Mir-208 promotes cell proliferation by repressing SOX6 expression in human esophageal squamous cell carcinoma

Primary culture of normal esophageal epithelial cells (NEEC) was established from fresh specimens of the adjacent noncancerous esophageal tissue, which is over 5 cm from the cancerous tissue, according to a previous report [17]. The ESCC cell lines, including Kyse140, Kyse30, Kyse510, Kyse520, Eca109, TE-1, Kyse410, Kyse180, EC18, HKESC1 and 108CA, were grown in the Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS) (HyClone, Logan, UT, USA), 100 units of penicillin and 100 units of streptomycin at 37°C in a 5% CO₂ atmosphere in a humidified incubator.

For the use of the clinical materials for research purposes, prior patient consent and approval from the Institutional Research Ethics Committee were obtained. This study was conducted on 10 pairs of snap-frozen ESCC tumor and matched normal tissues from adjacent regions, which were histopathologically diagnosed at the First Affiliated Hospital of Sun Yat-sen University from 2001 to 2006. The 10 ESCC tissues and the matched adjacent noncancerous esophageal tissues were frozen and stored in liquid nitrogen until further use.

The miR-208 expression plasmid was generated by cloning the genomic pre-miR-208 gene, with 300-bp on each flanking side, into retroviral transfer plasmid pMSCV-puro (Clontech Laboratories Inc., Moutain View, CA, USA) to generate plasmid pMSCV-miR-208. The non-targeting control microRNA (negative control mimic), which are designed computationally to have no perfect seed-sequence matches to the transcriptome, was subcloned into retroviral transfer plasmid pMSCV to generate the plasmid pMSCV-NC. pMSCV-miR-208 or pMSCV-NC was cotransfected with the PIK packaging plasmid into 293FT cells using the standard calcium phosphate transfection method [18]. Thirty-six hours after cotransfection, supernatants were collected and incubated with cells to be infected for 24 hours in the presence of polybrene (2.5 μg/ml). After infection, puromycin (1.5 μg/ml) was used to select stably transduced cells over a 10-day period.

Total cellular RNA was extracted using the Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instruction. cDNAs were amplified and quantified in an ABI Prism 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) using dye SYBR Green I (Molecular Probes, Invitrogen). The primers selected were as follows:

Expression levels of genes were normalized to that of the housekeeping gene GAPDH as the control (GAPDH forward primer, 5′-GACTCATGACCACAGTCCA TGC-3′; reverse primer, 3′-AGAGGCAGGGATGATGTTCTG-5′), and calculated as 2^{-[(Ct of p21, CyclinD1) – (Ct of GAPDH)]}, where C_t represents the threshold cycle for each transcript. The expression of the miRNA was defined based on the threshold cycle (Ct), and relative expression levels were calculated as 2^{-[(Ct of miR-208) – (Ct of U6)]} after normalization with reference to expression of U6 small nuclear RNA.

Western blotting analysis was performed according to standard methods, as previously described [19]. The membranes were probed with polyclonal rabbit antibodies against anti-SOX6 (1:500; Abcam, Cambridge, MA, USA), anti-p21, anti-cyclinD1 and anti-Rb, anti-phosphorylated Rb (1:1,000; Cell Signaling, Danvers, MA, USA). The membranes were stripped and re-probed with an anti-α-Tubulin mouse monoclonal antibody (1:1,000; Sigma, Saint Louis, MO, USA) as a loading control.

The region of the human SOX6 3′-UTR, from 1 to 1100 bp, generated by PCR amplification from DNA of the Eca109 cells, was cloned into vector pGL3 (Promega, Madison, WI, USA). The primers selected were as follows: SOX6-3′UTR-wt-up: 5′- GCCCCGCGGTGGCTCCACAATTACATCAGC -3′, SOX6-3′UTR-wt-dn: 3′- GCCCTGCAGCATAAAATCACTATGTACACAGGA -5′. The miR-208 mimic, miR-208 inhibitor and negative control (NC) were purchased from RiboBio (RiboBio Co. Ltd, Guangzhou, Guangdong, China). For depletion of SOX6, the siRNA was synthesized and purified by RiboBio. The SOX6 siRNA sequences used were: CGGGAAACTGTCCTCCATAAA. Transfection of oligonucleotides and siRNA were performed using the Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instruction.

ESCC cells (3.5 × 10⁴) were seeded in triplicate in 24-well plates and allowed to settle for 12 h. One hundred nanograms of pGL3-SOX6-luciferase plasmid was transfected into ESCC cells using the Lipofectamine 2000 reagent (Invitrogen). Medium was replaced after 6 h, and luciferase and renilla signals were measured 48 h after transfection using the Dual Luciferase Reporter Assay Kit (Promega) according to the manufacturer’s protocol. Three independent experiments were performed and the data were presented as the mean ± SD.

Kyse30 and Kyse410 cells, seeded on 96-well plates, were stained at the indicated time points with 100 μl sterile MTT dye (0.5 mg/ml, Sigma) for 4 h at 37ºC, followed by removal of the culture medium and addition of 150 μl dimethyl sulfoxide (Sigma). The absorbance was measured at 570 nm, with 655 nm as the reference wavelength. All experiments were performed in triplicate.

Cells were plated on a 6-well plate (0.5 × 10³ cells per well) and cultured for 10 days. The colonies were stained with 1.0% crystal violet for 1 min after fixation with 10% formaldehyde for 5 min. The experiment was performed independently three times for each cell line.

One thousand cells were trypsinized and suspended in 2 ml complete medium plus 0.33% agar (Sigma). The agar-cell mixture was plated on top of a bottom layer comprising 0.66% complete medium agar mixture. After 10 days, colony sizes were measured with an ocular micrometer and colonies greater than 0.1 mm in diameter were counted. The experiment was performed for independently three times for each cell line.

All cells in a culture dish were harvested by trypsinization, washed in ice-cold PBS, and fixed in 80% ice-cold ethanol. Before staining, the cells were pelleted in a cooled centrifuge and resuspended in cold PBS. Bovine pancreatic RNAase (Sigma) was added at a final concentration of 2 μg/ml, and cells were incubated at 37°C for 30 min, followed by incubation in 20 μg/ml propidium iodide (Sigma) for 20 min at room temperature. 20,000 cells were analyzed on a flow cytometer (FACSCalibur; BD Biosciences, Bedford, MA, USA).

Student’s t test was used to evaluate the significant difference of two groups of data in all the pertinent experiments. A P value <0.05 (using a two-tailed paired t test) was considered significantly different for two groups of data.

Real-time PCR analysis revealed that miR-208 expression was markedly increased in all eleven ESCC cell lines, including Kyse140, Kyse30, Kyse510, Kyse520, Eca109, TE-1, Kyse410, Kyse180, EC18, HKESC1 and 108CA, compared with that in NEEC (Figure 1A). Moreover, comparative analysis revealed that miR-208 was significantly overexpressed in 10 pairs of cancerous tissues compared with the adjacent noncancerous esophageal tissues (Figure 1B). Collectively, these results suggested that miR-208 was upregulated in ESCC.

To investigate the effect of miR-208 on the development and progression of ESCC, Kyse30 and Kyse410 ESCC cells, which were with medium-level of miR-208 expression, stably overexpressing miR-208 were established (Figure 2A). The MTT and colony formation assays showed that overexpression of miR-208 dramatically increased the growth rate of both ESCC cell lines compared with that of control cells (Figure 2B and C). Importantly, the anchorage-independent growth assay revealed that both Kyse30-miR-208 and Kyse410-miR-208 cells showed more and larger-sized colonies than their corresponding control cells (Figure 2D). Moreover, we analyzed the cell cycle of Kyse30-miR-208 and Kyse410-miR-208 cells by flow cytometry, which showed a significant decrease in the percentage of cells in G1/G0 phase and an increase in the percentage of cells in S phase (Figure 2E). All these results suggested that upregulation of miR-208 promoted the proliferation and tumorigenicity of ESCC cells.

To further test whether endogenous miR-208 helps to sustain the proliferative property of ESCC cells, loss-of-function studies using a miR-208 inhibitor were used to further investigate whether endogenous miR-208 helps to maintain the proliferative properties of ESCC cells. As shown in Figure 3A, B and C, suppression of miR-208 by transfection with the miR-208 inhibitor significantly decreased the growth rate of both ESCC cell lines as compared with that of NC transfected cells. The anchorage-independent growth assay revealed that both Kyse30-miR-208-inhibitor and Kyse410-miR-208-inhibitor cells formed fewer and smaller-sized colonies than their corresponding negative control cells, indicating the inhibitory function of miR-208 inhibitor on ESCC tumorigenicity (Figure 3D). Additionally, flow cytometry showed a significant increase in the percentage of cells in G1/G0 phase and a decrease in the percentage of cells in S phase in Kyse30-miR-208-inhibitor and Kyse410-miR-208-inhibitor cells compared with NC transfected cells (Figure 3E). These results suggested that downregulation of miR-208 could suppress the proliferation and tumorigenicity of ESCC cells.

A previous study showed that SOX6 is a tumor-suppressor and plays an important role in ESCC progression [1]. Using publicly available algorithms (TargetScan, Pictar, miRANDA), we found that SOX6 was a potential target of miR-208 (Figure 4A). As predicted, western blotting analysis revealed that SOX6 expression decreased in the Kyse30 and Kyse410 ESCC cells ectopic expressing miR-208 and increased in cells suppressing miR-208 (Figure 4B). To examine whether miR-208 mediated-SOX6 downregulation was through the 3′-UTR of SOX6, the SOX6- 3′-UTR fragment, containing three miR-208 binding sites, was subcloned into a pGL3 luciferase reporter vector. The results of the luciferase reporter assay showed that overexpression of miR-208 decreased, and suppression of miR-208 increased, the luciferase activity of the SOX6 3′-UTR-luciferase reporter, whereas a miR-208 with mutated seed sequence failed to show an inhibitory effect on the luciferase activity (Figure 4C). Meanwhile, we observed that the mRNA of the SOX6 downstream gene, p21 was significantly downregulated, and that of Cyclin D1 was significantly upregulated, by miR-208 (Figure 4D). Moreover, the expression level of the p21 protein was downregulated, Cyclin D1 was upregulated, and phosphorylated Rb was increased in miR-208 overexpressing cells compared with the negative control cells. In contrast, the expression level of p21 was upregulated, Cyclin D1 was downregulated, and Rb phosphorylation was decreased in cells transfected with the miR-208 inhibitor (Figure 4E). Collectively, our results suggested that SOX6 was a bona fide target of miR-208.

To investigate the effect of SOX6 reduction on ESCC progression, we repressed endogenous SOX6 expression using a SOX6-specific siRNA (Figure 5A). The MTT assay and the colony formation assay both showed that silencing SOX6 in miR-208 inhibitor transfected cells increased the growth rate of the cells (Figure 5B and C). The anchorage-independent growth assay showed similar results (Figure 5D). All the results suggested that further silencing SOX6 expression in Kyse30-miR-208-inhibitor and Kyse410-miR-208-inhibitor cells could reverse the inhibitory effect of the miR-208 inhibitor on ESCC cells proliferation. These data confirmed that miR-208 promoted ESCC cells proliferation and tumorigenicity by repressing endogenous SOX6 expression and that SOX6 plays important role in miR-208-mediated cell proliferation.