabi E, Mousavi SF, Aslani MM, et al. Identification and characterization of class 1 integrons among atypical enteropathogenic Escherichia coli isolated from children under 5 years of age. Iran J Microbiol. 2014;6:156–62.PubMedPubMedCentral Shahcheraghi F, Rahmati Ghezelgeh F, Nobari S, Torabi E, Mousavi SF, Aslani MM, et al. Identification and characterization of class 1 integrons among atypical enteropathogenic Escherichia coli isolated from children under 5 years of age. Iran J Microbiol. 2014;6:156–62.PubMedPubMedCentral
31.
Zurück zum Zitat Huang LY, Chen TL, Lu PL, Tsai CA, Cho WL, Chang FY, et al. Dissemination of multidrug-resistant, class 1 integron-carrying Acinetobacter baumannii isolates in Taiwan. Clin Microbiol Infect. 2008;14:1010–9.CrossRef Huang LY, Chen TL, Lu PL, Tsai CA, Cho WL, Chang FY, et al. Dissemination of multidrug-resistant, class 1 integron-carrying Acinetobacter baumannii isolates in Taiwan. Clin Microbiol Infect. 2008;14:1010–9.CrossRef
32.
Zurück zum Zitat Chang CY, Fang YT, Tsai SM, Chang LL, Yu WL. Characterization of class 1 integrons and gene cassettes in clinical isolates of Klebsiella pneumoniae from Taiwan. Diagn Microbiol Infect Dis. 2009;65:214–6.CrossRef Chang CY, Fang YT, Tsai SM, Chang LL, Yu WL. Characterization of class 1 integrons and gene cassettes in clinical isolates of Klebsiella pneumoniae from Taiwan. Diagn Microbiol Infect Dis. 2009;65:214–6.CrossRef
33.
Zurück zum Zitat Karczmarczyk M, Abbott Y, Walsh C, Leonard N, Fanning S. Characterization of multidrug-resistant Escherichia coli isolates from animals presenting at a university veterinary hospital. Appl Environ Microbiol. 2011;77:7104–12.CrossRef Karczmarczyk M, Abbott Y, Walsh C, Leonard N, Fanning S. Characterization of multidrug-resistant Escherichia coli isolates from animals presenting at a university veterinary hospital. Appl Environ Microbiol. 2011;77:7104–12.CrossRef
34.
Zurück zum Zitat Taherikalani M, Maleki A, Sadeghifard N, Mohammadzadeh D, Soroush S, Asadollahi P, et al. Dissemination of class 1, 2 and 3 Integrons among different multidrug resistant isolates of Acinetobacter baumannii in Tehran hospitals, Iran. Pol J Microbiol. 2011;60:169–74.PubMed Taherikalani M, Maleki A, Sadeghifard N, Mohammadzadeh D, Soroush S, Asadollahi P, et al. Dissemination of class 1, 2 and 3 Integrons among different multidrug resistant isolates of Acinetobacter baumannii in Tehran hospitals, Iran. Pol J Microbiol. 2011;60:169–74.PubMed
35.
Zurück zum Zitat Memariani M, Najar Peerayeh S, Shokouhi Mostafavi SK, Zahraei-Salehi T. Detection of class 1 and 2 integrons among Enteropathogenic Escherichia coli isolates. Arch Pediatr Infect Dis. 2014;2:e16372. Memariani M, Najar Peerayeh S, Shokouhi Mostafavi SK, Zahraei-Salehi T. Detection of class 1 and 2 integrons among Enteropathogenic Escherichia coli isolates. Arch Pediatr Infect Dis. 2014;2:e16372.
36.
Zurück zum Zitat Kang HY, Jeong YS, Oh JY, Tae SH, Choi CH, Moon DC, et al. Characterization of antimicrobial resistance and class 1 integrons found in Escherichia coli isolates from humans and animals in Korea. J Antimicrob Chemother. 2005;55:639–44.CrossRef Kang HY, Jeong YS, Oh JY, Tae SH, Choi CH, Moon DC, et al. Characterization of antimicrobial resistance and class 1 integrons found in Escherichia coli isolates from humans and animals in Korea. J Antimicrob Chemother. 2005;55:639–44.CrossRef
37.
Zurück zum Zitat Cavicchio L, Dotto G, Giacomelli M, Giovanardi D, Grilli G, Franciosini MP, et al. Class 1 and class 2 integrons in avian pathogenic Escherichia coli from poultry in Italy. Poult Sci. 2015;94:1202–8.CrossRef Cavicchio L, Dotto G, Giacomelli M, Giovanardi D, Grilli G, Franciosini MP, et al. Class 1 and class 2 integrons in avian pathogenic Escherichia coli from poultry in Italy. Poult Sci. 2015;94:1202–8.CrossRef
38.
Zurück zum Zitat Roe MT, Vega E, Pillai SD. Antimicrobial resistance markers of class 1 and class 2 integron bearing Escherichia coli from irrigation water and sediments. Emerg Infect Dis. 2003;9:822–6.CrossRef Roe MT, Vega E, Pillai SD. Antimicrobial resistance markers of class 1 and class 2 integron bearing Escherichia coli from irrigation water and sediments. Emerg Infect Dis. 2003;9:822–6.CrossRef
39.
Zurück zum Zitat Eftekhari N, Bakhshi B, Pourshafie MR, Zarbakhsh B, Rahbar M, Hajia M, et al. Genetic diversity of Shigella spp. and their integron content. Foodborne Pathog Dis. 2012;10:237–42.CrossRef Eftekhari N, Bakhshi B, Pourshafie MR, Zarbakhsh B, Rahbar M, Hajia M, et al. Genetic diversity of Shigella spp. and their integron content. Foodborne Pathog Dis. 2012;10:237–42.CrossRef
Metadaten
Titel
Molecular characterization of class 1, 2 and 3 integrons in clinical multi-drug resistant Klebsiella pneumoniae isolates
verfasst von
Farzaneh Firoozeh
Zeinab Mahluji
Ahmad Khorshidi
Mohammad Zibaei
Publikationsdatum
01.12.2019
Verlag
BioMed Central
Erschienen in
Antimicrobial Resistance & Infection Control / Ausgabe 1/2019
Elektronische ISSN: 2047-2994
DOI
https://doi.org/10.1186/s13756-019-0509-3

Weitere Artikel der Ausgabe 1/2019

Antimicrobial Resistance & Infection Control 1/2019 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Costims – das nächste heiße Ding in der Krebstherapie?

28.05.2024 Onkologische Immuntherapie Nachrichten

„Kalte“ Tumoren werden heiß – CD28-kostimulatorische Antikörper sollen dies ermöglichen. Am besten könnten diese in Kombination mit BiTEs und Checkpointhemmern wirken. Erste klinische Studien laufen bereits.

Perioperative Checkpointhemmer-Therapie verbessert NSCLC-Prognose

28.05.2024 NSCLC Nachrichten

Eine perioperative Therapie mit Nivolumab reduziert das Risiko für Rezidive und Todesfälle bei operablem NSCLC im Vergleich zu einer alleinigen neoadjuvanten Chemotherapie um über 40%. Darauf deuten die Resultate der Phase-3-Studie CheckMate 77T.

Positiver FIT: Die Ursache liegt nicht immer im Dickdarm

27.05.2024 Blut im Stuhl Nachrichten

Immunchemischer Stuhltest positiv, Koloskopie negativ – in solchen Fällen kann die Blutungsquelle auch weiter proximal sitzen. Ein Forschungsteam hat nachgesehen, wie häufig und in welchen Lokalisationen das der Fall ist.

GLP-1-Agonisten können Fortschreiten diabetischer Retinopathie begünstigen

24.05.2024 Diabetische Retinopathie Nachrichten

Möglicherweise hängt es von der Art der Diabetesmedikamente ab, wie hoch das Risiko der Betroffenen ist, dass sich sehkraftgefährdende Komplikationen verschlimmern.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.