Skip to main content
Erschienen in: Virology Journal 1/2014

Open Access 01.12.2014 | Short report

Rapid detection of porcine kobuvirus in feces by reverse transcription loop-mediated isothermal amplification

verfasst von: Changlong Li, Jianfei Chen, Hongyan Shi, Xin Zhang, Da Shi, Xiao Han, Yanbin Chi, Li Feng

Erschienen in: Virology Journal | Ausgabe 1/2014

Abstract

Background

PKV is a new emerging pathogen detected in diarrhea pigs. At present, no more detection methods were reported except RT-PCR method. this study was to develop a fast diagnostic method based on the LAMP reaction for rapid detection of PKV nucleic acid in fecal samples.

Findings

Two pairs of primers were designed to amplify the conservative 3D gene of PKV genome. The PKV RT-LAMP method possessed well specificity and had 100 times higher sensitivity than common reverse transcription PCR (RT-PCR), which could detect up to 10 RNA copies of the target gene.

Conclusions

The results showed that the optimal reaction condition for RT-LAMP was achieved at 64°C for 50 min. Furthermore, the RT-LAMP procedure does not demand special equipment and is time-saving.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1743-422X-11-73) contains supplementary material, which is available to authorized users.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

CL and LF designed the experiment. CL carried out most of the experiments and wrote the manuscript. CL, XH and YC prepared the fecal samples and organized the data. DS participated in some of the experiments. JC, XZ and HS revised the manuscript. All the authors read and approved the final manuscript.

Introduction

Kobuvirus belongs to the family Picornaviridae, a small and non-enveloped virus with a single stranded, positive-sense genomic RNA. The genus Kobuvirus consists of three species, Aichivirus A (formerly Aichi virus), Aichivirus B (formerly Bovine kobuvirus) and Aichivirus C (aka porcine kobuvirus). Kobuviruses have a wide range of host species including humans [1], cattle [2], pigs [3], sheep [4], bats [5], canine [6], cats [7], ferrets [8] and goats [9].
PKV was first identified from stool specimens of clinically healthy and diarrhea domestic pigs in 2007 in Hungary [10]. In the past several years PKV has been identified in China [11], Thailand [12], Japan [13], Korea [14], USA [15],Italy [16] and Brazil [17].
During the past three years, China has suffered from severe porcine diarrhea and serious economic loss. Apart from the three main viruses, Porcine Epidemic Diarrhea Virus (PEDV), Transmissible Gastroenteritis Virus (TGEV) and A group Porcine Rotavirus (PoRV), which causing porcine diarrhea, PKV was identified from the diarrhea pigs, separately existed or mixed infected with the three viruses. Recent studies indicated that PKV was involved in swine diarrhea and may act as a special part in gastroenteritis pathogenesis [10]. Early detection and diagnosis can serve to control the spread of PKV and decrease economic loss.
Most studies investigating the distribution and prevalence of PKV employed reverse transcription-polymerase chain reaction (RT-PCR) method to amplify the conserved region, which targeting the 3D region of PKV genome [18, 19]. At present, no more detection methods were reported except RT-PCR method. Sequence analysis indicated the 3D region is the most conservative, which suggests that the 3D region could be selected as the target sequence for loop-mediated isothermal amplification detection to investigate the distribution and prevalence of PKV.
As PCR requires an expensive thermal cycler and operator skill, which are limited to the field, a novel technique, loop-mediated isothermal amplification (LAMP) was developed by Notomi et al.[20] to overcome the difficulties of PCR-based techniques. RT-LAMP assays are more sensitive than conventional gel-based RT-PCR assays, fast and easy to perform since they require only a simple incubator, such as a heating block or a water bath to provide a constant temperature for the reaction [21]. This technique just requires only 30 to 60 minutes and can be performed at a single temperature ranging from 60°C to 65°C. Therefore, this study was to develop a fast diagnostic method based on the LAMP reaction for rapid detection of PKV nucleic acid in fecal samples.

Materials and methods

Primers for RT-LAMP and RT-PCR

LAMP primers were designed using Primer Explorer V4 software (Eiken Chemical Co., Ltd., Japan) (Table 1). The PKV (CH/HZ/2011, JX827598) specific primers used for RT-PCR were: sense PKV-S1 (5’-GGAAGAGGCGATCAATGGAAC-3’) (nucleotide location: 6805–6825) and antisense PKV-R1 (5’-GGCGTTCGAGGTGTTTCTCAAC-3’) (nucleotide location: 7277–7298) targeting a 494 bp fragment of the 3D region of PKV genome.
Table 1
LAMP primers for detection of PKV
Primer name
Length
Type
Genome position
Sequence (5'-3')
F3
18
Forward outer
7525-7342
CCCGCTACATCGAGACCA
B3
20
Reverse outer
7530-7549
TGGGTGGATCACACCCATAG
FIP
42
Forward inner
F1:7395-7416
GCCAACACATCCAGACGGGTTA-
F2:7350-7369
CTCACGCCATGTCTTTGGTA
BIP
42
Reverse inner
B1:7450-7471
TGTGTCCTCTCCGCTCTGATCC-
 
B2:7510-7529
ATCACATCATCACCGTAGGC
The position of LAMP primers are shown relative to the CH/HZ/2011 strain PKV (Accession No. JX827598).

RNA extraction

135 Fecal samples (from Heilongjiang, Jilin, Jiangxi, Jiangsu and Guangdong province) were collected from Diagnostic Center of Harbin Veterinary Research Institute and stored at −20°C. Stool specimens were converted to 10% (w/v) suspensions in PBS (0.01 M phosphate, pH 7.2-7.4, 0.15 M NaCl) for RNA extraction. Total RNA was extracted from 400 μl suspensions using TRIZOL reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. The RNA was stored at −80°C until use.

RT-LAMP and RT-PCR assays

The RT-LAMP was carried out in a volume of 25 μl. The optimized reaction mixture contains 40 pmol of inner primers FIP and BIP, 5 pM of outer primers F3 and B3, 35 pM dNTP (TaKaRa, Japan), 1× ThermoPol buffer (New England Biolabs, UK), 6 mM MgSO4 (TaKaRa, Japan), 1 μl betaine (Sigma, USA) and 8 U of Bst DNA polymerase (large fragment; New England Biolabs), 20 U M-MLV reverse transcriptase (TaKaRa, Japan) and 1 μl of template.
To determine the optimal reaction temperature, the RT-LAMP reaction mixtures were incubated at 62, 63, 64 and 65°C for 60 min. The optimal reaction time was determined by performing the RT-LAMP at the optimal temperature for 30, 40, 50 and 60 min. Finally, the reaction was terminated by heat inactivation at 80°C for 5 min.
The RT-PCR amplification was carried out in a 50 μl reaction mix by One-step RNA PCR Mix (AMV) (TaKaRa, Japan) according to the manufacturer's instructions. The RT-PCR was as follows: 50°C 30 min; 94°C 2 min; 94°C 30 s, 60°C 30 s, 72°C 30 s, 30 cycles; 72°C 6 min. RT-LAMP and RT-PCR products were electrophoresed through a 2% agarose gel after reaction.

Sensitivity between RT-LAMP and RT-PCR

To compare the sensibilities of RT-PCR and RT-LAMP, F3/B3 and PKV-S1/R1 primers were used to amplify the target fragments and linked to pET-30a vector (with T7 promoter), then sequenced as the templates for RNA transcription. The standard RNAs were transcribed from the plasmid DNAs by using mMESSAGE mMACHINE T7 kit (Ambion). The RNAs were calculated the RNA copy numbers and diluted with different gradients (109 ~ 10° copies/μl). The RNAs with gradient dilution were regarded as the templates for the comparison of sensitivity between RT-PCR and RT-LAMP detection.

Specificity of RT-LAMP and RT-PCR

For confirmation of the specificity of the RT-LAMP products, PEDV, TGEV, A group PoRV, which could cause pig diarrhea, two members of porcine picornaviruses PEV 9 (Porcine Enterovirus 9) and PTV (Porcine Teschovirus) were also added to the specificity assay. The above mentioned RNA templates were tested by RT-LAMP reactions.

Results

RT-LAMP detection of PKV

RT-LAMP products were electrophoresed through a 2% agarose gel, which yielded typical ladder-like bands (Figure 1A). For visual detection of LAMP products, SYBR green I dye (diluted 1:1000) was added to LAMP reaction and exposed to UV light. The positive LAMP showed green fluorescence while the negative control was with no green fluorescence (Figure 1B).

Optimal temperature and time for the PKV RT-LAMP assay

The optimal reaction temperature and incubation time of the RT-LAMP were investigated. The DNA products of the RT-LAMP at different temperatures showed multiple of characteristic ladder bands. The agarose gel analysis indicated that the intensity of DNAs at 64°C was stronger than other reaction temperatures (Figure 2A). Then RT-LAMP was performed at 64°C for different time points. As shown in Figure 2B, the DNA product showed the highest intensity when the reaction was performed for 50 min. Therefore, the optimal reaction condition of the PKV RT-LAMP was 64°C for 50 min.

Sensitivity between RT-LAMP and RT-PCR

The clones contains the target fragments were diluted from 109 ~ 10° copies/μl. The detection limit of RT-LAMP was 101 copies (Figure 3A) while RT-PCR was 103 copies (Figure 3B).

Specificity of RT-LAMP and RT-PCR

The specificity of RT-LAMP was showed in Figure 4, which demonstrated that the developed RT-LAMP and RT-PCR could specifically distinguish PKV genome, without cross-reaction to PEDV, TGEV, A group PoRV, PEV 9 and PTV (Figure 4).

Concordance of RT-LAMP and RT-PCR

PKV RT-LAMP assay was compared to RT-PCR detection by utilizing 135 clinical feces samples. Results indicated that LAMP was more sensitive than RT-PCR method. The concordance of the two methods was 88.1% (Table 2).
Table 2
Comparison of concordance between LAMP and RT-PCR for detection of PKV
Detection method
Positive
Negative
Total
Concordance
LAMP
101
34
135
88.1%
RT-PCR
89
46
135
 

Discussion

Porcine kobuvirus, a new species of the genus Kobuvirus in the family Picornaviridae, had been reported prevalent in many countries. The information about this virus is still limited and it is uncertain whether porcine kobuvirus is involved in pig diarrhea as it can be detected in both diarrhea and healthy pigs. Up to now, porcine kobuvirus has not been successful purified, which limited further study of the virus. More researches need to be done to reveal its feature and pathogenicity.
RT-PCR detection of the 3D region has been widely used for the identification and epidemiological study of porcine kobuvirus [1416]. At present, RT-PCR is the unique detection method to detect the nucleic acid of PKV and no more detection methods were reported. Furthermore, RT-LAMP is used increasingly for clinical diagnosis of many pathogens including Newcastle disease virus, Salmonella enterica, porcine circovirus, and porcine parvovirus [2124].
To summarize, the PKV RT-LAMP was established with high sensitivity and specificity. Compared to the RT-PCR method, this assay is with higher analytical and clinical sensitivity. As the RT-LAMP method is easy to set up and does not need additional equipment, it gets obvious advantages in clinical diagnosis better than the conventional PCR method.

Acknowledgments

This work was supported by grants from National Natural Science Foundation of China (31172350), the Central Public-Interest Scientific Institution Basal Research Fund (0302013002), Higher school science and technology innovation team project of Heilongjiang province (2011TD001).
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
The Creative Commons Public Domain Dedication waiver (https://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

CL and LF designed the experiment. CL carried out most of the experiments and wrote the manuscript. CL, XH and YC prepared the fecal samples and organized the data. DS participated in some of the experiments. JC, XZ and HS revised the manuscript. All the authors read and approved the final manuscript.
Anhänge

Authors’ original submitted files for images

Literatur
1.
Zurück zum Zitat Yamashita T, Kobayashi S, Sakae K, Nakata S, Chiba S, Ishihara Y, Isomura S: Isolation of cytopathic small round viruses with BS-C-1 cells from patients with gastroenteritis. J Infect Dis. 1991, 164: 954-957. 10.1093/infdis/164.5.954.PubMedCrossRef Yamashita T, Kobayashi S, Sakae K, Nakata S, Chiba S, Ishihara Y, Isomura S: Isolation of cytopathic small round viruses with BS-C-1 cells from patients with gastroenteritis. J Infect Dis. 1991, 164: 954-957. 10.1093/infdis/164.5.954.PubMedCrossRef
2.
Zurück zum Zitat Yamashita T, Ito M, Kabashima Y, Tsuzuki H, Fujiura A, Sakae K: Isolation and characterization of a new species of kobuvirus associated with cattle. J Gen Virol. 2003, 84: 3069-3077. 10.1099/vir.0.19266-0.PubMedCrossRef Yamashita T, Ito M, Kabashima Y, Tsuzuki H, Fujiura A, Sakae K: Isolation and characterization of a new species of kobuvirus associated with cattle. J Gen Virol. 2003, 84: 3069-3077. 10.1099/vir.0.19266-0.PubMedCrossRef
3.
Zurück zum Zitat Reuter G, Boldizsar A, Kiss I, Pankovics P: Candidate new species of Kobuvirus inporcine hosts. Emerging Infect Dis. 2008, 14: 1968-1970. 10.3201/eid1412.080797.PubMedPubMedCentralCrossRef Reuter G, Boldizsar A, Kiss I, Pankovics P: Candidate new species of Kobuvirus inporcine hosts. Emerging Infect Dis. 2008, 14: 1968-1970. 10.3201/eid1412.080797.PubMedPubMedCentralCrossRef
4.
Zurück zum Zitat Reuter G, Kecskemeti S, Pankovics P: Evolution of porcine kobuvirus infection, Hungary. Emerging Infect Dis. 2010, 16: 696-698. 10.3201/eid1604.090937.PubMedPubMedCentralCrossRef Reuter G, Kecskemeti S, Pankovics P: Evolution of porcine kobuvirus infection, Hungary. Emerging Infect Dis. 2010, 16: 696-698. 10.3201/eid1604.090937.PubMedPubMedCentralCrossRef
5.
Zurück zum Zitat Li L, Victoria JG, Wang C, Jones M, Fellers GM, Kunz TH, Delwart E: Bat guano virome: Predominance of dietary viruses from insects and plants plus novel mammalian viruses. J Virol. 2010, 84: 6955-6965. 10.1128/JVI.00501-10.PubMedPubMedCentralCrossRef Li L, Victoria JG, Wang C, Jones M, Fellers GM, Kunz TH, Delwart E: Bat guano virome: Predominance of dietary viruses from insects and plants plus novel mammalian viruses. J Virol. 2010, 84: 6955-6965. 10.1128/JVI.00501-10.PubMedPubMedCentralCrossRef
6.
Zurück zum Zitat Kapoor A, Simmonds P, Dubovi EJ, Qaisar N, Henriquez JA, Medina J, Shields S: Lipkin WI :Characterization of a canine homolog of human Aichi virus. J Virol. 2011, 85: 11520-115257. 10.1128/JVI.05317-11.PubMedPubMedCentralCrossRef Kapoor A, Simmonds P, Dubovi EJ, Qaisar N, Henriquez JA, Medina J, Shields S: Lipkin WI :Characterization of a canine homolog of human Aichi virus. J Virol. 2011, 85: 11520-115257. 10.1128/JVI.05317-11.PubMedPubMedCentralCrossRef
7.
Zurück zum Zitat Chung JY, Kim SH, Kim YH, Lee MH, Lee KK, Oem JK: Detection and genetic characterization of feline kobuviruses. Virus Genes. 2013, 47: 559-562. 10.1007/s11262-013-0953-8.PubMedCrossRef Chung JY, Kim SH, Kim YH, Lee MH, Lee KK, Oem JK: Detection and genetic characterization of feline kobuviruses. Virus Genes. 2013, 47: 559-562. 10.1007/s11262-013-0953-8.PubMedCrossRef
8.
Zurück zum Zitat Smits SL, Raj VS, Oduber MD, Schapendonk CM, Bodewes R, Provacia L, Stittelaar KJ, Osterhaus AD, Haagmans BL: Metagenomic analysis of the ferret fecal viral flora. PLoS One. 2013, 8: e71595-10.1371/journal.pone.0071595.PubMedPubMedCentralCrossRef Smits SL, Raj VS, Oduber MD, Schapendonk CM, Bodewes R, Provacia L, Stittelaar KJ, Osterhaus AD, Haagmans BL: Metagenomic analysis of the ferret fecal viral flora. PLoS One. 2013, 8: e71595-10.1371/journal.pone.0071595.PubMedPubMedCentralCrossRef
9.
Zurück zum Zitat Lee MH, Jeoung HY, Lim JA, Song JY, Song DS, An DJ: Kobuvirus in South Korean black goats. Virus Genes. 2012, 45: 186-189. 10.1007/s11262-012-0745-6.PubMedCrossRef Lee MH, Jeoung HY, Lim JA, Song JY, Song DS, An DJ: Kobuvirus in South Korean black goats. Virus Genes. 2012, 45: 186-189. 10.1007/s11262-012-0745-6.PubMedCrossRef
10.
Zurück zum Zitat Barry AF, Ribeiro J, Alfieri AF, van der Poel WH, Alfieri AA: First detection of kobuvirus in farm animals in Brazil and the Netherlands. Infect Genet Evol. 2011, 11 (7): 1811-1814. 10.1016/j.meegid.2011.06.020.PubMedCrossRef Barry AF, Ribeiro J, Alfieri AF, van der Poel WH, Alfieri AA: First detection of kobuvirus in farm animals in Brazil and the Netherlands. Infect Genet Evol. 2011, 11 (7): 1811-1814. 10.1016/j.meegid.2011.06.020.PubMedCrossRef
11.
Zurück zum Zitat Yu J, Jin M, Zhang Q, Li H, Li D, Xu Z, Li J, Cui S, Yang S, Liu N, Duan ZJ: Candidate porcine Kobuvirus, China. Emerg Infect Dis. 2009, 15: 823-825. 10.3201/eid1505.081518.PubMedPubMedCentralCrossRef Yu J, Jin M, Zhang Q, Li H, Li D, Xu Z, Li J, Cui S, Yang S, Liu N, Duan ZJ: Candidate porcine Kobuvirus, China. Emerg Infect Dis. 2009, 15: 823-825. 10.3201/eid1505.081518.PubMedPubMedCentralCrossRef
12.
Zurück zum Zitat Khamrin P, Maneekarn N, Kongkaew A, Kongkaew S, Okitsu S, Ushijima H: Porcine kobuvirus in piglets, Thailand. Emerg Infect Dis. 2009, 15: 2075-2076. 10.3201/eid1512.090724.PubMedPubMedCentralCrossRef Khamrin P, Maneekarn N, Kongkaew A, Kongkaew S, Okitsu S, Ushijima H: Porcine kobuvirus in piglets, Thailand. Emerg Infect Dis. 2009, 15: 2075-2076. 10.3201/eid1512.090724.PubMedPubMedCentralCrossRef
13.
Zurück zum Zitat Khamrin P, Maneekarn N, Hidaka S, Kishikawa S, Ushijima K, Okitsu S, Ushijima H: Molecular detection of kobuvirus sequences in stool samples collected from healthy pigs in Japan. Infect Genet Evol. 2010, 10: 950-954. 10.1016/j.meegid.2010.06.001.PubMedCrossRef Khamrin P, Maneekarn N, Hidaka S, Kishikawa S, Ushijima K, Okitsu S, Ushijima H: Molecular detection of kobuvirus sequences in stool samples collected from healthy pigs in Japan. Infect Genet Evol. 2010, 10: 950-954. 10.1016/j.meegid.2010.06.001.PubMedCrossRef
14.
Zurück zum Zitat Park S, Kim H, Moon H, Song D, Rho S, Han J, Nguyen V, Park B: Molecular detection of porcine kobuviruses in pigs in Korea and their association with diarrhea. Arch Virol. 2010, 155: 1803-1811. 10.1007/s00705-010-0774-1.PubMedCrossRef Park S, Kim H, Moon H, Song D, Rho S, Han J, Nguyen V, Park B: Molecular detection of porcine kobuviruses in pigs in Korea and their association with diarrhea. Arch Virol. 2010, 155: 1803-1811. 10.1007/s00705-010-0774-1.PubMedCrossRef
15.
Zurück zum Zitat Verma H, Mor S, Abdel M, Goyal S: Identification and molecular characterization of porcine kobuvirus in U. S. swine. Virus Gene. 2013, 46: 551-553. 10.1007/s11262-013-0879-1.CrossRef Verma H, Mor S, Abdel M, Goyal S: Identification and molecular characterization of porcine kobuvirus in U. S. swine. Virus Gene. 2013, 46: 551-553. 10.1007/s11262-013-0879-1.CrossRef
16.
Zurück zum Zitat Di Profio F, Ceci C, Di Felice E, Marsilio F, Di Martino B: Molecular detection of porcine kobuviruses in Italian swine. Res Vet Sci. 2013, 95: 782-785. 10.1016/j.rvsc.2013.06.020.PubMedCrossRef Di Profio F, Ceci C, Di Felice E, Marsilio F, Di Martino B: Molecular detection of porcine kobuviruses in Italian swine. Res Vet Sci. 2013, 95: 782-785. 10.1016/j.rvsc.2013.06.020.PubMedCrossRef
17.
Zurück zum Zitat Ribeiro J, Arruda R, Alfieri A, Alfieri A: High frequency of Aichivirus C (porcine kobuvirus) infection in piglets from different geographic regions of Brazil. Trop Anim Health Prod. 2013, 45: 1757-1762. 10.1007/s11250-013-0428-x.PubMedCrossRef Ribeiro J, Arruda R, Alfieri A, Alfieri A: High frequency of Aichivirus C (porcine kobuvirus) infection in piglets from different geographic regions of Brazil. Trop Anim Health Prod. 2013, 45: 1757-1762. 10.1007/s11250-013-0428-x.PubMedCrossRef
18.
Zurück zum Zitat Ge F, Yang D, Ju H, Wang J, Liu J, Liu P, Zhou J: Epidemiological survey of porcine epidemic diarrhea virus in swine farms in Shanghai, China. Arch Virol. 2013, 158: 2227-2231. 10.1007/s00705-013-1722-7.PubMedCrossRef Ge F, Yang D, Ju H, Wang J, Liu J, Liu P, Zhou J: Epidemiological survey of porcine epidemic diarrhea virus in swine farms in Shanghai, China. Arch Virol. 2013, 158: 2227-2231. 10.1007/s00705-013-1722-7.PubMedCrossRef
19.
Zurück zum Zitat Shi D, Zhang S, Chen J, Shi H, Zhang X, Feng L: Molecular characterization of a porcine kobuvirus variant strain in China. Arch Virol. 2013, 158: 2379-2383. 10.1007/s00705-013-1736-1.PubMedCrossRef Shi D, Zhang S, Chen J, Shi H, Zhang X, Feng L: Molecular characterization of a porcine kobuvirus variant strain in China. Arch Virol. 2013, 158: 2379-2383. 10.1007/s00705-013-1736-1.PubMedCrossRef
20.
Zurück zum Zitat Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T: Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28: 63-10.1093/nar/28.12.e63.CrossRef Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T: Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28: 63-10.1093/nar/28.12.e63.CrossRef
21.
Zurück zum Zitat Pham H, Nakajima C, Ohashi K, Onuma M: Loop-mediated isothermal amplification for rapid detection of newcastle disease virus. J Clin Microbiol. 2005, 43: 1646-1650. 10.1128/JCM.43.4.1646-1650.2005.PubMedPubMedCentralCrossRef Pham H, Nakajima C, Ohashi K, Onuma M: Loop-mediated isothermal amplification for rapid detection of newcastle disease virus. J Clin Microbiol. 2005, 43: 1646-1650. 10.1128/JCM.43.4.1646-1650.2005.PubMedPubMedCentralCrossRef
22.
Zurück zum Zitat Ohtsuka K, Yanagawa K, Takatori K, Hara Y: Detection of Salmonella enterica in naturally contaminated liquid eggs by loop-mediated isothermal amplification, and characterization of salmonella isolates. Appl Environ Microb. 2005, 71: 6730-6735. 10.1128/AEM.71.11.6730-6735.2005.CrossRef Ohtsuka K, Yanagawa K, Takatori K, Hara Y: Detection of Salmonella enterica in naturally contaminated liquid eggs by loop-mediated isothermal amplification, and characterization of salmonella isolates. Appl Environ Microb. 2005, 71: 6730-6735. 10.1128/AEM.71.11.6730-6735.2005.CrossRef
23.
Zurück zum Zitat Chen C, Cui S: Detection of porcine parvovirus by loop-mediated isothermal amplification. J Virol Methods. 2009, 155: 122-125. 10.1016/j.jviromet.2008.10.004.PubMedCrossRef Chen C, Cui S: Detection of porcine parvovirus by loop-mediated isothermal amplification. J Virol Methods. 2009, 155: 122-125. 10.1016/j.jviromet.2008.10.004.PubMedCrossRef
24.
Zurück zum Zitat Chen H, Zhang J, Sun D, Chu Y, Cai X, Liu X, Luo X, Liu Q, Liu Y: Rapid detection of porcine circovirus type 2 by loop-mediated isothermal amplification. J Virol Methods. 2008, 149: 264-268. 10.1016/j.jviromet.2008.01.023.PubMedCrossRef Chen H, Zhang J, Sun D, Chu Y, Cai X, Liu X, Luo X, Liu Q, Liu Y: Rapid detection of porcine circovirus type 2 by loop-mediated isothermal amplification. J Virol Methods. 2008, 149: 264-268. 10.1016/j.jviromet.2008.01.023.PubMedCrossRef
Metadaten
Titel
Rapid detection of porcine kobuvirus in feces by reverse transcription loop-mediated isothermal amplification
verfasst von
Changlong Li
Jianfei Chen
Hongyan Shi
Xin Zhang
Da Shi
Xiao Han
Yanbin Chi
Li Feng
Publikationsdatum
01.12.2014
Verlag
BioMed Central
Erschienen in
Virology Journal / Ausgabe 1/2014
Elektronische ISSN: 1743-422X
DOI
https://doi.org/10.1186/1743-422X-11-73

Weitere Artikel der Ausgabe 1/2014

Virology Journal 1/2014 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.

Therapiestart mit Blutdrucksenkern erhöht Frakturrisiko

25.04.2024 Hypertonie Nachrichten

Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.